ABCMdb

PMID: 10581253

Blott EJ, Higgins CF, Linton KJ
Cysteine-scanning mutagenesis provides no evidence for the extracellular accessibility of the nucleotide-binding domains of the multidrug resistance transporter P-glycoprotein.
EMBO J. 1999 Dec 1;18(23):6800-8., 1999-12-01 [PubMed]

Sentences

No. Mutations Sentence Comment

36 ABCB1 p.Asn280Cys ABCB1 p.Gly324Cys Two additional single-cysteine (SC) mutants (N280C and G324C), known to be located in an intracellular and extracellular loop of TMD1, respectively (Loo and Clarke, 1995), were also generated as controls. Login to comment 38 ABCB1 p.Asn280Cys ABCB1 p.Gly324Cys P-gp-cys- and 21 of the 30 SC mutants (including the control mutants SC-N280C and SC-G324C) expressed full-length protein in both the lower molecular weight non-glycosylated and the higher molecular weight glycosylated forms (Figure 2). Login to comment 39 ABCB1 p.Pro549Cys ABCB1 p.Arg580Cys ABCB1 p.Val569Cys ABCB1 p.Lys578Cys Four SC mutants (P549C, V569C, K578C and R580C) were expressed at significantly lower levels than wild-type P-gp, but use of an alternative transfection reagent (lipofectamine) allowed sufficient expression for further analysis. Login to comment 59 ABCB1 p.Pro549Cys ABCB1 p.Arg580Cys ABCB1 p.Arg580Cys ABCB1 p.Val569Cys ABCB1 p.Lys578Cys ABCB1 p.Lys578Cys Cells were transiently transfected with the relevant cDNA, using lipofectin or lipofectamine (for SC mutants P549C, V569C, K578C and R580C), and 75 µg of whole cell lysate (150 µg for K578C and R580C) was added per lane. Login to comment 61 ABCB1 p.Leu554Cys ABCB1 p.Ile488Cys mutations L554C and I488C resulted in proteins that had approximately half and twice the activity of P-gp-cys-, respectively. Login to comment 66 ABCB1 p.Asn280Cys ABCB1 p.Gly324Cys To establish the validity of the assay, SC-P-gp mutants G324C (known to be exposed in an extracellular loop of TMD1) and N280C (known to be located in an intracellular loop of TMD1) were used as positive and negative controls, respectively. Login to comment 67 ABCB1 p.Asn280Cys ABCB1 p.Gly324Cys In intact cells, the higher molecular weight, glycosylated P-gp-G324C was biotinylated while neither form of P-gp- N280C was biotinylated (Figure 4A), as expected. Login to comment 68 ABCB1 p.Asn280Cys To demonstrate that P-gp-N280C was expressed and could be labelled by BM, the same assay was carried out in the presence of saponin, a gentle membrane permeabilizing agent. Login to comment 69 ABCB1 p.Asn280Cys ABCB1 p.Asn280Cys ABCB1 p.Gly324Cys ABCB1 p.Gly324Cys In this case, both the mature and immature (nonglycosylated) forms of G324C and N280C P-gp were labelled equivalently (Figure 4B): immature P-gp is likely to be confined to intracellular membranes and so accessible to BM only after permeabilization of the cell. Login to comment 87 ABCB1 p.Ile488Cys ABCB1 p.Ile500Cys ABCB1 p.Tyr490Cys ABCB1 p.Ile469Cys However, for some of the mutant P-gps (I469C, I488C, Y490C and I500C) only the immature form was labelled. Login to comment 190 ABCB1 p.Asn280Cys ABCB1 p.Gly324Cys ABCB1 p.Pro549Cys ABCB1 p.Val569Cys ABCB1 p.Lys578Cys ABCB1 p.Leu554Cys ABCB1 p.Ile488Cys ABCB1 p.Ile500Cys ABCB1 p.Tyr490Cys ABCB1 p.Ile469Cys ABCB1 p.Ser565Cys ABCB1 p.Glu638Cys ABCB1 p.Lys519Cys ABCB1 p.Arg547Cys ABCB1 p.Lys502Cys ABCB1 p.Lys536Cys ABCB1 p.Asp498Cys ABCB1 p.Lys515Cys ABCB1 p.Phe465Cys ABCB1 p.Gln456Cys ABCB1 p.Ala529Cys ABCB1 p.Thr581Cys ABCB1 p.Ser474Cys ABCB1 p.Asp511Cys ABCB1 p.Asn508Cys ABCB1 p.Ser403Cys ABCB1 p.Val495Cys Oligonucleotides used for site-directed mutagenesis pSC-name Diagnostic restriction site Mutagenic oligonucleotide sequence 5Ј-3Ј N280C ϩAvaI GGTACAACAAATGTCTCGAGGAAGCTAAAAG G324C -AflIII CCTTGGTCTTATCATGTGAATATTCTATTGG S403C ϩPstI CTTCAGTTACCCCTGCAGAAAAGAAGTTAAG S419C ϩEco57I GAACCTGAAAGTGCAGTGTGGGCAGACG Q456C ϩBstEI GTTGATGGATGCGATATCCGGACCATAAATG F465C ϩBanI ATGTAAGGTGCCTACGGGAA I469C ϩNsiI CTACGGGAATGCATTGGTGT S474C ϩHpaII GGTGTCGTGTGTCAGGAACCGGTATTGTTT T482C ϩBsrGI GTATTGTTTGCCTGTACAATAGCTGAAAAC I488C ϩEclXI GCTGAAAACTGTCGCTACGGCCGTGAAAATG Y490C none ACATTCGCTGTGGCCGTGA V495C ϩBsrGI GGCCGTGAAAATTGTACAATGGATGAGATTG D498C -NcoI GTCACCATGTGTGAGATTGAG I500C ϩBsmI GTCACCATGGATGAATGCGAGAAAGCTGTC K502C ϩBsmI GGATGAGATTGAATGCGCTGTCAAGGAAG N508C ϩFspI GTCAAGGAAGCATGCGCATATGACTTTATC D511C ϩAflIII GGAAGCCAACGCGTATTGCTTTATCATG K515C ϩAflIII GAAGCCAACGCGTATGACTTTATCATGTGCCTGCCTCAT K519C ϩStyI GAAACTGCCTCATTGCTTTGACACCTTGGTTGGAGAGAGAG A529C ϩBanI GAGAGAGGGTGCCAGTTGAG K536C ϩBlpI GAGAGAGAGGCGCCCAGTTGAGTGGTGGGCAGTGCCAGAGGATCG R547C ϩBssSI GCACGTGCCCTCGTGTGCAACCCCAAG P549C ϩSspI TGGTTCGCAACTGCAAAATATTCCTGCTGGA L554C ϩSspI CGCAACCCCAAAATATTGCTGTGCGATGAGGCCACG S565C ϩBsmI GACACAGAATGCGAAGCAG V569C ϩBsmI GACACAGAATGCGAAGCAGTGTGTCAGGTGG K578C ϩBsiEI GATAAGGCCAGATGCGGCCGGACCACC R580C -MslI GCCACAAAAGGTTGCACGACCATTGTGATA T581C ϩApaLI GAAAAGGTCGGTGCACCATTGTG E638C ϩEclXI GAAGTTGAATTATGCAATGCGGCCGATGAATC 'ϩ` represents the introduction of a new restriction endonuclease site; '-` represents the removal of an existing site. Login to comment