ABCMdb

ABCC2 p.Thr486Ile

Predicted by SNAP2:	A: N (57%), C: D (75%), D: D (63%), E: D (66%), F: D (85%), G: D (63%), H: D (59%), I: D (71%), K: N (53%), L: D (71%), M: D (63%), N: N (61%), P: D (75%), Q: N (61%), R: D (66%), S: N (61%), V: D (63%), W: D (91%), Y: D (80%),
Predicted by PROVEAN:	A: N, C: D, D: N, E: N, F: D, G: D, H: D, I: D, K: N, L: D, M: N, N: N, P: D, Q: N, R: N, S: N, V: N, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Role of pharmacogenetics of ATP-binding cassette t... Pharmacol Ther. 2006 Nov;112(2):457-73. Cascorbi I
Role of pharmacogenetics of ATP-binding cassette transporters in the pharmacokinetics of drugs.
Pharmacol Ther. 2006 Nov;112(2):457-73., [PMID:16766035]

Abstract [show]
Interindividual differences of drug response are an important cause of treatment failures and adverse drug reactions. The identification of polymorphisms explaining distinct phenotypes of drug metabolizing enzymes contributed in part to the understanding of individual variations of drug plasma levels. However, bioavailability also depends on a major extent from the expression and activity of drug transport across biomembranes. In particular efflux transporters of the ATP-binding cassette (ABC) family such as ABCB1 (P-glycoprotein, P-gp), the ABCC (multidrug resistance-related protein, MRP) family and ABCG2 (breast cancer resistance protein, BCRP) have been identified as major determinants of chemoresistance in tumor cells. They are expressed in the apical membranes of many barrier tissue such as the intestine, liver, blood-brain barrier, kidney, placenta, testis and in lymphocytes, thus contributing to plasma, liquor, but also intracellular drug disposition. Since expression and function exhibit a broad variability, it was hypothesized that hereditary variances in the genes of membrane transporters could explain at least in part interindividual differences of pharmacokinetics and clinical outcome of a variety of drugs. This review focuses on the functional significance of single nucleotide polymorphisms (SNP) of ABCB1, ABCC1, ABCC2, and ABCG2 in in vitro systems, in vivo tissues and drug disposition, as well as on the clinical outcome of major indications.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
882 0.01 Exon 2 56 C>T P19L 0.01 Exon 3 234 A>G synonymous 0.01 Exon 3 299 G>A R100Q 0.01 Exon 7 842 G>A S281N 0.01 Exon 10 1249 G>A V417I 0.12 (0.21) Exon 10 1457 C>T T486I 0.03 Exon 18 2302 C>T R768W 0.01 (0.00) Exon 18 2366 C>T S789F 0.01 (0.00) slightly elevated activity, lower expressionb Exon 20 2647 G>A D883N 0.01 Exon 21 2882 A>G K961R 0.01 Exon 22 2934 G>A synonymous 0.05 Exon 22 3039 C>T synonymous 0.01 Exon 22 3057 G>T Q1019H 0.01 Exon 24 3321 G>T synonymous 0.01 Exon 25 3521 G>A R1174H 0.01 Exon 25 3563 T>A V1188E 0.01 Exon 26 3732 C>T N1244K 0.01 Exon 28 3972 C>T synonymous 0.21 (0.34) Exon 29 4100 C>G S1367C 0.01 Exon 30 4290 G>T synonymous 0.01 Exon 31 4348 G>A A1450T 0.01 (0.00) decreased activity, lower expressionb Exon 31 4488 C>T synonymous 0.01 Exon 32 4544 G>A C1515Y 0.01 a Haenisch et al. (in press). Login to comment

[hide] Pharmacogenomics of MRP transporters (ABCC1-5) and... Drug Metab Rev. 2008;40(2):317-54. Gradhand U, Kim RB
Pharmacogenomics of MRP transporters (ABCC1-5) and BCRP (ABCG2).
Drug Metab Rev. 2008;40(2):317-54., [PMID:18464048]

Abstract [show]
Elucidation of the key mechanisms that confer interindividual differences in drug response remains an important focus of drug disposition and clinical pharmacology research. We now know both environmental and host genetic factors contribute to the apparent variability in drug efficacy or in some cases, toxicity. In addition to the widely studied and recognized genes involved in the metabolism of drugs in clinical use today, we now recognize that membrane-bound proteins, broadly referred to as transporters, may be equally as important to the disposition of a substrate drug, and that genetic variation in drug transporter genes may be a major contributor of the apparent intersubject variation in drug response, both in terms of attained plasma and tissue drug level at target sites of action. Of particular relevance to drug disposition are members of the ATP Binding Cassette (ABC) superfamily of efflux transporters. In this review a comprehensive assessment and annotation of recent findings in relation to genetic variation in the Multidrug Resistance Proteins 1-5 (ABCC1-5) and Breast Cancer Resistance Protein (ABCG2) are described, with particular emphasis on the impact of such transporter genetic variation to drug disposition or efficacy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
101 Several molecular defects in MRP2 have been suggested to result in DJS including those which produce deficient protein maturation (Hashimoto et al., 2002; Keitel et al., 2003), proteasomal degradation (Keitel, 2003), impaired membrane sorting (Hashimoto et al., 2002; Mor-Cohen et al., 2001), loss in transport activity (Mor-Cohen et al., 2001), Figure 2 Predicted membrance topology of MRP2 (ABCC2) based on hydrophobicity analysis. Locations of the non-synonymous polymorphisms are indicated with arrows. See Table 2 for allele frequencies and description of funtional consequences. NH2 COOH NBD NBD in out Membrane Pro19Leu Phe39Tyr Arg100* Arg100Gln Ser281Asn Ser325* Asp333Gly Arg353His Arg412Gly Val417Ile Lys430Arg Thr486Ile Gly676Arg Trp709Arg Asn718Ser Ser789Phe Arg768Trp Asp833Asn Glu893Gln Leu927Arg Lys961Arg Tyr967* Phe981Leu Gln1019His Arg1066* Arg1150His Arg1100Cys Arg1100His Ile1137Phe Ile1173Phe Val1188Glu Arg1174His Arg1181Leu Asn1244Lys Thr1273Ala Pro1291Leu Lys1299Gln Arg1310* Ser1367Cys Gln1382Arg Arg1392del Met1393del Ala1450Thr Thr1476Met Cys1515Tyr MRP2 (ABCC2) NBD NBD Asp833Asn Glu893Gln Leu927Arg Lys961Arg Tyr967* NBD NBDNBD Asp833Asn Glu893Gln Leu927Arg Lys961Arg Tyr967* 325 Table2MRP2(ABCC2)singlenucleotidepolymorphisms.Location,allelefrequencyandfunctionaleffects. Positionin codingsequence Amino acidexchangeLocation Allelefrequency EffectNCBIIDReferenceAfCaJpothers 56C>TPro19LeuExon2--1[1]b -- 116T>APhe39TyrExon2--0[2]--rs927344 298C>TArg100*Exon3--[3]-DJS[3] 299G>AArg100GlnExon3--1[1]b -- 842G>ASer281AsnExon7-0[4]1[1]b -- 974C>GSer325*Exon8---Malayan[5]DJS[5] 998A>GAsp333GlyExon8--0[2]--rs17222674 1058G>AArg353HisExon9--0[2]--rs7080681 1271A>GArg412GlyExon10-[6]0[2]-DJS;Decreaseinmethotrexateelimination[6] 1249G>AVal417IleExon10-22[7]13[9]-lowermRNAand(protein)expressioninpreterm placenta[11] rs2273697 26[8]16[4]noeffectonRNAandproteinininduodenum[12] 19[10]noeffectonproteininliver[8] noeffectonconjugatedbilirubinlevelinserum[13] changesinlocalizationinneuroepithelialtumors[14] possibleassociationwithtenofovir-inducedrenal proximaltubulopathy[15] 1289A>GLys430ArgExon10-4[16]0[2]-- 1457C>TThr486IleExon10-0[4]3[1]b -- 2026G>CGly676Arg--0[2]-DJS[17] 2125T>CTrp709Arg--0[2]-DJS[17] 2153A>GAsn718SerExon17-0[4]0[2]--rs3740072 2302C>TArg768TrpExon18-0[18]1[9]-DJS;deficientmaturationandimpairedsorting[19] 2366C>TSer789PheExon18-0[18]1[9]-lowerexpressionandmembranelocalization[20] noeffectonconjugatedbilirubinlevelinserum[13]/ heterozygous 2647G>AAsp883AsnExon20--1[1]b -- 2677G>CGlu893GlnExon20--0[2]--rs3740071 2780T>GLeu927ArgExon21-1[10]0[2]-- (Continued) Table2(Continued) Positionin codingsequence Aminoacid exchangeLocation Allelefrequency EffectNCBIIDReferenceAfCaJpothers 2882A>GLys961ArgExon21--1[1]b --- 2901C>ATyr967*Exon22--0[2]--rs17222547 2943C>GPhe981LeuExon22-2[21]0[2]-Noinfluenceonpravastatinkinetics[21] 3057G>TGln1019HisExon22--1[1]b -- 3196C>TArg1066*Exon23-[22]0[2]-DJS;truncatedprotein[22][23] 3298C>TArg1100CysExon24-1[10]0[2]-- 3299G>AArg1100HisExon24-1[10]0[2]-- 3449G>AArg1150HisExon25--0[2]Israeli[24]DJS;impairedtransportactivityintransfectedcells althoughnormalexpressionandlocalization[24] 3517A>TIle1173PheExon25--0[2]Israeli[24]DJS;impairedproteinmaturationandproteasomal degradation[25] lowexpression,mislocation,andimpairedtransport activityintransfectedcells[24] 3521G>AArg1174HisExon25-0[4]1[1]b -- 3542G>TArg1181LeuExon25-0[4]0[2]--rs8187692 3563T>AVal1188GluExon25-7[4]1[1]b -noeffectonnelfinaviraccumulationinPBMC[4],rs17222723 4[16]associatedwithanthracycline-induced cardiotoxicity[26] 6[8] 3732C>TAsn1244LysExon26--0[1]b -- 0[2] 3817A>GThr1273AlaExon27--0[2]--rs8187699 3872C>TPro1291LeuExon28--0[2]--rs17216317 3897A>CLys1299GlnExon28--0[2]--rs4148400 3928C>TArg1310*Exon28--0[2]-DJS[17,27] 4100C>GSer1367CysExon29--1[1]b -- 4145A>GGln1382ArgExon29--[28]-DJS;noeffectonmaturationorsorting,impaired substrate-inducedATPhydrolysis[19] 4175-80delArg1392delExon30--0[2]-DJS;deficientMRP2maturationandimpaired sortingtoapicalmembraneintransfectedcells[29] 327 4348G>AAla11450ThrExon31-0[18]1[9]-lowerexperssionandmembracelocalizationin transfectedcells[20] 4461C>TThr1476MetExon31-[30]1[2]-- 4544G>ACys1515TyrExon32-9[4]1[1]b -noeffectonnelfinaviraccumulationinPBMC[4]rs8187710 5[10]associatedwithanthracycline-induced cardiotoxicity[26] 4[16] 6[8] ReferencewithoutfrequencymeansthatSNPwasdetectedbutnofrequencydetermined. Login to comment

[hide] Pharmacogenetics of intestinal absorption. Curr Drug Deliv. 2008 Jul;5(3):153-69. Nakamura T, Yamamori M, Sakaeda T
Pharmacogenetics of intestinal absorption.
Curr Drug Deliv. 2008 Jul;5(3):153-69., [PMID:18673259]

Abstract [show]
The small intestine is the primary site of absorption for many drugs administered orally and so is the target tissue for pharmacotherapeutic strategies to control the oral absorption of drugs. Drug transporters, including the ATP-binding cassette (ABC) superfamily and the solute carrier (SLC) superfamily, have been considered to play a physiological role in regulating the absorption of xenobiotics, and variations in their expression level and function in the small intestine cause intra- and inter-individual variation in the oral absorption of drugs. Recent advances in molecular biology have suggested that genetic polymorphisms are associated with the expression level and function, and thereby inter-individual variation. In this review, the pharmacogenetics of these transporters is summarized, and their future significance in the clinical setting is discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
83 In Vitro Studies Associated with Common SNPs of Drug Transporter Genes Exon Polymorphism Effect dbSNP Cell Expression Function Reference ABCC2 Exon 1 -24C>T 5`-UTR rs717620 116A>T Tyr2Phe rs927344Exon 2 159A>G synonymous rs17222596 Exon 7 736A>C Met246Leu rs17222744 Exon 8 998A>G Asp333Gly rs17222674 Exon 9 1058G>A Arg353His rs7080681 1219C>T synonymous rs17216198 1249G>A Val417Ile rs2273697 LLC-PK1 Protein (n.s.) Membrane localization (n.s.) Transport activity (n.s.) Hirouchi et al. [51] 1434G>T synonymous 1434G>A synonymous rs4267009 Exon 10 1457C>T Thr486Ile rs17222589 Exon 11 1483A>G Lys495Glu rs17222561 Exon 13 1686T>G Phe562Leu rs17216233 2009T>C Ile670Thr rs17222632Exon 16 2073C>A synonymous rs17222624 Exon 17 2153A>G Asn718Ser rs3740072 Exon 19 2546T>G Leu849Arg rs17222617 Exon 20 2677G>C Glu893Gln rs3740071 2901C>A Tyr967stop rs17222547 2934G>A synonymous rs3740070 Exon 22 2944A>G Ile982Val rs17222554 3107T>C Ile1036Thr rs17216149Exon 23 3188A>G Asn1063Ser rs17222540 Exon 24 3396T>C synonymous rs17216345 3542G>T Arg1181Leu rs8187692 3561G>A synonymous rs17216324 Exon 25 3563T>A Val1188Glu rs17222723 Exon 27 3817A>G Thr1273Ara rs8187699 3872C>T Pro1291Leu rs17216317 3895A>C Lys1299Gln rs4148400 3927C>T synonymous rs4148401 Exon 28 3972C>T synonymous rs3740066 4062C>T synonymous rs17216275Exon 29 4110C>T synonymous rs7899457 4242C>T synonymous rs17216296Exon 30 4290G>T synonymous rs1137968 4410G>A synonymous rs8187706Exon 31 4488C>T synonymous rs8187707 4527C>T synonymous rs8187709Exon 32 4544G>A Cys1515Tyr rs8187710 ABCG2 PA317 mRNA (n.s.) Protein (n.s.) Drug sensitivity (n.s.) Topotecan uptake (n.s.) Imai et al. [85] mRNA (n.s.) Protein (n.s.) Apical localization (impaired) Drug sensitivity ( ) Indolocarbazole uptake ( ) Indolocarbazole efflux ( ) Mizuarai et al. [88] Exon 2 34G>A Val12Met rs2231137 LLC-PK1 Apical localization (n.s.) . Login to comment
92 Exon Polymorphism Effect dbSNP Subject Expression Function Reference DNT patient Tumoral protein (GG GA) Peritumoral protein (GG GA) Vogelgesang et al. [54] Nasopharyngeal cancer patient Irinotecan PK (CC CT TT) SN-38 PK (CC CT TT) SN-38G PK (CC CT TT) Zhou et al. [56] Colorectal cancer patient (Japanese) Tumoral mRNA (CC CT TT) Drug sensitivity (CC CT TT) Tumor growth rate (CC CT TT) Nishioka et al. [57] HIV patient (Caucasian) Nelfinavir intracellular AUC (CC CT TT) Colombo et al. [58] Spina Bifida patient Disease-susceptibility (CC CT TT) Jensen et al. [60] Cancer patient (Caucasian) Diflomotecan PK (CC CA) Sparreboom et al. [96] 116A>T Tyr2Phe rs927344Exon 2 159A>G synonymous rs17222596 Exon 7 736A>C Met246Leu rs17222744 Exon 8 998A>G Asp333Gly rs17222674 Exon 9 1058G>A Arg353His rs7080681 1219C>T synonymous rs17216198 1249G>A Val417Ile rs2273697 Healthy (Finnish) Pravastatin PK (GG GA AA) Niemi et al. [48] Women undergoing cesarean section Placental mRNA [preterms] (GG>GA>AA), [term] (GG GA AA) Placental protein (GG GA AA) Meyer zu Schwabedissen et al. [52] DNT patient Tumoral protein (GG<GA) Peritumoral protein (GG GA) Vogelgesang et al. [54] HIV patient (Caucasian) Nelfinavir intracellular AUC (GG GA AA) Colombo et al. [58] Cancer patient (Caucasian) Diflomotecan PK (CC CA) Sparreboom et al. [96] 1434G>T synonymous 1434G>A synonymous rs4267009 Exon 10 1457C>T Thr486Ile rs17222589 Exon 11 1483A>G Lys495Glu rs17222561 Exon 13 1686T>G Phe562Leu rs17216233 2009T>C Ile670Thr rs17222632Exon 16 2073C>A synonymous rs17222624 Exon 17 2153A>G Asn718Ser rs3740072 Exon 19 2546T>G Leu849Arg rs17222617 Exon 20 2677G>C Glu893Gln rs3740071 2901C>A Tyr967stop rs17222547 2934G>A synonymous rs3740070 Exon 22 2944A>G Ile982Val rs17222554 3107T>C Ile1036Thr rs17216149Exon 23 3188A>G Asn1063Ser rs17222540 (Table 3) contd…. Login to comment

[hide] Pharmacogenetics of ATP-binding cassette transport... Methods Mol Biol. 2010;596:95-121. Cascorbi I, Haenisch S
Pharmacogenetics of ATP-binding cassette transporters and clinical implications.
Methods Mol Biol. 2010;596:95-121., [PMID:19949922]

Abstract [show]
Drug resistance is a severe limitation of chemotherapy of various malignancies. In particular efflux transporters of the ATP-binding cassette family such as ABCB1 (P-glycoprotein), the ABCC (multidrug resistance-associated protein) family, and ABCG2 (breast cancer resistance protein) have been identified as major determinants of chemoresistance in tumor cells. Bioavailability depends not only on the activity of drug metabolizing enzymes but also to a major extent on the activity of drug transport across biomembranes. They are expressed in the apical membranes of many barrier tissues such as the intestine, liver, blood-brain barrier, kidney, placenta, testis, and in lymphocytes, thus contributing to plasma, liquor, but also intracellular drug disposition. Since expression and function exhibit a broad variability, it was hypothesized that hereditary variances in the genes of membrane transporters could explain at least in part interindividual differences of pharmacokinetics of a variety of anticancer drugs and many others contributing to the clinical outcome of certain leukemias and further malignancies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
190 0.01* (0.00) c. 56 C>T P19L 0.01* c. 234 A>G Synonymous 0.01* c. 299 G>A R100Q 0.01* c. 842 G>A S281N 0.01* c. 1249 G>A V417I 0.13 (0.21) c. 1446 C>G (0.01) c. 1457 C>T T486I 0.03* (0.00) c. 2302 C>T R768W 0.01 (0.00) c. 2366 C>T S789F 0.01 (0.00) c. 2647 G>A D883N 0.01* c. 2882 A>G K961R 0.01* c. 2934 G>A Synonymous 0.05* c. 3039 C>T Synonymous 0.01* c. 3057 G>T Q1019H 0.01* c. 3321 G>T Synonymous 0.01* c. 3521 G>A R1174H 0.01* c. 3542 G>T (0.001) c. 3561 G>A (0.00) c. 3563 T>A V1188E 0.01* (0.05) c. 3732 C>T N1244K 0.01* c. 3972 C>T Synonymous 0.22* (0.34) c. 4100 C>G S1367C 0.01* c. 4290 G>T Synonymous 0.01* c. 4348 G>A A1450T 0.01 (0.00) c. 4488 C>T Synonymous 0.01* c. 4544 G>A C1515Y 0.01* (0.04) association to cholestatic or mixed type hepatitis whereas -24T carriers exhibited more often hepatocellular-type hepatitis after intake of drugs or herbal remedies (96). Login to comment

[hide] Influence of ABCB1, ABCC1, ABCC2, and ABCG2 haplot... Pharmacogenet Genomics. 2005 Sep;15(9):599-608. Colombo S, Soranzo N, Rotger M, Sprenger R, Bleiber G, Furrer H, Buclin T, Goldstein D, Decosterd L, Telenti A
Influence of ABCB1, ABCC1, ABCC2, and ABCG2 haplotypes on the cellular exposure of nelfinavir in vivo.
Pharmacogenet Genomics. 2005 Sep;15(9):599-608., [PMID:16041239]

Abstract [show]
OBJECTIVES: The human immunodeficiency virus protease inhibitor nelfinavir is substrate of polyspecific drug transporters encoded by ABCB1 (P-glycoprotein), ABCC1 (MRP1) and ABCC2 (MRP2), and an inhibitor of BCRP, encoded by ABCG2. Genetic polymorphism in these genes may be associated with changes in transport function. METHODS: A comprehensive evaluation of single nucleotide polymorphisms (39 SNPs in ABCB1, 7 in ABCC1, 27 in ABCC2, and 16 in ABCG2), and inferred haplotypes was done to assess possible associations of genetic variants with cellular exposure of nelfinavir in vivo. Analysis used peripheral mononuclear cells from individuals receiving nelfinavir (n=28). Key results were re-examined in a larger sample size (n=129) contributing data on plasma drug levels. RESULTS AND CONCLUSIONS: There was no significant association between cellular nelfinavir area under the curve (AUC) and SNPs or haplotypes at ABCC1, ABCC2, ABCG2. There was an association with cellular exposure for two loci in strong linkage disequilibrium: ABCB1 3435C>T; AUCTT>AUCCT>AUCCC (ratio 2.1, 1.4, 1, Ptrend=0.01), and intron 26 +80T>C; AUCCC> AUCCT > AUCTT (ratio 2.4, 1.3, 1, Ptrend=0.006). Haplotypic analysis using tagging SNPs did not improve the single SNP association values.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
71 - 24C > T exon 1 Itoda et al., 2002 mp-v-004 rs717620 IVS 6-30 G > T intron 6 Epidauros mp-v-051 rs8187666 c.842G > A exon 7 p.S281N Epidauros mp-v-115 c.998G > A intron 7 Epidauros mp-v-083 c.1219C > T exon 10 synonymous (p.L407L) Epidauros mp-v-007 rs8187669 c.1249G > A exon 10 p.V417I Itoda et al., 2002 mp-v-008 rs2273697 c.1346C > G exon 10 synonymous (p.T482T) Epidauros mp-v-114 c.1457C > T exon 10 p.T486I Epidauros mp-v-055 rs8187670 IVS 16 - 47 G > A intron 16 Epidauros mp-v-118 IVS 16 - 30 T > A intron 16 Epidauros mp-v-119 c.2153A > G exon 17 p.N718S Epidauros mp-v-093 rs3740072 c.2216T > C exon 17 p.L739P Epidauros mp-v-108 c.3449G > A exon 25 p.R1150H Mor-Cohen et al., 2001 mp-v-085 c.3517A > T exon 25 p.I1173F Keitel et al., 2003 mp-v-096 c.3521G > A exon 25 p.R1174H Epidauros mp-v-068 c.3542G > T exon 25 p.R1181L Epidauros mp-v-069 rs8187692 c.3563T > A exon 25 p.V1188E Epidauros mp-v-025 rs8187694 IVS 30 - 53 C > T intron 30 Epidauros mp-v-105 rs3824610 c.4348G > A exon 31 p.A1450T Suzuki et al. 2002 mp-v-106 c.4410G > A exon 31 synonymous (p.E1470E) Epidauros mp-v-077 rs8187706 c.4488C > T exon 31 synonymous (p.H1496H) Epidauros mp-v-038 rs8187707 IVS 31 + 12 G > A intron 31 Epidauros mp-v-039 rs8187708 IVS 31 + 74 C > T intron 31 Epidauros mp-v-040 IVS 31 - 9 T > C intron 31 Epidauros mp-v-042 c 4527C > T exon 32 synonymous (p.A1509A) Epidauros mp-v-048 rs8187709 c.4544G > A exon 32 p.C1515Y Epidauros mp-v-043 rs8187710 + 259 G > T 30 flanking Epidauros mp-v-120 Transporter polymorphisms and HIV treatment Colombo et al. 601 BCRP (ABCG2) g. Login to comment

[hide] Functional characterization of protein variants of... Hum Mutat. 2012 Apr;33(4):750-62. doi: 10.1002/humu.22041. Epub 2012 Feb 28. Arlanov R, Porter A, Strand D, Brough R, Karpova D, Kerb R, Wojnowski L, Schwab M, Lang T
Functional characterization of protein variants of the human multidrug transporter ABCC2 by a novel targeted expression system in fibrosarcoma cells.
Hum Mutat. 2012 Apr;33(4):750-62. doi: 10.1002/humu.22041. Epub 2012 Feb 28., [PMID:22290738]

Abstract [show]
The multidrug resistance-associated protein 2 (MRP2/ABCC2) is involved in the efflux of endogenous and xenobiotic substrates, including several anticancer and antiviral drugs. The functional consequences of ABCC2 protein variants remain inconsistent, which may be due to shortcomings of the in vitro assays used. To study systematically the functional consequences of nonsynonymous ABCC2 variants, we used a novel "Screen and Insert" (ScIn) technology to achieve stable and highly reproducible expression of 13 ABCC2 variants in HT1080 cells. Western blotting revealed lower (30-65%) ABCC2 expression for D333G, R1174H, and R1181L as compared with wild type (WT; 100%), whereas the linked variant V1188E/C1515Y resulted in higher expression (150%). R1174H caused mislocalization of ABCC2 to the cytoplasm with an endoplasmic reticulum-like distribution. Variants N1244K and R1174H decreased transport of glutathione-methylfluorescein (GS-MF) and glutathione-monochlorobimane (GS-MCB) by 80% and 50%, respectively, whereas R1181L and P1291L reduced only GS-MCB transport by 50% as compared with WT. Contrary to protein data, the double variant V1188E/C1515Y decreased specific transport activity for GS-MF and GS-MCB by 40%. The ScIn approach is a feasible and reliable method to functionally characterize systematically ABCC2 variants. D333G, R1174H, R1181L, N1244K, P1291L, and double variant V1188E/C1515Y have been identified as most promising for further clinical evaluation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
176 Immunoblots of the variants F39Y, R353H, T486I, I670T, G921S, I1036T, N1244K, and P1291L showed similar expression compared with WT (range 85-110% of WT). Login to comment
178 ABCC2 Missense Variants Selected for Study on Expression, Localization, and Function rs# NCBI Genetic variationa Amino acid Ethnicity Allele frequency (%) Nb Data source Predicted phenotypec rs927344 c.116T>A F39Y AA 2.3 86 Current study Benign AA 2 200 pharmGKB KO 0 94 Current study rs17222674 c.998A>G D333G AA 0 88 Current study Probably damaging AA 1 200 pharmGKB KO 0 94 Current study rs7080681 c.1058G>A R353H AA 6.7 90 Current study Benign AA 3.5 200 pharmGKB KO 0 94 Current study rs17222589 c.1457C>T T486I AA 0 84 Current study Benign KO 3.7 82 Current study JA 5 20 pharmGKB JA 2.3 144 Itoda et al. (2002) rs17222632 c.2009T>C I670T AA 1.1 92 Current study Benign AA 1.5 200 pharmGKB KO 0 92 Current study rs41318029 c.2761G>A G921S AA 0 84 Current study Benign KO 0 92 Current study CA 1 120 NCBI dbSNP rs45441199 c.3107T>C I1036T AA 0 96 Current study Benign AA 0.5 200 pharmGKB KO 0 94 Current study CA 0.5 198 pharmGKB CA 1 120 NCBI dbSNP rs139188247 c.3521G>A R1174H AA 2.3 86 Current study Probably damaging KO 0 94 Current study JA 1 144 Itoda et al. (2002) rs8187692 c.3542G>T R1181L AA 5.8 86 Current study Probably damaging AA 8.5 200 pharmGKB KO 0 96 Current study rs17222723 c.3563T>A V1188E AA 5.8 86 Current study Benign AA 6.5 200 pharmGKB KO 0 96 Current study CA 7.5 200 pharmGKB c.3732T>G N1244K JA 1.5 144 Itoda et al. (2002) Possibly damaging rs17216317 c.3872C>T P1291L AA 4.7 86 Current study Probably damaging AA 2 86 pharmGKB KO 0 86 Current study CA 0.5 196 pharmGKB rs8187710 c.4544G>A C1515Y AA 13 92 Current study Benign AA 19.6 194 pharmGKB KO 0 94 Current study CA 8 198 pharmGKB AA, African-American; CA, Caucasian; KO, Korean; JA, Japanese. Login to comment
217 The D333G, R353H, T486I, G921S, and P1291L variants showed a lower transport activity for GS-MCB (71%, 60%, 75%, 63%, and 51% of WT, P < 0.01) but not for GS-MF, whereas the variants F39Y, I1036T, and V1188E/C1515Y did not alter ABCC2-mediated transport for either substrate. Login to comment
267 Finally, GS-MF and/or GS-MCB efflux for all other ABCC2 variants (F39Y, D333G, R353H, T486I, I670T, G921S, and I1036T) showed only minor alterations compared with WT based on our definition of at least 50% change in transport activity. Login to comment
300 Conservation of the ABCC2 Missense Variants Among Other ABCC Orthologs and Homologs Protein Speciesa F39Y D333G R353H T486I I670T G921S I1036T R1174H R1181L V1188E N1244K P1291L C1515Y ABCC2 Human F D R T I G I R R V N P C Mouse F D P K V S I R R K N P Y Rat F D S N V S I R R K N P Y Rabbit F D P N V G L R R I N P Y Rhesus F D R T M S I R R V N P Y ABCC1 Human Y D T T V G I R R L Y P Y Mouse Y D R T V G A R R L Y P C Rat Y D R T V V V R R L Y P C Macaque Y D T T V G I R R L Y P Y Dog Y D K T V G I R R L Y P C ABCC3 Human Y D P A V G F R D T Y E F Mouse Y N P T V V L R D T Y P F Rat Y D P T V G L R D A Y P F ABCC4 Human - E Y S V R L R R A Y P Y ABCC5 Human - Q A Y C P I H E E Y P E ABCC6 Human Y D P H V K I R P A A P S ABCC11 Human - C E K C T C H D R I Q F Multiple sequence alignment was performed using ClustalW (www.ebi.ac.uk/clustalw). Login to comment

[hide] Influence of genetic polymorphisms on intestinal e... Pharmacogenet Genomics. 2008 Apr;18(4):357-65. Haenisch S, May K, Wegner D, Caliebe A, Cascorbi I, Siegmund W
Influence of genetic polymorphisms on intestinal expression and rifampicin-type induction of ABCC2 and on bioavailability of talinolol.
Pharmacogenet Genomics. 2008 Apr;18(4):357-65., [PMID:18334920]

Abstract [show]
OBJECTIVES: To evaluate whether ABCC2 gene polymorphisms are associated with expression and/or function of the efflux pump. METHODS: We investigated the allele frequency of ABCC2 -24C>T, -23G>A, c.1249G>A, c.1446C>G, c.1457C>T, c.2302C>T, c.2366C>T, c.3542G>T, c.3561G>A, c.3563T>A, c.3972C>T, c.4348G>A, and 4544G>A in 374 nonrelated German healthy volunteers and determined the impact on duodenal mRNA and protein content of ABCC2. For functional analysis, the disposition of intravenously (30 mg) and orally administered talinolol (100 mg) was measured among 31 individuals. Moreover, the effects of rifampicin-type induction (600 mg, 8 days) of duodenal ABCC2 were quantified in 22 participants with regard to genetic polymorphisms. RESULTS: The allele frequencies were 18.3% (-24T), 21.1% (1249A), 1.4% (1446G), 0.1% (3542T), 4.5% (3563A), 34.2% (3972T), and 4.4% (4544A); carriers of -23G>A, 1457C>T, 2302C>T, 2366C>T, 3561G>A, and 4348G>A were not identified. The -24T allele was in strong linkage with 3972T, and 3563A with 4544A, whereas 1249A was weakly linked with other variant alleles. None of the single nucleotide polymorphisms investigated influenced significantly intestinal ABCC2 mRNA and protein content. The variant ABCC2 1249G>A (V417I), however, was associated with lower oral bioavailability (P=0.001), and increased residual clearance of intravenous talinolol (P=0.021). Intestinal ABCC2 mRNA and protein expression were upregulated by rifampicin treatment, a genetic influence could be detected in only four cases heterozygote for 3563T>A or 4544G>A. CONCLUSION: The 1249G>A (V417I) polymorphism is obviously associated with higher activity of the intestinal transporter.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 The SNPs -24C > T (rs717620), -23G > A (rs17216156) in the 50 -UTR, c.1446C > G (T482T), recently described by Niemi et al. [17], c.1457C > T (T486I, rs45518933), c.3542G > T (R1181L, rs8187692), c.3561G > A (E1187E, rs45622934), c.3563T>A (V1188E rs17222723), c.4544G>A (C1515Y, rs8187710) were determined by pyrosequencing using the PSQ 96HS system (Biotage, Uppsala, Sweden). Login to comment

[hide] Genetic variations of the ABCC2 gene in the Chines... Drug Metab Pharmacokinet. 2008;23(5):385-91. Ho WF, Koo SH, Yee JY, Lee JD
Genetic variations of the ABCC2 gene in the Chinese, Malay, and Indian populations of Singapore.
Drug Metab Pharmacokinet. 2008;23(5):385-91., [PMID:18974617]

Abstract [show]
MRP2 is a drug transporter that is responsible for the gastrointestinal absorption and biliary excretion of a wide variety of endogenous and xenobiotic compounds, including many clinically used drugs. This study aims to identify genetic variations of ABCC2 gene in three distinct ethnic groups of the Singaporean population (n = 288). The coding region of the gene encoding the transporter protein was screened for genetic variations in the study population by denaturing high-performance liquid chromatography and DNA sequencing. Twenty-two genetic variations of ABCC2, including 8 novel ones, were found: 1 in the 5' untranslated region, 10 in the coding exons (8 nonsynonymous and 2 synonymous variations), and 11 in the introns. Three novel nonsynonymous variations: 2686G > A (Glu896Lys), 4240C > T (His1414Tyr) and 4568A > C (Gln1523Pro) were detected in single heterozygous Malay, Chinese, and Indian subjects, respectively. Among the novel nonsynonymous variations, 4240C > T and 4568A > C were predicted to be functionally significant. These data would provide fundamental and useful information for pharmacogenetic studies on drugs that are substrates of MRP2 in Asians.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
54 Among the reported variations, the ones that may be of functional relevance include -24CÀT,7,25) 1249GÀA (Val417Ile),5) 3563TÀA (Val1188Glu),5,26-28) 3972CÀT (Ile1324Ile),25) and 4544GÀA (Cys1515Tyr).26,28) The -24CÀT polymorphism was found to associate with increased plasma methotrexate concentrations in pediatric leukemia patients.7) We have also previously observed a trend for a genotypic-phenotypic correlation between -24CÀT polymorphism and increased irinotecan AUC(0, /).29) -24CÀT and 3972CÀT (Ile1324Ile) were linked to higher response rates to irinotecan and longer progression-free survival in patients with advanced non-small cell lung cancer.25) However, a study on the disposition of nitrocamptothecin and its aminocamptothecin metabolite in relation to the 3972CÀT variation revealed no significant association.30) 3563TÀA (Val1188Glu) and 4544GÀA (Cys1515Tyr) were correlated with high MRP2 expression,28) and increased susceptibility for anthracycline-induced cardiotoxicity.26) 3563TÀA (Val1188Glu) was also significantly associated with pruritus in primary biliary cirrhosis.27) Genetic polymorphisms in ABCC2 might thus constitute a risk factor for the development of acquired forms of cholestatic liver diseases.28) Mutations in the transmembrane domain: 1249GÀA (Val417Ile), 1457CÀT (Thr486Ile), and 3563TÀA (Val1188Glu) could affect their substrate specificities though their transporter activities might not be completely disrupted.5) All reported nonsynonymous variations detected in this study were predicted to be benign using the PolyPhen program. Login to comment

[hide] Genetic variations and haplotypes of ABCC2 encodin... Drug Metab Pharmacokinet. 2008;23(2):139-47. Sai K, Saito Y, Itoda M, Fukushima-Uesaka H, Nishimaki-Mogami T, Ozawa S, Maekawa K, Kurose K, Kaniwa N, Kawamoto M, Kamatani N, Shirao K, Hamaguchi T, Yamamoto N, Kunitoh H, Ohe Y, Yamada Y, Tamura T, Yoshida T, Minami H, Matsumura Y, Ohtsu A, Saijo N, Sawada J
Genetic variations and haplotypes of ABCC2 encoding MRP2 in a Japanese population.
Drug Metab Pharmacokinet. 2008;23(2):139-47., [PMID:18445995]

Abstract [show]
The multidrug resistance-associated protein 2 (MRP2) encoded by the ABCC2 gene is expressed in the liver, intestine and kidneys and preferentially exports organic anions or conjugates with glucuronide or glutathione. In this study, all 32 exons and the 5'-flanking region of ABCC2 in 236 Japanese were resequenced, and 61 genetic variations including 5 novel nonsynonymous ones were detected. A total of 64 haplotypes were determined/inferred and classified into five *1 haplotype groups (*1A, *1B, *1C, *1G, and *1H) without nonsynonymous substitutions and *2 to *9 groups with nonsynonymous variations. Frequencies of the major 4 haplotype groups *1A (-1774delG), *1B (no common SNP), *1C (-24C>T and 3972C>T), and *2 [1249G>A (Val417Ile)] were 0.331, 0.292, 0.172, and 0.093, respectively. This study revealed that haplotype *1A, which has lowered activity, is quite common in Japanese, and that the frequency of *1C, another functional haplotype, was comparable to frequencies in Asians and Caucasians. In contrast, the haplotypes harboring 3972C>T but not -24C>T (*1G group), which are reportedly common in Caucasians, were minor in Japanese. Moreover, the allele 1446C>T (Thr482Thr), which has increased activity, was not detected in our Japanese population. These findings imply possible differences in MRP2-mediated drug responses between Asians and Caucasians.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
68 Summary of ABCC2 variations detected in this study SNP ID Position This Study dbSNP (NCBI) JSNP Reference Location NT_030059.12 From the translational initiation site or from the end of the nearest exon Nucleotide change Amino acid change Frequency (total＝472) MPJ6_AC 2082 8 5?-Flanking 20289354 －1774 acttatcttgttG/_tttttttttttt 0.343 MPJ6_AC 2078 a 5?-Flanking 20289538 －1590 tttaatttgttaG/Atgtatgtttgct 0.002 MPJ6_AC 2079 8, 10, 17 5?-Flanking 20289579 －1549 tccttatagtatG/Attgtggatatta 0.203 MPJ6_AC 2080 9, 17 5?-Flanking 20290105 －1023 tgggaggccaagG/Acagaaggattgt 0.343 MPJ6_AC 2081 10, 17 5?-Flanking 20290109 －1019 aggccaaggcagA/Gaggattgttgaa 0.203 MPJ6_AC 2028 a 5?-Flanking 20290395 －733 acagtttctagcG/Tactgatgccacc 0.004 MPJ6_AC 2029 5?-Flanking 20290395 －733 acagtttctagcG/Aactgatgccacc 0.002 MPJ6_AC 2030 a 5?-Flanking 20290715 －413 ttgcagcagaagC/Tgaaactgcacat 0.002 MPJ6_AC 2003 ssj0000371 9, 12, 15-18, 20, 26 Exon 1 20291104 －24 tagaagagtcttC/Tgttccagacgca 0.174 MPJ6_AC 2004 18 Exon 1 20291105 －23 agaagagtcttcG/Attccagacgcag 0.006 MPJ6_AC 2031 ssj0000386 17, 26 Intron 3 20301785 IVS3 －49 ctcccctcagtcC/Ttcggttagtggc 0.203 MPJ6_AC 2032 a Intron 6 20302837 IVS6 ＋86 tattttattattT/Atttttttgagat 0.076 MPJ6_AC 2033 a Exon 7 20305479 732 caagtttgaaacG/Acacatgaagaga Thr244Thr 0.002 MPJ6_AC 2066 a Intron 7 20307421 IVS7 －69 tcacaggctgacC/Gaccctggagctg 0.002 MPJ6_AC 2067 a Intron 7 20307423 IVS7 －67 acaggctgaccaC/Acctggagctgct 0.002 MPJ6_AC 2035 a Exon 9 20308814 1177 ggtgtaaaagtaC/Tggacagctatca Arg393Trp 0.002 MPJ6_AC 2068 a Exon 9 20308839 1202 tggcttctgtatA/Gtaagaaggtaag Tyr401Cys 0.002 MPJ6_AC 2036 a Intron 9 20308859 IVS9 ＋13 gtaagcagaataC/Tggcaggtatcac 0.002 MPJ6_AC 2037 a Exon 10 20312319 1227 gaccctatccaaC/Tttggccaggaag Asn409Asn 0.002 MPJ6_AC 2009 ssj0000388 17, 18, 20, 23-26 Exon 10 20312341 1249 aaggagtacaccG/Attggagaaacag Val417Ile 0.097 MPJ6_AC 2010 18 Exon 10 20312549 1457 ccaagagtaagaC/Tcattcaggtaaa Thr486Ile 0.019 MPJ6_AC 2069 a Intron 11 20315600 IVS11 －67 taaaacatgggtG/Agatcagatacac 0.002 MPJ6_AC 2038 ssj0000390 26 Intron 12 20315952 IVS12 ＋148 ccgccccatgccA/Gcttttcctcctt 0.210 MPJ6_AC 2039 a Intron 13 20318344 IVS13 －73 tcatggactaacG/Aacaaagtcaaaa 0.002 MPJ6_AC 2070 a Intron 14 20318515 IVS14 ＋14 taaataaatttgG/Taagttgcttccc 0.002 MPJ6_AC 2040 a Intron 14 20318521 IVS14 ＋20 aatttggaagtt(del/ins) b cagcaaactga 0.002 MPJ6_AC 2071 a Intron 14 20318594 IVS14 ＋93 agcaaactgagaG/Tagagtgtggaga 0.002 MPJ6_AC 2041 a Intron 14 20319757 IVS14 －62 cggagagagacaC/Tgtgagggcagac 0.002 MPJ6_AC 2042 a Intron 14 20319758 IVS14 －61 ggagagagacacG/Atgagggcagaca 0.006 MPJ6_AC 2043 ssj0000393 26 Intron 15 20320054 IVS15 ＋169 aaagcaaaggttT/Ctcagccccttcc 0.210 MPJ6_AC 2044 a Intron 15 20321170 IVS15 －131 gtcttgtatatcC/Gaaggcaaatttt 0.004 MPJ6_AC 2045 a Intron 16 20325422 IVS16 －169 ttgagtcctgagA/Tgtggaataacta 0.004 MPJ6_AC 2046 ssj0000396 17 Intron 16 20325486 IVS16 －105 tgcacagttattC/Taaatttaagctc 0.214 MPJ6_AC 2072 a Exon 18 20327159 2358 tcttctagatgaC/Acccctgtctgca Asp786Glu 0.002 MPJ6_AC 2012 18, 20, 23 Exon 18 20327167 2366 atgaccccctgtC/Ttgcagtggatgc Ser789Phe 0.008 MPJ6_AC 2073 a Intron 19 20327555 IVS19 ＋3 gaagccacaggtA/Gtgtaagaaggat 0.002 MPJ6_AC 2047 a Intron 19 20327645 IVS19 ＋93 agtatccagtgaA/Tctagatttggaa 0.002 MPJ6_AC 2048 Intron 20 20338745 IVS20 ＋29 gctggcagccctC/Agtcagctctata 0.002 MPJ6_AC 2049 a Exon 21 20339052 2801 ccttgaaaactcG/Agaatgtgaatag Arg934Gln 0.002 MPJ6_AC 2015 ssj0000398 8, 18, 26 Exon 22 20339944 2934 aggattgttttcG/Aatattcttcatc Ser978Ser 0.040 MPJ6_AC 2050 a Exon 22 20340061 3051 cgactatccagcA/Gtctcagagggac Ala1017Ala 0.002 MPJ6_AC 2051 a Exon 23 20340337 3181 cacaagcaactgC/Ttgaacaatatcc Leu1061Leu 0.002 MPJ6_AC 2052 ssj0000399 17, 26 Intron 23 20340470 IVS23 ＋56 ggatctttctgaC/Tagggaggaatta 0.222 MPJ6_AC 2074 a Exon 24 20342724 3320 ttacatgcttccT/Gggggataatcag Leu1107Arg 0.002 MPJ6_AC 2053 Intron 24 20342843 IVS24 ＋25 atggctaagtcaT/Cccttccttcctc 0.030 MPJ6_AC 2075 a Intron 24 20342880 IVS24 ＋62 agcccagcctctT/Ctcctgagaatct 0.002 MPJ6_AC 2054 Intron 24 20342926 IVS24 ＋108 cactcactcctcC/Tcctcagcagctt 0.023 MPJ6_AC 2055 a Intron 24 20344318 IVS24 －56 agaaaggaggaaG/Aatggtggatgcc 0.002 MPJ6_AC 2056 a Intron 26 20352061 IVS26 －21 atgatgattttcA/Ggtcttctggttt 0.002 MPJ6_AC 2057 a Intron 27 20352227 IVS27 ＋44 ggcaaaaacaacA/Gtgcaactccttc 0.008 MPJ6_AC 2058 ssj0000404 17, 26 Intron 27 20352307 IVS27 ＋124 aaagtttcctttC/Gctctaactcaaa 0.222 MPJ6_AC 2076 26 Exon 28 20352688 3927 ccaagtgcggtaC/Tcgacctgagctg Tyr1309Tyr 0.002 MPJ6_AC 2022 ssj0000407 8, 12, 13, 17, 18, 20, 26 Exon 28 20352733 3972 cacttgtgacatC/Tggtagcatggag Ile1324Ile 0.216 MPJ6_AC 2059 a Intron 28 20352920 IVS28 ＋172 agggaaggatagC/Tagccagggatca 0.004 MPJ6_AC 2060 a Intron 29 20354201 IVS29 ＋136 cttgagctagttC/Tcctaggatggac 0.002 MPJ6_AC 2061 ssj0000408 26 Intron 29 20354219 IVS29 ＋154 gatggacacgtcA/Gtttccagaactt 0.367 MPJ6_AC 2062 IMS-JST090926 17 Intron 29 20355209 IVS29 －35 cttttctggcatG/Aagccccaacagc 0.015 MPJ6_AC 2063 a Intron 30 20358793 IVS30 －92 ggggggttttgaA/Gagtctgatctgg 0.008 MPJ6_AC 2064 IMS-JST185750 Intron 30 20358832 IVS30 －53 ccccctgccctgC/Tgtctttccttgg 0.051 MPJ6_AC 2077 a 3?-UTR 20359975 *61 c taattttattttT/Gtataaaatacag 0.002 MPJ6_AC 2065 a 3?-Flanking 20360190 *193＋83 c ttattcctttgcC/Gtttcatttctgt 0.002a8 a Novel genetic variation b delGCTTCCCAAACTTATTCGCAGTACTGGTGCCAGAATTTTGATAATACAAGAGCTTAGTAG/insTATTTACCT c Numbered from the termination codon. Login to comment
87 The *2 [including 1249GÀA (Val417Ile)] was the most frequent among them, and its frequency (0.093) was similar to those for Asians (0.10-0.13)8,12,20) and slightly lower than those for Caucasians (0.13-0.22).9,10,14,15,21) The haplotype frequencies of *3 [harboring 1457CÀT (Thr486Ile)] and *4 [2366CÀT (Ser789Phe)] were 0.019 and 0.008. Login to comment
91 Functional changes in *3 [1457CÀT (Thr486Ile)] and *5 to *9 (novel nonsys- nonymous variations) are currently unknown. Login to comment

[hide] MRP2 haplotypes confer differential susceptibility... Pharmacogenet Genomics. 2007 Jun;17(6):403-15. Choi JH, Ahn BM, Yi J, Lee JH, Lee JH, Nam SW, Chon CY, Han KH, Ahn SH, Jang IJ, Cho JY, Suh Y, Cho MO, Lee JE, Kim KH, Lee MG
MRP2 haplotypes confer differential susceptibility to toxic liver injury.
Pharmacogenet Genomics. 2007 Jun;17(6):403-15., [PMID:17502832]

Abstract [show]
OBJECTIVES: Multidrug resistance protein 2 (MRP2, ABCC2) plays an important role in the biliary clearance of a wide variety of endogenous and exogenous toxic compounds. Therefore, polymorphisms and mutations in the MRP2 gene may affect individual susceptibility to hepatotoxic reactions. METHODS: Associations between genetic variations of MRP2 and toxic hepatitis were investigated using integrated population genetic analysis and functional molecular studies. RESULTS: Using a gene scanning method, 12 polymorphisms and mutations were found in the MRP2 gene in a Korean population. Individual variation at these sites was analyzed by conventional DNA screening in 110 control subjects and 94 patients with toxic hepatitis induced mostly by herbal remedies. When haplotypes were identified, over 85% of haploid genes belonged to the five most common haplotypes. Among these, a haplotype containing the g.-1774delG polymorphism showed a strong association with cholestatic or mixed-type hepatitis, and a haplotype containing the g.-1549G>A, g.-24C>T, c.334-49C>T, and c.3972C>T variations was associated with hepatocellular-type hepatitis. A comprehensive functional study of these sites revealed that genetic variations in the promoter of this gene are primarily responsible for the susceptibility to toxic liver injuries. The g.-1774delG variation and the combined variation of g.-1549G>A and g.-24C>T decreased MRP2 promoter activity by 36 and 39%, respectively. In addition, the promoter carrying the g.-1774delG allele showed a defect in the bile acid-induced induction of promoter activity. CONCLUSIONS: These results suggest that genetic variations of MRP2 are an important predisposing factor for herbal-induced or drug-induced toxic liver injuries.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
93 The pGL3 plasmids containing WT or mutant MRP2 promoters were Table 3 Oligonucleotide primers used in the genotyping and functional molecular studies Primer name Nucleotide sequence Primers for SNaPshot or SNaPIT PCR primers c.334-49C > T Sense 50 -CAT GGG TCC TGG AAA GGT T-30 Antisense 50 -CCC CAT GGT ACC TCC TCA T-30 c.1249G > A (p.V417I) Sense 50 -TTT GTC CAT GGG TCC TAA TTT-30 Antisense 50 -ATG AAG TTG GTC ACA TCC ATG-30 c.1457C > T (p.T486I) Sense 50 -ATG GTG CTT GTA ATC CCA ATT-30 Antisense 50 -TTG CCC AAA CTC CCA TTA-30 c.2620 + 3A > G Sense 50 -AAA AAA GGA GAG TTT GCT AAG AAT C-30 Antisense 50 -ATA CTG AGC AGT TCA GGA ATT AGA TAT T-30 c.2934G > A (p.S978S) Sense 50 -AGT TCT ACT AAT ATT GAG GTG GGG A-30 Antisense 50 -AAT AAA AGC CAC AGA ATT CAT CA-30 c.3972C > T (p.I1324I) Sense 50 -TAC CGA CCT GAG CTG GAT C-30 Antisense 50 -CAT CCA GGC CTT CCT TCA-30 c.4147 - 35G > A Sense 50 -GTA GCC ACT CCG AGC CTT AG-30 Antisense 50 -GGA ATC AGA CCT GGA TGA AAA-30 c.4508 + 12G > A Sense 50 -CCC ACA GGC TGC ACA CCA T-30 Antisense 50 -TGT TAC TGT TGA GCA AGG GTT A-30 Genotyping primers c.334 - 49C > T 50 -TCT GAA GAA TAC TGC CAC TAA CCG A-30 c.1249G > A (p.V417I) 50 -GAC ATC AGG TTC ACT GTT TCT CCA A-30 c.1457C > T (p.T486I) 50 -GGG TGA CTT TTT CTT TAC CTG AAT G-30 c.2620 + 3A > G 50 -CTA TCT TGT CCC AAT CCT TCT TAC A-30 c.2934G > A (p.S978S) 50 -ACC TAC AAG CAA TAG GAT TGT TTT C-30 c.3972C > T (p.I1324I) 50 -CTC CAC CTA CCT TCT CCA TGC TAC C-30 c.4147 - 35G > A 50 -GAA CTC CGA GGT CCT TTT CTG GCA T-30 c.4508 + 12G > A 50 -AAG CCA TCC GTG TCA AGC CCT GTC C-30 Primers for the DNA sequencing of MRP2 promoter regions g. - 1774delG Sense 50 -GAT TCT CCA CCC TCT CTT TT-30 Antisense 50 -CAT TCA GTG TGG GAG AAA AT-30 g. - 1549G > A Sense 50 -CCC ACT TTT TAA TTT GTT AGT GTA-30 Antisense 50 -CTG GGA CTA CAG GCA CAT-30 g. - 24C > T and g. - 23G > A Sense 50 -TAG GCT CAC ACT GGA TAA GC-30 Antisense 50 -TGC ACA TCT AAC ATT TCT GG-30 Mutagenic primers - 24C-T 50 -CAA TCA TAT TAA TAG AAG AGT CTT CGT TCC AGA CGC AGT CCA GGA A-30 c.1249G > A (p.V417I) 50 -GGA AGG AGT ACA CCA TTG GAG AAA CAG TGA ACC TGA TGT C-30 c.2302C > T (p.R768W) 50 -AAA TCT TAG TGG GGG TCA GAA GCA GTG GAT CAG CCT GGC CAG-30 c.2934G > A (p.S978S) 50 -CTA CAA GCA ATA GGA TTG TTT TCA ATA TTC TTC ATC ATC-30 c.3972C > T (p.I1324I) 50 -GAG GGA TCA CTT GTG ACA TTG GTA GCA TGG AGA AGG TAG G-30 Primers for MRP2 promoter cloning First round PCR ( - 2314 to + 348) Sense 50 -AGA TTC ATG ACT TCC TGG CTC CTT-30 Antisense 50 -ACA ACA ATT CTC CTT CCT CAC ACG-30 Second round PCR ( - 2229 to -1) Sense (KpnI site) 50 -CGG GGT ACC TTG ATG AAC ATT TAG ATT CT-30 Antisense (NheI site) 50 -CTA GCT AGC GAT TCC TGG ACT GCG TCT GG-30 RT-PCR primers for exon 4 splicing Sense (exon 3) 50 -CGT GTA TAA ATC CAG GAC CAA GAG A-30 Antisense (exon 5) 50 -GGA GAT GAA GAA CAG GCA GGA GTA G-30 PCR, polymerase chain reaction; RT-PCR, reverse transcription-polymerase chain reaction. Login to comment
112 Twelve genetic variations were found in the MRP2 gene after comprehensive gene scanning of a total of 100 samples derived from 50 healthy Table 4 Frequency of MRP2 genetic variations in control and toxic hepatitis patients Variant Control Hepatocellular Cholestatic or mixed n n P value n P value g. - 1774delG + / + 50 30 0.28 9 0.04* + / - 46 23 20 - / - 14 4 8 (0.34) (0.27) (0.49) g. - 1549G > A + / + 66 30 0.03* 24 0.11 + / - 42 22 10 - / - 2 5 3 (0.21) (0.28) (0.22) g. - 24C > T + / + 74 31 0.06 25 0.75 + / - 34 22 11 - / - 2 4 1 (0.17) (0.26) (0.18) g. - 23G > A + / + 105 55 37 + / - 5 2 0 (0.02) (0.02) (0.00) c.334 - 49C > T + / + 66 28 0.06 23 0.2 + / - 41 24 11 - / - 3 5 3 (0.21) (0.30) (0.23) c.1249G > A (p.V417I) 92 47 0.22 34 0.29 + / + 15 10 3 + / - 3 0 0 - / - (0.10) (0.09) (0.04) c.1457C > T (p.T486I) 107 56 36 + / + 3 1 1 + / - (0.01) (0.01) (0.01) c.2620 + 3A > G + / + 110 56 37 + / - 0 1 0 (0.00) (0.01) (0.00) c.2934G > A (p.S978S) + / + 100 52 0.52 35 0.35 + / - 9 5 2 - / - 1 0 0 (0.05) (0.04) (0.03) c.3972C > T (p.I1324I) + / + 61 29 0.02* 23 0.12 + / - 47 22 11 - / - 2 6 3 (0.23) (0.30) (0.23) c.4147-35G > A + / + 107 52 37 + / - 3 5 0 (0.01) (0.04) (0.00) c.4508 + 12G > A + / + 108 57 37 + / - 2 0 0 (0.01) (0.00) (0.00) + , major allele, - , minor allele. Login to comment

[hide] The apical conjugate efflux pump ABCC2 (MRP2). Pflugers Arch. 2007 Feb;453(5):643-59. Epub 2006 Jul 18. Nies AT, Keppler D
The apical conjugate efflux pump ABCC2 (MRP2).
Pflugers Arch. 2007 Feb;453(5):643-59. Epub 2006 Jul 18., [PMID:16847695]

Abstract [show]
ABCC2 is a member of the multidrug resistance protein subfamily localized exclusively to the apical membrane domain of polarized cells, such as hepatocytes, renal proximal tubule epithelia, and intestinal epithelia. This localization supports the function of ABCC2 in the terminal excretion and detoxification of endogenous and xenobiotic organic anions, particularly in the unidirectional efflux of substances conjugated with glutathione, glucuronate, or sulfate, as exemplified by leukotriene C(4), bilirubin glucuronosides, and some steroid sulfates. The hepatic ABCC2 pump contributes to the driving forces of bile flow. Acquired or hereditary deficiency of ABCC2, the latter known as Dubin-Johnson syndrome in humans, causes an increased concentration of bilirubin glucuronosides in blood because of their efflux from hepatocytes via the basolateral ABCC3, which compensates for the deficiency in ABCC2-mediated apical efflux. In this article we provide an overview on the molecular characteristics of ABCC2 and its expression in various tissues and species. We discuss the transcriptional and posttranscriptional regulation of ABCC2 and review approaches to the functional analysis providing information on its substrate specificity. A comprehensive list of sequence variants in the human ABCC2 gene summarizes predicted and proven functional consequences, including variants leading to Dubin-Johnson syndrome.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
139 Although all sequence variants associated with Dubin-Johnson syndrome result in the absence of a Table 3 Nucleotide sequence variants in the human ABCC2 gene (NM_000392) leading to amino acid changes in the ABCC2/MRP2 protein (NP_000383) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references Exon 2 c.56 C>Te p.P19L Probably damaging T: 0.007 [63] Exon 2 c.116 T>A p.F39Y Benign A: 0.010 rs927344 A: 0.008 rs17222603 Exon 3 c.298 C>T p.R100Xf DJS [154] Exon 3 c.299 G>Ae p.R100Q Possibly damaging A: 0.007 [63] Exon 7 c.736 A>C p.M246L Benign C: 0.002 rs8187667 C: 0.002 rs17222744 Exon 7 c.842 G>A p.S281N Benign A: 0.0060.056 [117] Exon 8 c.998 A>G p.D333G Possibly damaging G: 0.002 rs8187668 G: 0.004 rs17222674 Exon 9 c.1058 G>A p.R353H Benign A: 0.009 rs7080681 A: 0.014 rs17216205 Exon 9 c.1177 C>T p.R393W DJS Probably damaging [104, 112] Exon 10 c.1234 A>G p.R412G Probably damaging Deficient methotrexate transport function [56] Exon 10 c.1249 G>A p.V417I Benign None apparent [50] A: 0.163 rs2273697, [146] A: 0.158 rs17216184 A: 0.125 [62] A: 0.1830.312 [117] Exon 10 c.1457 C>T p.T486I Benign T: 0.002 rs8187670 T: 0.002 rs17222589 Exon 11 c.1483 A>G p.K495E Possibly damaging G: 0.002 rs8187672 G: 0.002 rs17222561 Exon 13 c.1686 T>G p.F562L Benign G: 0.002 rs8187673 G: 0.002 rs17216233 Exon 16 c.2009 T>C p.I670T Benign rs8187676 C: 0.006 rs17222632 Exon 16 c.2026 G>C p.G676R DJS Probably damaging [181] Exon 17 c.2125 T>C p.W709R DJS Probably damaging [111] Exon 17 c.2153 A>G p.N718S Possibly damaging rs3740072 Exon 17 c.2215 C>T p.L739F Probably damaging T: 0.006 [51] Exon 18 c.2302 C>T p.R768W DJS Probably damaging Deficient maturation and impaired sorting [47] T: 0.010 [62] [168, 180] Exon 18 c.2366 C>T p.S789F Probably damaging Reduced protein levels [50] T: 0.010 [62] Exon 19 c.2546 T>G p.L849R Benign G: 0.002 rs8187689 G: 0.006 rs17222617 Exon 20 c.2647 G>Ae p.D883N Benign A: 0.007 [63] Exon 20 c.2677 G>C p.E893Q Benign rs3740071 Exon 21 c.2882 A>Ge p.K961R Benign G: 0.007 [63] Exon 22 c.2901 C>A p.Y967Xf A: 0.002 rs8187683 A: 0.002 rs17222547 Exon 22 c.2944 A>G p.I982V Benign G: 0.002 rs8187684 G: 0.002 rs17222554 Exon 22 c.3057 G>Te p.Q1019H Benign T: 0.007 [63] Exon 23 c.3107 T>C p.I1036T Possibly damaging C: 0.002 rs8187685 C: 0.004 rs17216149 Exon 23 c.3188 A>G p.N1063S Benign G: 0.002 rs8187686 G: 0.002 rs17222540 Exon 23 c.3196 C>T p.R1066Xf DJS No ABCC2 protein in liver [134] Exon 25 c.3449 G>A p.R1150H DJS Probably damaging Deficient transport function A: 00.009 [117] Exon 25 c.3517 A>T p.I1173F DJS Probably damaging Deficient maturation and impaired sorting, deficient transport function T: 00.029 [117] [80, 117] Exon 25 c.3521 G>Ae p.R1174H Probably damaging A: 0.007 [63] Exon 25 c.3542 G>T p.R1181L Possibly damaging T: 0.039 rs8187692 T: 0.034 rs17222702 Exon 25 c.3563 T>A p.V1188E Benign A: 0.059 rs8187694 A: 0.059 rs17222723 Exon 26 c.3732 T>Ge p.N1244K Possibly damaging G: 0.014 [63] Exon 27 c.3817 A>G p.T1273A Benign G: 0.002 rs8187699 G: 0.004 rs17222582 Exon 27 c.3825 C>G p.Y1275Xf DJS No ABCC2 protein in liver [104] Exon 28 c.3872 C>T p.P1291L Possibly damaging T: 0.012 rs8187700 T: 0.010 rs17216317 Exon 28 c.3895 A>C p.K1299Q Benign rs4148400, [146] Exon 28 c.3928 C>T p.R1310Xf DJS [166] Exon 29 c.4100 C>Ge p.S1367C Possibly damaging G: 0.007 [63] Exon 29 c.4145 A>G p.Q1382R DJS Probably Deficient [47, 168] Table 3 (continued) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references functionally active ABCC2 protein from the canalicular membrane, their effects on the synthesis and function of the ABCC2 protein differ. Login to comment
140 Although all sequence variants associated with Dubin-Johnson syndrome result in the absence of a Table 3 Nucleotide sequence variants in the human ABCC2 gene (NM_000392) leading to amino acid changes in the ABCC2/MRP2 protein (NP_000383) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references Exon 2 c.56 C>Te p.P19L Probably damaging T: 0.007 [63] Exon 2 c.116 T>A p.F39Y Benign A: 0.010 rs927344 A: 0.008 rs17222603 Exon 3 c.298 C>T p.R100Xf DJS [154] Exon 3 c.299 G>Ae p.R100Q Possibly damaging A: 0.007 [63] Exon 7 c.736 A>C p.M246L Benign C: 0.002 rs8187667 C: 0.002 rs17222744 Exon 7 c.842 G>A p.S281N Benign A: 0.0060.056 [117] Exon 8 c.998 A>G p.D333G Possibly damaging G: 0.002 rs8187668 G: 0.004 rs17222674 Exon 9 c.1058 G>A p.R353H Benign A: 0.009 rs7080681 A: 0.014 rs17216205 Exon 9 c.1177 C>T p.R393W DJS Probably damaging [104, 112] Exon 10 c.1234 A>G p.R412G Probably damaging Deficient methotrexate transport function [56] Exon 10 c.1249 G>A p.V417I Benign None apparent [50] A: 0.163 rs2273697, [146] A: 0.158 rs17216184 A: 0.125 [62] A: 0.1830.312 [117] Exon 10 c.1457 C>T p.T486I Benign T: 0.002 rs8187670 T: 0.002 rs17222589 Exon 11 c.1483 A>G p.K495E Possibly damaging G: 0.002 rs8187672 G: 0.002 rs17222561 Exon 13 c.1686 T>G p.F562L Benign G: 0.002 rs8187673 G: 0.002 rs17216233 Exon 16 c.2009 T>C p.I670T Benign rs8187676 C: 0.006 rs17222632 Exon 16 c.2026 G>C p.G676R DJS Probably damaging [181] Exon 17 c.2125 T>C p.W709R DJS Probably damaging [111] Exon 17 c.2153 A>G p.N718S Possibly damaging rs3740072 Exon 17 c.2215 C>T p.L739F Probably damaging T: 0.006 [51] Exon 18 c.2302 C>T p.R768W DJS Probably damaging Deficient maturation and impaired sorting [47] T: 0.010 [62] [168, 180] Exon 18 c.2366 C>T p.S789F Probably damaging Reduced protein levels [50] T: 0.010 [62] Exon 19 c.2546 T>G p.L849R Benign G: 0.002 rs8187689 G: 0.006 rs17222617 Exon 20 c.2647 G>Ae p.D883N Benign A: 0.007 [63] Exon 20 c.2677 G>C p.E893Q Benign rs3740071 Exon 21 c.2882 A>Ge p.K961R Benign G: 0.007 [63] Exon 22 c.2901 C>A p.Y967Xf A: 0.002 rs8187683 A: 0.002 rs17222547 Exon 22 c.2944 A>G p.I982V Benign G: 0.002 rs8187684 G: 0.002 rs17222554 Exon 22 c.3057 G>Te p.Q1019H Benign T: 0.007 [63] Exon 23 c.3107 T>C p.I1036T Possibly damaging C: 0.002 rs8187685 C: 0.004 rs17216149 Exon 23 c.3188 A>G p.N1063S Benign G: 0.002 rs8187686 G: 0.002 rs17222540 Exon 23 c.3196 C>T p.R1066Xf DJS No ABCC2 protein in liver [134] Exon 25 c.3449 G>A p.R1150H DJS Probably damaging Deficient transport function A: 00.009 [117] Exon 25 c.3517 A>T p.I1173F DJS Probably damaging Deficient maturation and impaired sorting, deficient transport function T: 00.029 [117] [80, 117] Exon 25 c.3521 G>Ae p.R1174H Probably damaging A: 0.007 [63] Exon 25 c.3542 G>T p.R1181L Possibly damaging T: 0.039 rs8187692 T: 0.034 rs17222702 Exon 25 c.3563 T>A p.V1188E Benign A: 0.059 rs8187694 A: 0.059 rs17222723 Exon 26 c.3732 T>Ge p.N1244K Possibly damaging G: 0.014 [63] Exon 27 c.3817 A>G p.T1273A Benign G: 0.002 rs8187699 G: 0.004 rs17222582 Exon 27 c.3825 C>G p.Y1275Xf DJS No ABCC2 protein in liver [104] Exon 28 c.3872 C>T p.P1291L Possibly damaging T: 0.012 rs8187700 T: 0.010 rs17216317 Exon 28 c.3895 A>C p.K1299Q Benign rs4148400, [146] Exon 28 c.3928 C>T p.R1310Xf DJS [166] Exon 29 c.4100 C>Ge p.S1367C Possibly damaging G: 0.007 [63] Exon 29 c.4145 A>G p.Q1382R DJS Probably Deficient [47, 168] Table 3 (continued) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references functionally active ABCC2 protein from the canalicular membrane, their effects on the synthesis and function of the ABCC2 protein differ. Login to comment

[hide] Polymorphisms in the ABCC2 (cMOAT/MRP2) gene found... Drug Metab Dispos. 2002 Apr;30(4):363-4. Itoda M, Saito Y, Soyama A, Saeki M, Murayama N, Ishida S, Sai K, Nagano M, Suzuki H, Sugiyama Y, Ozawa S, Sawada Ji J
Polymorphisms in the ABCC2 (cMOAT/MRP2) gene found in 72 established cell lines derived from Japanese individuals: an association between single nucleotide polymorphisms in the 5'-untranslated region and exon 28.
Drug Metab Dispos. 2002 Apr;30(4):363-4., [PMID:11901087]

Abstract [show]
We found nucleotide variability in the 5'-upstream region and exonic sequences of a gene-encoding canalicular multispecific organic anion transporter/multidrug resistance-associated protein 2 (cMOAT/MRP2) by polymerase chain reaction-based sequencing using genomic DNA from 72 established cell lines derived from 72 Japanese individuals. Four single nucleotide polymorphisms (SNPs) were found in the 5'-untranslational region and 21 in the exonic regions. Of them, 14 were nonsynonymous SNPs. One deletion of seven consecutive adenines resulting in a frameshift variant was also found. Four SNPs, c-24t, g1249a (V417I), c2366t (S789F), and c3972t (I1324I), were the same as those recently reported. A strong association was found between c-24t (5'-untranslated region) and c3972t (exon 28), with the promoter activity of the former worth being compared.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
22 Of those, 12 nucleotide changes were nonsynonymous, and the frequency for c1457t (T486I) was approximately 0.03 (Table 1). Login to comment
26 The amino acid substitutions S789F (c2366t) and S1367C (c4100g) were reportedly located in nucleotide binding domains 1 and 2, respectively, those of V417I (g1249a) and T486I (c1457t) in membrane-spanning domain 2, and that of Q1019H (g3057t) in membrane spanning domain 3 (Toh et al., 1999). Login to comment
57 Location Substitution Genotype 72 Cell Linesa (48 Subjects)b Nucleotide Amino Acid w/w w/m m/m 5Ј-Flanking t-751a 71 1 0 5Ј-Flanking c-717t 71 1 0 5Ј-UTR c-24t 52 (31) 14 (16) 6 (1) 5Ј-UTR g-23a 70 2 0 Exon 2 c56t P19L 71 1 0 Exon 3 a234g L78L 71 1 0 Exon 3 g299a R100Q 71 1 0 Exon 7 g842a S281N 71 1 0 Exon 10 g1249a V417I 59 (37) 9 (10) 4 (1) Exon 10 c1457t T486I 69 2 1 Exon 18 c2302t R768W 72 (47) 0 (1) 0 (0) Exon 18 c2366t S789F 71 (47) 1 (1) 0 (0) Exon 20 g2647a D883N 71 1 0 Exon 21 a2882g K961R 71 1 0 Exon 22 g2934a S978S 66 5 1 Exon 22 c3039t T1013T 71 0 1 Exon 22 g3057t Q1019H 71 1 0 Exon 24 g3321t L1107L 71 1 0 Exon 25 g3521a R1174H 71 1 0 Exon 25 t3563a V1188E 71 1 0 Exon 26 t3732g N1244K 71 0 1 Exon 28 c3972t I1324I 49 (29) 14 (17) 9 (2) Exon 29 c4100g S1367C 71 1 0 Exon 30 g4290t V1430V 71 1 0 Exon 31 g4348a A1450T 72 (47) 0 (1) 0 (0) Exon 31 c4488t H1496H 71 1 0 Exon 32 g4544a C1515Y 71 1 0 UTR, untranslated region. Login to comment

[hide] Genetic Variations of ABCC2 Gene Associated with A... Genomics Inform. 2013 Dec;11(4):254-62. doi: 10.5808/GI.2013.11.4.254. Epub 2013 Dec 31. Yi JH, Cho YJ, Kim WJ, Lee MG, Lee JH
Genetic Variations of ABCC2 Gene Associated with Adverse Drug Reactions to Valproic Acid in Korean Epileptic Patients.
Genomics Inform. 2013 Dec;11(4):254-62. doi: 10.5808/GI.2013.11.4.254. Epub 2013 Dec 31., [PMID:24465238]

Abstract [show]
The multidrug resistance protein 2 (MRP2, ABCC2) gene may determine individual susceptibility to adverse drug reactions (ADRs) in the central nervous system (CNS) by limiting brain access of antiepileptic drugs, especially valproic acid (VPA). Our objective was to investigate the effect of ABCC2 polymorphisms on ADRs caused by VPA in Korean epileptic patients. We examined the association of ABCC2 single-nucleotide polymorphisms and haplotype frequencies with VPA related to adverse reactions. In addition, the association of the polymorphisms with the risk of VPA related to adverse reactions was estimated by logistic regression analysis. A total of 41 (24.4%) patients had shown VPA-related adverse reactions in CNS, and the most frequent symptom was tremor (78.0%). The patients with CNS ADRs were more likely to have the G allele (79.3% vs. 62.7%, p = 0.0057) and the GG genotype (61.0% vs. 39.7%, p = 0.019) at the g.-1774delG locus. The frequency of the haplotype containing g.-1774Gdel was significantly lower in the patients with CNS ADRs than without CNS ADRs (15.8% vs. 32.3%, p = 0.0039). Lastly, in the multivariate logistic regression analysis, the presence of the GG genotype at the g.-1774delG locus was identified as a stronger risk factor for VPA related to ADRs (odds ratio, 8.53; 95% confidence interval, 1.04 to 70.17). We demonstrated that ABCC2 polymorphisms may influence VPA-related ADRs. The results above suggest the possible usefulness of ABCC2 gene polymorphisms as a marker for predicting response to VPA-related ADRs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
76 Based on logistic regression, ADRs were more likely to occur in Variant Allele Control Epilepsy patient p-value CNS ADR-Yes CNS ADR-No g.ߜ1774delG G 146 (66.4) 65 (79.3) 158 (62.7) 0.0057** del 74 (33.6) 17 (20.7) 94 (37.3) g.ߜ1549G > A G 174 (79.1) 59 (72.0) 199 (80.2) 0.1151 A 46 (20.6) 23 (28.0) 49 (19.8) g.ߜ24C > T C 182 (72.7) 54 (65.9) 198 (78.0) 0.0278* rs717620 T 38 (17.3) 28 (34.1) 56 (22.0) g.ߜ23G > A G 215 (97.7) 82 (100.0) 253 (99.6) 0.5693 A 5 (2.3) 0 (0.0) 1 (0.4) c.1249G > A G 199 (90.5) 73 (89.0) 235 (92.5) 0.3194 (p.V417I, rs2273697) A 21 (9.5) 9 (11.0) 19 (7.5) c.1457C > T C 217 (98.6) 82 (100.0) 254 (100.0) - (p.T486I) T 3 (1.4) 0 (0.0) 0 (0.0) c.2620 + 3A > G A 220 (100) 82 (100.0) 254 (100.0) - G 0 0 (0.0) 0 (0.0) c.2934G > A G 209 (95.0) 79 (96.3) 244 (96.1) 0.9095 (p.S978S, rs3740070) A 11 (5.0) 3 (3.7) 10 (3.9) c.3972C > T C 169 (76.8) 53 (64.6) 192 (75.6) 0.0522 (p.I1324I, rs3740066) T 51 (23.2) 29 (35.4) 62 (24.4) c.4147 ߜ 35G > A G 217 (98.6) 80 (97.6) 253 (99.6) 0.0869 A 3 (1.4) 2 (2.4) 1 (0.4) c.4508 + 12G > A G 218 (99.1) 82 (100.0) 254 (100.0) - A 2 (0.9) 0 (0.0) 0 (0.0) Values are presented as number (%). Login to comment
95 The frequency of haplotype 3 was higher in ID ߜ1774 Gdel ߜ1549 G/A ߜ24C/T ߜ23G/A V471I T486I 2620+ 3A/G 2934 G/A 3972C/ T 4147&#ff0d; 35G/A 4508+ 12G/A Group Control CNS ADR -Yes CNS ADR -No 1 del G C G V C A G C G G 69 (31.3) 13 (15.8) 82 (32.3)** 2 G G C G V C A G C G G 54 (24.4) 24 (29.0) 65 (25.7) 3 G A T G V C A G T G G 31 (14.2) 18 (22.3)* 29 (11.4) 4 G G C G I C A G C G G 19 (8.7) 8 (9.3) 17 (6.7) 5 G G T G V C A G T G G 4 (1.7) 9 (10.6) 25 (9.8) ľd; ľd; ľd; ľd; ľd; ľd; ľd; ľd; ľd; ľd; ľd; ľd; ľd; ľd; ľd; Total 220 82 254 Values are presented as number (%). Login to comment
104 Frequency of MRP2 haplotypes in control and epilepsy patients Variant Control Epilepsy patient p-value CNS ADR-Yes CNS ADR-No g.ߜ1774delG +/+a 50 (45.5) 25 (61.0) 50 (39.7) 0.019* +/ߜ 46 (41.8) 15 (36.6) 58 (46.0) ߜ/ߜ 14 (12.7) 1 (2.4) 18 (14.3) g.ߜ1549G > A +/+ 66 (60.0) 21 (51.2) 82 (66.1) 0.440 +/ߜ 42 (38.2) 17 (41.5) 35 (28.2) ߜ/ߜ 2 (1.8) 3 (7.3) 7 (5.6) g.ߜ24C > T +/+ 74 (67.3) 17 (41.5) 79 (62.2) 0.243 rs717620 +/ߜ 34 (30.9) 20 (48.8) 40 (31.5) ߜ/ߜ 2 (1.8) 4 (9.8) 8 (6.3) g.ߜ23G > A +/+ 105 (95.5) 41 (100.0) 126 (99.2) >0.999 +/ߜ 5 (4.5) 0 (0.0) 1 (0.8) c.1249G > A +/+ 92 (83.6) 32 (78.0) 109 (85.8) >0.999 (p.V417I) +/ߜ 15 (13.6) 9 (22.0) 17 (13.4) rs2273697 ߜ/ߜ 3 (2.7) 0 (0.0) 1 (0.8) c.1457C > T +/+ 107 (97.3) 41 (100.0) 127 (100.0) - (p.T486I) +/ߜ 3 (2.7) 0 (0.0) 0 (0.0) c.2620 + 3A > G +/+ 110 (100.0) 41 (100.0) 127 (100.0) - c.2934G > A +/+ 100 (90.9) 38 (92.7) 117 (92.1) - (p.S978S) +/ߜ 9 (8.2) 3 (7.3) 10 (7.9) rs3740070 ߜ/ߜ 1 (0.9) 0 (0.0) 0 (0.0) c.3972C > T +/+ 61 (55.5) 17 (41.5) 74 (58.3) 0.164 (p.I1324I) +/ߜ 47 (42.7) 19 (46.3) 44 (34.6) rs3740066 ߜ/ߜ 2 (1.8) 5 (12.2) 9 (7.1) c.4147 ߜ 35G > A +/+ 107 (97.3) 39 (95.1) 126 (99.2) 0.141 +/ߜ 3 (2.7) 2 (4.9) 1 (0.8) c.4508 + 12G > A +/+ 108 (98.2) 41 (100.0) 127 (100.0) - +/ߜ 2 (1.8) 0 (0.0) 0 (0.0) Values are presented as number (%). Login to comment