ABCMdb

ABCC2 p.Thr486Ile

None has been submitted yet.

Publications

PMID: 16766035 [PubMed] Cascorbi I et al: "Role of pharmacogenetics of ATP-binding cassette transporters in the pharmacokinetics of drugs."

No. Sentence Comment

882 0.01 Exon 2 56 C>T P19L 0.01 Exon 3 234 A>G synonymous 0.01 Exon 3 299 G>A R100Q 0.01 Exon 7 842 G>A S281N 0.01 Exon 10 1249 G>A V417I 0.12 (0.21) Exon 10 1457 C>T T486I 0.03 Exon 18 2302 C>T R768W 0.01 (0.00) Exon 18 2366 C>T S789F 0.01 (0.00) slightly elevated activity, lower expressionb Exon 20 2647 G>A D883N 0.01 Exon 21 2882 A>G K961R 0.01 Exon 22 2934 G>A synonymous 0.05 Exon 22 3039 C>T synonymous 0.01 Exon 22 3057 G>T Q1019H 0.01 Exon 24 3321 G>T synonymous 0.01 Exon 25 3521 G>A R1174H 0.01 Exon 25 3563 T>A V1188E 0.01 Exon 26 3732 C>T N1244K 0.01 Exon 28 3972 C>T synonymous 0.21 (0.34) Exon 29 4100 C>G S1367C 0.01 Exon 30 4290 G>T synonymous 0.01 Exon 31 4348 G>A A1450T 0.01 (0.00) decreased activity, lower expressionb Exon 31 4488 C>T synonymous 0.01 Exon 32 4544 G>A C1515Y 0.01 a Haenisch et al. (in press). Login to comment

PMID: 18464048 [PubMed] Gradhand U et al: "Pharmacogenomics of MRP transporters (ABCC1-5) and BCRP (ABCG2)."

No. Sentence Comment

101 Several molecular defects in MRP2 have been suggested to result in DJS including those which produce deficient protein maturation (Hashimoto et al., 2002; Keitel et al., 2003), proteasomal degradation (Keitel, 2003), impaired membrane sorting (Hashimoto et al., 2002; Mor-Cohen et al., 2001), loss in transport activity (Mor-Cohen et al., 2001), Figure 2 Predicted membrance topology of MRP2 (ABCC2) based on hydrophobicity analysis. Locations of the non-synonymous polymorphisms are indicated with arrows. See Table 2 for allele frequencies and description of funtional consequences. NH2 COOH NBD NBD in out Membrane Pro19Leu Phe39Tyr Arg100* Arg100Gln Ser281Asn Ser325* Asp333Gly Arg353His Arg412Gly Val417Ile Lys430Arg Thr486Ile Gly676Arg Trp709Arg Asn718Ser Ser789Phe Arg768Trp Asp833Asn Glu893Gln Leu927Arg Lys961Arg Tyr967* Phe981Leu Gln1019His Arg1066* Arg1150His Arg1100Cys Arg1100His Ile1137Phe Ile1173Phe Val1188Glu Arg1174His Arg1181Leu Asn1244Lys Thr1273Ala Pro1291Leu Lys1299Gln Arg1310* Ser1367Cys Gln1382Arg Arg1392del Met1393del Ala1450Thr Thr1476Met Cys1515Tyr MRP2 (ABCC2) NBD NBD Asp833Asn Glu893Gln Leu927Arg Lys961Arg Tyr967* NBD NBDNBD Asp833Asn Glu893Gln Leu927Arg Lys961Arg Tyr967* 325 Table2MRP2(ABCC2)singlenucleotidepolymorphisms.Location,allelefrequencyandfunctionaleffects. Positionin codingsequence Amino acidexchangeLocation Allelefrequency EffectNCBIIDReferenceAfCaJpothers 56C>TPro19LeuExon2--1[1]b -- 116T>APhe39TyrExon2--0[2]--rs927344 298C>TArg100*Exon3--[3]-DJS[3] 299G>AArg100GlnExon3--1[1]b -- 842G>ASer281AsnExon7-0[4]1[1]b -- 974C>GSer325*Exon8---Malayan[5]DJS[5] 998A>GAsp333GlyExon8--0[2]--rs17222674 1058G>AArg353HisExon9--0[2]--rs7080681 1271A>GArg412GlyExon10-[6]0[2]-DJS;Decreaseinmethotrexateelimination[6] 1249G>AVal417IleExon10-22[7]13[9]-lowermRNAand(protein)expressioninpreterm placenta[11] rs2273697 26[8]16[4]noeffectonRNAandproteinininduodenum[12] 19[10]noeffectonproteininliver[8] noeffectonconjugatedbilirubinlevelinserum[13] changesinlocalizationinneuroepithelialtumors[14] possibleassociationwithtenofovir-inducedrenal proximaltubulopathy[15] 1289A>GLys430ArgExon10-4[16]0[2]-- 1457C>TThr486IleExon10-0[4]3[1]b -- 2026G>CGly676Arg--0[2]-DJS[17] 2125T>CTrp709Arg--0[2]-DJS[17] 2153A>GAsn718SerExon17-0[4]0[2]--rs3740072 2302C>TArg768TrpExon18-0[18]1[9]-DJS;deficientmaturationandimpairedsorting[19] 2366C>TSer789PheExon18-0[18]1[9]-lowerexpressionandmembranelocalization[20] noeffectonconjugatedbilirubinlevelinserum[13]/ heterozygous 2647G>AAsp883AsnExon20--1[1]b -- 2677G>CGlu893GlnExon20--0[2]--rs3740071 2780T>GLeu927ArgExon21-1[10]0[2]-- (Continued) Table2(Continued) Positionin codingsequence Aminoacid exchangeLocation Allelefrequency EffectNCBIIDReferenceAfCaJpothers 2882A>GLys961ArgExon21--1[1]b --- 2901C>ATyr967*Exon22--0[2]--rs17222547 2943C>GPhe981LeuExon22-2[21]0[2]-Noinfluenceonpravastatinkinetics[21] 3057G>TGln1019HisExon22--1[1]b -- 3196C>TArg1066*Exon23-[22]0[2]-DJS;truncatedprotein[22][23] 3298C>TArg1100CysExon24-1[10]0[2]-- 3299G>AArg1100HisExon24-1[10]0[2]-- 3449G>AArg1150HisExon25--0[2]Israeli[24]DJS;impairedtransportactivityintransfectedcells althoughnormalexpressionandlocalization[24] 3517A>TIle1173PheExon25--0[2]Israeli[24]DJS;impairedproteinmaturationandproteasomal degradation[25] lowexpression,mislocation,andimpairedtransport activityintransfectedcells[24] 3521G>AArg1174HisExon25-0[4]1[1]b -- 3542G>TArg1181LeuExon25-0[4]0[2]--rs8187692 3563T>AVal1188GluExon25-7[4]1[1]b -noeffectonnelfinaviraccumulationinPBMC[4],rs17222723 4[16]associatedwithanthracycline-induced cardiotoxicity[26] 6[8] 3732C>TAsn1244LysExon26--0[1]b -- 0[2] 3817A>GThr1273AlaExon27--0[2]--rs8187699 3872C>TPro1291LeuExon28--0[2]--rs17216317 3897A>CLys1299GlnExon28--0[2]--rs4148400 3928C>TArg1310*Exon28--0[2]-DJS[17,27] 4100C>GSer1367CysExon29--1[1]b -- 4145A>GGln1382ArgExon29--[28]-DJS;noeffectonmaturationorsorting,impaired substrate-inducedATPhydrolysis[19] 4175-80delArg1392delExon30--0[2]-DJS;deficientMRP2maturationandimpaired sortingtoapicalmembraneintransfectedcells[29] 327 4348G>AAla11450ThrExon31-0[18]1[9]-lowerexperssionandmembracelocalizationin transfectedcells[20] 4461C>TThr1476MetExon31-[30]1[2]-- 4544G>ACys1515TyrExon32-9[4]1[1]b -noeffectonnelfinaviraccumulationinPBMC[4]rs8187710 5[10]associatedwithanthracycline-induced cardiotoxicity[26] 4[16] 6[8] ReferencewithoutfrequencymeansthatSNPwasdetectedbutnofrequencydetermined. Login to comment

PMID: 18673259 [PubMed] Nakamura T et al: "Pharmacogenetics of intestinal absorption."

No. Sentence Comment

83 In Vitro Studies Associated with Common SNPs of Drug Transporter Genes Exon Polymorphism Effect dbSNP Cell Expression Function Reference ABCC2 Exon 1 -24C>T 5`-UTR rs717620 116A>T Tyr2Phe rs927344Exon 2 159A>G synonymous rs17222596 Exon 7 736A>C Met246Leu rs17222744 Exon 8 998A>G Asp333Gly rs17222674 Exon 9 1058G>A Arg353His rs7080681 1219C>T synonymous rs17216198 1249G>A Val417Ile rs2273697 LLC-PK1 Protein (n.s.) Membrane localization (n.s.) Transport activity (n.s.) Hirouchi et al. [51] 1434G>T synonymous 1434G>A synonymous rs4267009 Exon 10 1457C>T Thr486Ile rs17222589 Exon 11 1483A>G Lys495Glu rs17222561 Exon 13 1686T>G Phe562Leu rs17216233 2009T>C Ile670Thr rs17222632Exon 16 2073C>A synonymous rs17222624 Exon 17 2153A>G Asn718Ser rs3740072 Exon 19 2546T>G Leu849Arg rs17222617 Exon 20 2677G>C Glu893Gln rs3740071 2901C>A Tyr967stop rs17222547 2934G>A synonymous rs3740070 Exon 22 2944A>G Ile982Val rs17222554 3107T>C Ile1036Thr rs17216149Exon 23 3188A>G Asn1063Ser rs17222540 Exon 24 3396T>C synonymous rs17216345 3542G>T Arg1181Leu rs8187692 3561G>A synonymous rs17216324 Exon 25 3563T>A Val1188Glu rs17222723 Exon 27 3817A>G Thr1273Ara rs8187699 3872C>T Pro1291Leu rs17216317 3895A>C Lys1299Gln rs4148400 3927C>T synonymous rs4148401 Exon 28 3972C>T synonymous rs3740066 4062C>T synonymous rs17216275Exon 29 4110C>T synonymous rs7899457 4242C>T synonymous rs17216296Exon 30 4290G>T synonymous rs1137968 4410G>A synonymous rs8187706Exon 31 4488C>T synonymous rs8187707 4527C>T synonymous rs8187709Exon 32 4544G>A Cys1515Tyr rs8187710 ABCG2 PA317 mRNA (n.s.) Protein (n.s.) Drug sensitivity (n.s.) Topotecan uptake (n.s.) Imai et al. [85] mRNA (n.s.) Protein (n.s.) Apical localization (impaired) Drug sensitivity ( ) Indolocarbazole uptake ( ) Indolocarbazole efflux ( ) Mizuarai et al. [88] Exon 2 34G>A Val12Met rs2231137 LLC-PK1 Apical localization (n.s.) . Login to comment
92 Exon Polymorphism Effect dbSNP Subject Expression Function Reference DNT patient Tumoral protein (GG GA) Peritumoral protein (GG GA) Vogelgesang et al. [54] Nasopharyngeal cancer patient Irinotecan PK (CC CT TT) SN-38 PK (CC CT TT) SN-38G PK (CC CT TT) Zhou et al. [56] Colorectal cancer patient (Japanese) Tumoral mRNA (CC CT TT) Drug sensitivity (CC CT TT) Tumor growth rate (CC CT TT) Nishioka et al. [57] HIV patient (Caucasian) Nelfinavir intracellular AUC (CC CT TT) Colombo et al. [58] Spina Bifida patient Disease-susceptibility (CC CT TT) Jensen et al. [60] Cancer patient (Caucasian) Diflomotecan PK (CC CA) Sparreboom et al. [96] 116A>T Tyr2Phe rs927344Exon 2 159A>G synonymous rs17222596 Exon 7 736A>C Met246Leu rs17222744 Exon 8 998A>G Asp333Gly rs17222674 Exon 9 1058G>A Arg353His rs7080681 1219C>T synonymous rs17216198 1249G>A Val417Ile rs2273697 Healthy (Finnish) Pravastatin PK (GG GA AA) Niemi et al. [48] Women undergoing cesarean section Placental mRNA [preterms] (GG>GA>AA), [term] (GG GA AA) Placental protein (GG GA AA) Meyer zu Schwabedissen et al. [52] DNT patient Tumoral protein (GG<GA) Peritumoral protein (GG GA) Vogelgesang et al. [54] HIV patient (Caucasian) Nelfinavir intracellular AUC (GG GA AA) Colombo et al. [58] Cancer patient (Caucasian) Diflomotecan PK (CC CA) Sparreboom et al. [96] 1434G>T synonymous 1434G>A synonymous rs4267009 Exon 10 1457C>T Thr486Ile rs17222589 Exon 11 1483A>G Lys495Glu rs17222561 Exon 13 1686T>G Phe562Leu rs17216233 2009T>C Ile670Thr rs17222632Exon 16 2073C>A synonymous rs17222624 Exon 17 2153A>G Asn718Ser rs3740072 Exon 19 2546T>G Leu849Arg rs17222617 Exon 20 2677G>C Glu893Gln rs3740071 2901C>A Tyr967stop rs17222547 2934G>A synonymous rs3740070 Exon 22 2944A>G Ile982Val rs17222554 3107T>C Ile1036Thr rs17216149Exon 23 3188A>G Asn1063Ser rs17222540 (Table 3) contd…. Login to comment

PMID: 19949922 [PubMed] Cascorbi I et al: "Pharmacogenetics of ATP-binding cassette transporters and clinical implications."

No. Sentence Comment

190 0.01* (0.00) c. 56 C>T P19L 0.01* c. 234 A>G Synonymous 0.01* c. 299 G>A R100Q 0.01* c. 842 G>A S281N 0.01* c. 1249 G>A V417I 0.13 (0.21) c. 1446 C>G (0.01) c. 1457 C>T T486I 0.03* (0.00) c. 2302 C>T R768W 0.01 (0.00) c. 2366 C>T S789F 0.01 (0.00) c. 2647 G>A D883N 0.01* c. 2882 A>G K961R 0.01* c. 2934 G>A Synonymous 0.05* c. 3039 C>T Synonymous 0.01* c. 3057 G>T Q1019H 0.01* c. 3321 G>T Synonymous 0.01* c. 3521 G>A R1174H 0.01* c. 3542 G>T (0.001) c. 3561 G>A (0.00) c. 3563 T>A V1188E 0.01* (0.05) c. 3732 C>T N1244K 0.01* c. 3972 C>T Synonymous 0.22* (0.34) c. 4100 C>G S1367C 0.01* c. 4290 G>T Synonymous 0.01* c. 4348 G>A A1450T 0.01 (0.00) c. 4488 C>T Synonymous 0.01* c. 4544 G>A C1515Y 0.01* (0.04) association to cholestatic or mixed type hepatitis whereas -24T carriers exhibited more often hepatocellular-type hepatitis after intake of drugs or herbal remedies (96). Login to comment

PMID: 16041239 [PubMed] Colombo S et al: "Influence of ABCB1, ABCC1, ABCC2, and ABCG2 haplotypes on the cellular exposure of nelfinavir in vivo."

No. Sentence Comment

71 - 24C > T exon 1 Itoda et al., 2002 mp-v-004 rs717620 IVS 6-30 G > T intron 6 Epidauros mp-v-051 rs8187666 c.842G > A exon 7 p.S281N Epidauros mp-v-115 c.998G > A intron 7 Epidauros mp-v-083 c.1219C > T exon 10 synonymous (p.L407L) Epidauros mp-v-007 rs8187669 c.1249G > A exon 10 p.V417I Itoda et al., 2002 mp-v-008 rs2273697 c.1346C > G exon 10 synonymous (p.T482T) Epidauros mp-v-114 c.1457C > T exon 10 p.T486I Epidauros mp-v-055 rs8187670 IVS 16 - 47 G > A intron 16 Epidauros mp-v-118 IVS 16 - 30 T > A intron 16 Epidauros mp-v-119 c.2153A > G exon 17 p.N718S Epidauros mp-v-093 rs3740072 c.2216T > C exon 17 p.L739P Epidauros mp-v-108 c.3449G > A exon 25 p.R1150H Mor-Cohen et al., 2001 mp-v-085 c.3517A > T exon 25 p.I1173F Keitel et al., 2003 mp-v-096 c.3521G > A exon 25 p.R1174H Epidauros mp-v-068 c.3542G > T exon 25 p.R1181L Epidauros mp-v-069 rs8187692 c.3563T > A exon 25 p.V1188E Epidauros mp-v-025 rs8187694 IVS 30 - 53 C > T intron 30 Epidauros mp-v-105 rs3824610 c.4348G > A exon 31 p.A1450T Suzuki et al. 2002 mp-v-106 c.4410G > A exon 31 synonymous (p.E1470E) Epidauros mp-v-077 rs8187706 c.4488C > T exon 31 synonymous (p.H1496H) Epidauros mp-v-038 rs8187707 IVS 31 + 12 G > A intron 31 Epidauros mp-v-039 rs8187708 IVS 31 + 74 C > T intron 31 Epidauros mp-v-040 IVS 31 - 9 T > C intron 31 Epidauros mp-v-042 c 4527C > T exon 32 synonymous (p.A1509A) Epidauros mp-v-048 rs8187709 c.4544G > A exon 32 p.C1515Y Epidauros mp-v-043 rs8187710 + 259 G > T 30 flanking Epidauros mp-v-120 Transporter polymorphisms and HIV treatment Colombo et al. 601 BCRP (ABCG2) g. Login to comment

PMID: 22290738 [PubMed] Arlanov R et al: "Functional characterization of protein variants of the human multidrug transporter ABCC2 by a novel targeted expression system in fibrosarcoma cells."

No. Sentence Comment

176 Immunoblots of the variants F39Y, R353H, T486I, I670T, G921S, I1036T, N1244K, and P1291L showed similar expression compared with WT (range 85-110% of WT). Login to comment
178 ABCC2 Missense Variants Selected for Study on Expression, Localization, and Function rs# NCBI Genetic variationa Amino acid Ethnicity Allele frequency (%) Nb Data source Predicted phenotypec rs927344 c.116T>A F39Y AA 2.3 86 Current study Benign AA 2 200 pharmGKB KO 0 94 Current study rs17222674 c.998A>G D333G AA 0 88 Current study Probably damaging AA 1 200 pharmGKB KO 0 94 Current study rs7080681 c.1058G>A R353H AA 6.7 90 Current study Benign AA 3.5 200 pharmGKB KO 0 94 Current study rs17222589 c.1457C>T T486I AA 0 84 Current study Benign KO 3.7 82 Current study JA 5 20 pharmGKB JA 2.3 144 Itoda et al. (2002) rs17222632 c.2009T>C I670T AA 1.1 92 Current study Benign AA 1.5 200 pharmGKB KO 0 92 Current study rs41318029 c.2761G>A G921S AA 0 84 Current study Benign KO 0 92 Current study CA 1 120 NCBI dbSNP rs45441199 c.3107T>C I1036T AA 0 96 Current study Benign AA 0.5 200 pharmGKB KO 0 94 Current study CA 0.5 198 pharmGKB CA 1 120 NCBI dbSNP rs139188247 c.3521G>A R1174H AA 2.3 86 Current study Probably damaging KO 0 94 Current study JA 1 144 Itoda et al. (2002) rs8187692 c.3542G>T R1181L AA 5.8 86 Current study Probably damaging AA 8.5 200 pharmGKB KO 0 96 Current study rs17222723 c.3563T>A V1188E AA 5.8 86 Current study Benign AA 6.5 200 pharmGKB KO 0 96 Current study CA 7.5 200 pharmGKB c.3732T>G N1244K JA 1.5 144 Itoda et al. (2002) Possibly damaging rs17216317 c.3872C>T P1291L AA 4.7 86 Current study Probably damaging AA 2 86 pharmGKB KO 0 86 Current study CA 0.5 196 pharmGKB rs8187710 c.4544G>A C1515Y AA 13 92 Current study Benign AA 19.6 194 pharmGKB KO 0 94 Current study CA 8 198 pharmGKB AA, African-American; CA, Caucasian; KO, Korean; JA, Japanese. Login to comment
217 The D333G, R353H, T486I, G921S, and P1291L variants showed a lower transport activity for GS-MCB (71%, 60%, 75%, 63%, and 51% of WT, P < 0.01) but not for GS-MF, whereas the variants F39Y, I1036T, and V1188E/C1515Y did not alter ABCC2-mediated transport for either substrate. Login to comment
267 Finally, GS-MF and/or GS-MCB efflux for all other ABCC2 variants (F39Y, D333G, R353H, T486I, I670T, G921S, and I1036T) showed only minor alterations compared with WT based on our definition of at least 50% change in transport activity. Login to comment
300 Conservation of the ABCC2 Missense Variants Among Other ABCC Orthologs and Homologs Protein Speciesa F39Y D333G R353H T486I I670T G921S I1036T R1174H R1181L V1188E N1244K P1291L C1515Y ABCC2 Human F D R T I G I R R V N P C Mouse F D P K V S I R R K N P Y Rat F D S N V S I R R K N P Y Rabbit F D P N V G L R R I N P Y Rhesus F D R T M S I R R V N P Y ABCC1 Human Y D T T V G I R R L Y P Y Mouse Y D R T V G A R R L Y P C Rat Y D R T V V V R R L Y P C Macaque Y D T T V G I R R L Y P Y Dog Y D K T V G I R R L Y P C ABCC3 Human Y D P A V G F R D T Y E F Mouse Y N P T V V L R D T Y P F Rat Y D P T V G L R D A Y P F ABCC4 Human - E Y S V R L R R A Y P Y ABCC5 Human - Q A Y C P I H E E Y P E ABCC6 Human Y D P H V K I R P A A P S ABCC11 Human - C E K C T C H D R I Q F Multiple sequence alignment was performed using ClustalW (www.ebi.ac.uk/clustalw). Login to comment

PMID: 18334920 [PubMed] Haenisch S et al: "Influence of genetic polymorphisms on intestinal expression and rifampicin-type induction of ABCC2 and on bioavailability of talinolol."

No. Sentence Comment

47 The SNPs -24C > T (rs717620), -23G > A (rs17216156) in the 50 -UTR, c.1446C > G (T482T), recently described by Niemi et al. [17], c.1457C > T (T486I, rs45518933), c.3542G > T (R1181L, rs8187692), c.3561G > A (E1187E, rs45622934), c.3563T>A (V1188E rs17222723), c.4544G>A (C1515Y, rs8187710) were determined by pyrosequencing using the PSQ 96HS system (Biotage, Uppsala, Sweden). Login to comment

PMID: 18974617 [PubMed] Ho WF et al: "Genetic variations of the ABCC2 gene in the Chinese, Malay, and Indian populations of Singapore."

No. Sentence Comment

54 Among the reported variations, the ones that may be of functional relevance include -24CÀT,7,25) 1249GÀA (Val417Ile),5) 3563TÀA (Val1188Glu),5,26-28) 3972CÀT (Ile1324Ile),25) and 4544GÀA (Cys1515Tyr).26,28) The -24CÀT polymorphism was found to associate with increased plasma methotrexate concentrations in pediatric leukemia patients.7) We have also previously observed a trend for a genotypic-phenotypic correlation between -24CÀT polymorphism and increased irinotecan AUC(0, /).29) -24CÀT and 3972CÀT (Ile1324Ile) were linked to higher response rates to irinotecan and longer progression-free survival in patients with advanced non-small cell lung cancer.25) However, a study on the disposition of nitrocamptothecin and its aminocamptothecin metabolite in relation to the 3972CÀT variation revealed no significant association.30) 3563TÀA (Val1188Glu) and 4544GÀA (Cys1515Tyr) were correlated with high MRP2 expression,28) and increased susceptibility for anthracycline-induced cardiotoxicity.26) 3563TÀA (Val1188Glu) was also significantly associated with pruritus in primary biliary cirrhosis.27) Genetic polymorphisms in ABCC2 might thus constitute a risk factor for the development of acquired forms of cholestatic liver diseases.28) Mutations in the transmembrane domain: 1249GÀA (Val417Ile), 1457CÀT (Thr486Ile), and 3563TÀA (Val1188Glu) could affect their substrate specificities though their transporter activities might not be completely disrupted.5) All reported nonsynonymous variations detected in this study were predicted to be benign using the PolyPhen program. Login to comment

PMID: 18445995 [PubMed] Sai K et al: "Genetic variations and haplotypes of ABCC2 encoding MRP2 in a Japanese population."

No. Sentence Comment

68 Summary of ABCC2 variations detected in this study SNP ID Position This Study dbSNP (NCBI) JSNP Reference Location NT_030059.12 From the translational initiation site or from the end of the nearest exon Nucleotide change Amino acid change Frequency (total＝472) MPJ6_AC 2082 8 5?-Flanking 20289354 －1774 acttatcttgttG/_tttttttttttt 0.343 MPJ6_AC 2078 a 5?-Flanking 20289538 －1590 tttaatttgttaG/Atgtatgtttgct 0.002 MPJ6_AC 2079 8, 10, 17 5?-Flanking 20289579 －1549 tccttatagtatG/Attgtggatatta 0.203 MPJ6_AC 2080 9, 17 5?-Flanking 20290105 －1023 tgggaggccaagG/Acagaaggattgt 0.343 MPJ6_AC 2081 10, 17 5?-Flanking 20290109 －1019 aggccaaggcagA/Gaggattgttgaa 0.203 MPJ6_AC 2028 a 5?-Flanking 20290395 －733 acagtttctagcG/Tactgatgccacc 0.004 MPJ6_AC 2029 5?-Flanking 20290395 －733 acagtttctagcG/Aactgatgccacc 0.002 MPJ6_AC 2030 a 5?-Flanking 20290715 －413 ttgcagcagaagC/Tgaaactgcacat 0.002 MPJ6_AC 2003 ssj0000371 9, 12, 15-18, 20, 26 Exon 1 20291104 －24 tagaagagtcttC/Tgttccagacgca 0.174 MPJ6_AC 2004 18 Exon 1 20291105 －23 agaagagtcttcG/Attccagacgcag 0.006 MPJ6_AC 2031 ssj0000386 17, 26 Intron 3 20301785 IVS3 －49 ctcccctcagtcC/Ttcggttagtggc 0.203 MPJ6_AC 2032 a Intron 6 20302837 IVS6 ＋86 tattttattattT/Atttttttgagat 0.076 MPJ6_AC 2033 a Exon 7 20305479 732 caagtttgaaacG/Acacatgaagaga Thr244Thr 0.002 MPJ6_AC 2066 a Intron 7 20307421 IVS7 －69 tcacaggctgacC/Gaccctggagctg 0.002 MPJ6_AC 2067 a Intron 7 20307423 IVS7 －67 acaggctgaccaC/Acctggagctgct 0.002 MPJ6_AC 2035 a Exon 9 20308814 1177 ggtgtaaaagtaC/Tggacagctatca Arg393Trp 0.002 MPJ6_AC 2068 a Exon 9 20308839 1202 tggcttctgtatA/Gtaagaaggtaag Tyr401Cys 0.002 MPJ6_AC 2036 a Intron 9 20308859 IVS9 ＋13 gtaagcagaataC/Tggcaggtatcac 0.002 MPJ6_AC 2037 a Exon 10 20312319 1227 gaccctatccaaC/Tttggccaggaag Asn409Asn 0.002 MPJ6_AC 2009 ssj0000388 17, 18, 20, 23-26 Exon 10 20312341 1249 aaggagtacaccG/Attggagaaacag Val417Ile 0.097 MPJ6_AC 2010 18 Exon 10 20312549 1457 ccaagagtaagaC/Tcattcaggtaaa Thr486Ile 0.019 MPJ6_AC 2069 a Intron 11 20315600 IVS11 －67 taaaacatgggtG/Agatcagatacac 0.002 MPJ6_AC 2038 ssj0000390 26 Intron 12 20315952 IVS12 ＋148 ccgccccatgccA/Gcttttcctcctt 0.210 MPJ6_AC 2039 a Intron 13 20318344 IVS13 －73 tcatggactaacG/Aacaaagtcaaaa 0.002 MPJ6_AC 2070 a Intron 14 20318515 IVS14 ＋14 taaataaatttgG/Taagttgcttccc 0.002 MPJ6_AC 2040 a Intron 14 20318521 IVS14 ＋20 aatttggaagtt(del/ins) b cagcaaactga 0.002 MPJ6_AC 2071 a Intron 14 20318594 IVS14 ＋93 agcaaactgagaG/Tagagtgtggaga 0.002 MPJ6_AC 2041 a Intron 14 20319757 IVS14 －62 cggagagagacaC/Tgtgagggcagac 0.002 MPJ6_AC 2042 a Intron 14 20319758 IVS14 －61 ggagagagacacG/Atgagggcagaca 0.006 MPJ6_AC 2043 ssj0000393 26 Intron 15 20320054 IVS15 ＋169 aaagcaaaggttT/Ctcagccccttcc 0.210 MPJ6_AC 2044 a Intron 15 20321170 IVS15 －131 gtcttgtatatcC/Gaaggcaaatttt 0.004 MPJ6_AC 2045 a Intron 16 20325422 IVS16 －169 ttgagtcctgagA/Tgtggaataacta 0.004 MPJ6_AC 2046 ssj0000396 17 Intron 16 20325486 IVS16 －105 tgcacagttattC/Taaatttaagctc 0.214 MPJ6_AC 2072 a Exon 18 20327159 2358 tcttctagatgaC/Acccctgtctgca Asp786Glu 0.002 MPJ6_AC 2012 18, 20, 23 Exon 18 20327167 2366 atgaccccctgtC/Ttgcagtggatgc Ser789Phe 0.008 MPJ6_AC 2073 a Intron 19 20327555 IVS19 ＋3 gaagccacaggtA/Gtgtaagaaggat 0.002 MPJ6_AC 2047 a Intron 19 20327645 IVS19 ＋93 agtatccagtgaA/Tctagatttggaa 0.002 MPJ6_AC 2048 Intron 20 20338745 IVS20 ＋29 gctggcagccctC/Agtcagctctata 0.002 MPJ6_AC 2049 a Exon 21 20339052 2801 ccttgaaaactcG/Agaatgtgaatag Arg934Gln 0.002 MPJ6_AC 2015 ssj0000398 8, 18, 26 Exon 22 20339944 2934 aggattgttttcG/Aatattcttcatc Ser978Ser 0.040 MPJ6_AC 2050 a Exon 22 20340061 3051 cgactatccagcA/Gtctcagagggac Ala1017Ala 0.002 MPJ6_AC 2051 a Exon 23 20340337 3181 cacaagcaactgC/Ttgaacaatatcc Leu1061Leu 0.002 MPJ6_AC 2052 ssj0000399 17, 26 Intron 23 20340470 IVS23 ＋56 ggatctttctgaC/Tagggaggaatta 0.222 MPJ6_AC 2074 a Exon 24 20342724 3320 ttacatgcttccT/Gggggataatcag Leu1107Arg 0.002 MPJ6_AC 2053 Intron 24 20342843 IVS24 ＋25 atggctaagtcaT/Cccttccttcctc 0.030 MPJ6_AC 2075 a Intron 24 20342880 IVS24 ＋62 agcccagcctctT/Ctcctgagaatct 0.002 MPJ6_AC 2054 Intron 24 20342926 IVS24 ＋108 cactcactcctcC/Tcctcagcagctt 0.023 MPJ6_AC 2055 a Intron 24 20344318 IVS24 －56 agaaaggaggaaG/Aatggtggatgcc 0.002 MPJ6_AC 2056 a Intron 26 20352061 IVS26 －21 atgatgattttcA/Ggtcttctggttt 0.002 MPJ6_AC 2057 a Intron 27 20352227 IVS27 ＋44 ggcaaaaacaacA/Gtgcaactccttc 0.008 MPJ6_AC 2058 ssj0000404 17, 26 Intron 27 20352307 IVS27 ＋124 aaagtttcctttC/Gctctaactcaaa 0.222 MPJ6_AC 2076 26 Exon 28 20352688 3927 ccaagtgcggtaC/Tcgacctgagctg Tyr1309Tyr 0.002 MPJ6_AC 2022 ssj0000407 8, 12, 13, 17, 18, 20, 26 Exon 28 20352733 3972 cacttgtgacatC/Tggtagcatggag Ile1324Ile 0.216 MPJ6_AC 2059 a Intron 28 20352920 IVS28 ＋172 agggaaggatagC/Tagccagggatca 0.004 MPJ6_AC 2060 a Intron 29 20354201 IVS29 ＋136 cttgagctagttC/Tcctaggatggac 0.002 MPJ6_AC 2061 ssj0000408 26 Intron 29 20354219 IVS29 ＋154 gatggacacgtcA/Gtttccagaactt 0.367 MPJ6_AC 2062 IMS-JST090926 17 Intron 29 20355209 IVS29 －35 cttttctggcatG/Aagccccaacagc 0.015 MPJ6_AC 2063 a Intron 30 20358793 IVS30 －92 ggggggttttgaA/Gagtctgatctgg 0.008 MPJ6_AC 2064 IMS-JST185750 Intron 30 20358832 IVS30 －53 ccccctgccctgC/Tgtctttccttgg 0.051 MPJ6_AC 2077 a 3?-UTR 20359975 *61 c taattttattttT/Gtataaaatacag 0.002 MPJ6_AC 2065 a 3?-Flanking 20360190 *193＋83 c ttattcctttgcC/Gtttcatttctgt 0.002a8 a Novel genetic variation b delGCTTCCCAAACTTATTCGCAGTACTGGTGCCAGAATTTTGATAATACAAGAGCTTAGTAG/insTATTTACCT c Numbered from the termination codon. Login to comment
87 The *2 [including 1249GÀA (Val417Ile)] was the most frequent among them, and its frequency (0.093) was similar to those for Asians (0.10-0.13)8,12,20) and slightly lower than those for Caucasians (0.13-0.22).9,10,14,15,21) The haplotype frequencies of *3 [harboring 1457CÀT (Thr486Ile)] and *4 [2366CÀT (Ser789Phe)] were 0.019 and 0.008. Login to comment
91 Functional changes in *3 [1457CÀT (Thr486Ile)] and *5 to *9 (novel nonsys- nonymous variations) are currently unknown. Login to comment

PMID: 17502832 [PubMed] Choi JH et al: "MRP2 haplotypes confer differential susceptibility to toxic liver injury."

No. Sentence Comment

93 The pGL3 plasmids containing WT or mutant MRP2 promoters were Table 3 Oligonucleotide primers used in the genotyping and functional molecular studies Primer name Nucleotide sequence Primers for SNaPshot or SNaPIT PCR primers c.334-49C > T Sense 50 -CAT GGG TCC TGG AAA GGT T-30 Antisense 50 -CCC CAT GGT ACC TCC TCA T-30 c.1249G > A (p.V417I) Sense 50 -TTT GTC CAT GGG TCC TAA TTT-30 Antisense 50 -ATG AAG TTG GTC ACA TCC ATG-30 c.1457C > T (p.T486I) Sense 50 -ATG GTG CTT GTA ATC CCA ATT-30 Antisense 50 -TTG CCC AAA CTC CCA TTA-30 c.2620 + 3A > G Sense 50 -AAA AAA GGA GAG TTT GCT AAG AAT C-30 Antisense 50 -ATA CTG AGC AGT TCA GGA ATT AGA TAT T-30 c.2934G > A (p.S978S) Sense 50 -AGT TCT ACT AAT ATT GAG GTG GGG A-30 Antisense 50 -AAT AAA AGC CAC AGA ATT CAT CA-30 c.3972C > T (p.I1324I) Sense 50 -TAC CGA CCT GAG CTG GAT C-30 Antisense 50 -CAT CCA GGC CTT CCT TCA-30 c.4147 - 35G > A Sense 50 -GTA GCC ACT CCG AGC CTT AG-30 Antisense 50 -GGA ATC AGA CCT GGA TGA AAA-30 c.4508 + 12G > A Sense 50 -CCC ACA GGC TGC ACA CCA T-30 Antisense 50 -TGT TAC TGT TGA GCA AGG GTT A-30 Genotyping primers c.334 - 49C > T 50 -TCT GAA GAA TAC TGC CAC TAA CCG A-30 c.1249G > A (p.V417I) 50 -GAC ATC AGG TTC ACT GTT TCT CCA A-30 c.1457C > T (p.T486I) 50 -GGG TGA CTT TTT CTT TAC CTG AAT G-30 c.2620 + 3A > G 50 -CTA TCT TGT CCC AAT CCT TCT TAC A-30 c.2934G > A (p.S978S) 50 -ACC TAC AAG CAA TAG GAT TGT TTT C-30 c.3972C > T (p.I1324I) 50 -CTC CAC CTA CCT TCT CCA TGC TAC C-30 c.4147 - 35G > A 50 -GAA CTC CGA GGT CCT TTT CTG GCA T-30 c.4508 + 12G > A 50 -AAG CCA TCC GTG TCA AGC CCT GTC C-30 Primers for the DNA sequencing of MRP2 promoter regions g. - 1774delG Sense 50 -GAT TCT CCA CCC TCT CTT TT-30 Antisense 50 -CAT TCA GTG TGG GAG AAA AT-30 g. - 1549G > A Sense 50 -CCC ACT TTT TAA TTT GTT AGT GTA-30 Antisense 50 -CTG GGA CTA CAG GCA CAT-30 g. - 24C > T and g. - 23G > A Sense 50 -TAG GCT CAC ACT GGA TAA GC-30 Antisense 50 -TGC ACA TCT AAC ATT TCT GG-30 Mutagenic primers - 24C-T 50 -CAA TCA TAT TAA TAG AAG AGT CTT CGT TCC AGA CGC AGT CCA GGA A-30 c.1249G > A (p.V417I) 50 -GGA AGG AGT ACA CCA TTG GAG AAA CAG TGA ACC TGA TGT C-30 c.2302C > T (p.R768W) 50 -AAA TCT TAG TGG GGG TCA GAA GCA GTG GAT CAG CCT GGC CAG-30 c.2934G > A (p.S978S) 50 -CTA CAA GCA ATA GGA TTG TTT TCA ATA TTC TTC ATC ATC-30 c.3972C > T (p.I1324I) 50 -GAG GGA TCA CTT GTG ACA TTG GTA GCA TGG AGA AGG TAG G-30 Primers for MRP2 promoter cloning First round PCR ( - 2314 to + 348) Sense 50 -AGA TTC ATG ACT TCC TGG CTC CTT-30 Antisense 50 -ACA ACA ATT CTC CTT CCT CAC ACG-30 Second round PCR ( - 2229 to -1) Sense (KpnI site) 50 -CGG GGT ACC TTG ATG AAC ATT TAG ATT CT-30 Antisense (NheI site) 50 -CTA GCT AGC GAT TCC TGG ACT GCG TCT GG-30 RT-PCR primers for exon 4 splicing Sense (exon 3) 50 -CGT GTA TAA ATC CAG GAC CAA GAG A-30 Antisense (exon 5) 50 -GGA GAT GAA GAA CAG GCA GGA GTA G-30 PCR, polymerase chain reaction; RT-PCR, reverse transcription-polymerase chain reaction. Login to comment
112 Twelve genetic variations were found in the MRP2 gene after comprehensive gene scanning of a total of 100 samples derived from 50 healthy Table 4 Frequency of MRP2 genetic variations in control and toxic hepatitis patients Variant Control Hepatocellular Cholestatic or mixed n n P value n P value g. - 1774delG + / + 50 30 0.28 9 0.04* + / - 46 23 20 - / - 14 4 8 (0.34) (0.27) (0.49) g. - 1549G > A + / + 66 30 0.03* 24 0.11 + / - 42 22 10 - / - 2 5 3 (0.21) (0.28) (0.22) g. - 24C > T + / + 74 31 0.06 25 0.75 + / - 34 22 11 - / - 2 4 1 (0.17) (0.26) (0.18) g. - 23G > A + / + 105 55 37 + / - 5 2 0 (0.02) (0.02) (0.00) c.334 - 49C > T + / + 66 28 0.06 23 0.2 + / - 41 24 11 - / - 3 5 3 (0.21) (0.30) (0.23) c.1249G > A (p.V417I) 92 47 0.22 34 0.29 + / + 15 10 3 + / - 3 0 0 - / - (0.10) (0.09) (0.04) c.1457C > T (p.T486I) 107 56 36 + / + 3 1 1 + / - (0.01) (0.01) (0.01) c.2620 + 3A > G + / + 110 56 37 + / - 0 1 0 (0.00) (0.01) (0.00) c.2934G > A (p.S978S) + / + 100 52 0.52 35 0.35 + / - 9 5 2 - / - 1 0 0 (0.05) (0.04) (0.03) c.3972C > T (p.I1324I) + / + 61 29 0.02* 23 0.12 + / - 47 22 11 - / - 2 6 3 (0.23) (0.30) (0.23) c.4147-35G > A + / + 107 52 37 + / - 3 5 0 (0.01) (0.04) (0.00) c.4508 + 12G > A + / + 108 57 37 + / - 2 0 0 (0.01) (0.00) (0.00) + , major allele, - , minor allele. Login to comment

PMID: 16847695 [PubMed] Nies AT et al: "The apical conjugate efflux pump ABCC2 (MRP2)."

No. Sentence Comment

139 Although all sequence variants associated with Dubin-Johnson syndrome result in the absence of a Table 3 Nucleotide sequence variants in the human ABCC2 gene (NM_000392) leading to amino acid changes in the ABCC2/MRP2 protein (NP_000383) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references Exon 2 c.56 C>Te p.P19L Probably damaging T: 0.007 [63] Exon 2 c.116 T>A p.F39Y Benign A: 0.010 rs927344 A: 0.008 rs17222603 Exon 3 c.298 C>T p.R100Xf DJS [154] Exon 3 c.299 G>Ae p.R100Q Possibly damaging A: 0.007 [63] Exon 7 c.736 A>C p.M246L Benign C: 0.002 rs8187667 C: 0.002 rs17222744 Exon 7 c.842 G>A p.S281N Benign A: 0.0060.056 [117] Exon 8 c.998 A>G p.D333G Possibly damaging G: 0.002 rs8187668 G: 0.004 rs17222674 Exon 9 c.1058 G>A p.R353H Benign A: 0.009 rs7080681 A: 0.014 rs17216205 Exon 9 c.1177 C>T p.R393W DJS Probably damaging [104, 112] Exon 10 c.1234 A>G p.R412G Probably damaging Deficient methotrexate transport function [56] Exon 10 c.1249 G>A p.V417I Benign None apparent [50] A: 0.163 rs2273697, [146] A: 0.158 rs17216184 A: 0.125 [62] A: 0.1830.312 [117] Exon 10 c.1457 C>T p.T486I Benign T: 0.002 rs8187670 T: 0.002 rs17222589 Exon 11 c.1483 A>G p.K495E Possibly damaging G: 0.002 rs8187672 G: 0.002 rs17222561 Exon 13 c.1686 T>G p.F562L Benign G: 0.002 rs8187673 G: 0.002 rs17216233 Exon 16 c.2009 T>C p.I670T Benign rs8187676 C: 0.006 rs17222632 Exon 16 c.2026 G>C p.G676R DJS Probably damaging [181] Exon 17 c.2125 T>C p.W709R DJS Probably damaging [111] Exon 17 c.2153 A>G p.N718S Possibly damaging rs3740072 Exon 17 c.2215 C>T p.L739F Probably damaging T: 0.006 [51] Exon 18 c.2302 C>T p.R768W DJS Probably damaging Deficient maturation and impaired sorting [47] T: 0.010 [62] [168, 180] Exon 18 c.2366 C>T p.S789F Probably damaging Reduced protein levels [50] T: 0.010 [62] Exon 19 c.2546 T>G p.L849R Benign G: 0.002 rs8187689 G: 0.006 rs17222617 Exon 20 c.2647 G>Ae p.D883N Benign A: 0.007 [63] Exon 20 c.2677 G>C p.E893Q Benign rs3740071 Exon 21 c.2882 A>Ge p.K961R Benign G: 0.007 [63] Exon 22 c.2901 C>A p.Y967Xf A: 0.002 rs8187683 A: 0.002 rs17222547 Exon 22 c.2944 A>G p.I982V Benign G: 0.002 rs8187684 G: 0.002 rs17222554 Exon 22 c.3057 G>Te p.Q1019H Benign T: 0.007 [63] Exon 23 c.3107 T>C p.I1036T Possibly damaging C: 0.002 rs8187685 C: 0.004 rs17216149 Exon 23 c.3188 A>G p.N1063S Benign G: 0.002 rs8187686 G: 0.002 rs17222540 Exon 23 c.3196 C>T p.R1066Xf DJS No ABCC2 protein in liver [134] Exon 25 c.3449 G>A p.R1150H DJS Probably damaging Deficient transport function A: 00.009 [117] Exon 25 c.3517 A>T p.I1173F DJS Probably damaging Deficient maturation and impaired sorting, deficient transport function T: 00.029 [117] [80, 117] Exon 25 c.3521 G>Ae p.R1174H Probably damaging A: 0.007 [63] Exon 25 c.3542 G>T p.R1181L Possibly damaging T: 0.039 rs8187692 T: 0.034 rs17222702 Exon 25 c.3563 T>A p.V1188E Benign A: 0.059 rs8187694 A: 0.059 rs17222723 Exon 26 c.3732 T>Ge p.N1244K Possibly damaging G: 0.014 [63] Exon 27 c.3817 A>G p.T1273A Benign G: 0.002 rs8187699 G: 0.004 rs17222582 Exon 27 c.3825 C>G p.Y1275Xf DJS No ABCC2 protein in liver [104] Exon 28 c.3872 C>T p.P1291L Possibly damaging T: 0.012 rs8187700 T: 0.010 rs17216317 Exon 28 c.3895 A>C p.K1299Q Benign rs4148400, [146] Exon 28 c.3928 C>T p.R1310Xf DJS [166] Exon 29 c.4100 C>Ge p.S1367C Possibly damaging G: 0.007 [63] Exon 29 c.4145 A>G p.Q1382R DJS Probably Deficient [47, 168] Table 3 (continued) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references functionally active ABCC2 protein from the canalicular membrane, their effects on the synthesis and function of the ABCC2 protein differ. Login to comment
140 Although all sequence variants associated with Dubin-Johnson syndrome result in the absence of a Table 3 Nucleotide sequence variants in the human ABCC2 gene (NM_000392) leading to amino acid changes in the ABCC2/MRP2 protein (NP_000383) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references Exon 2 c.56 C>Te p.P19L Probably damaging T: 0.007 [63] Exon 2 c.116 T>A p.F39Y Benign A: 0.010 rs927344 A: 0.008 rs17222603 Exon 3 c.298 C>T p.R100Xf DJS [154] Exon 3 c.299 G>Ae p.R100Q Possibly damaging A: 0.007 [63] Exon 7 c.736 A>C p.M246L Benign C: 0.002 rs8187667 C: 0.002 rs17222744 Exon 7 c.842 G>A p.S281N Benign A: 0.0060.056 [117] Exon 8 c.998 A>G p.D333G Possibly damaging G: 0.002 rs8187668 G: 0.004 rs17222674 Exon 9 c.1058 G>A p.R353H Benign A: 0.009 rs7080681 A: 0.014 rs17216205 Exon 9 c.1177 C>T p.R393W DJS Probably damaging [104, 112] Exon 10 c.1234 A>G p.R412G Probably damaging Deficient methotrexate transport function [56] Exon 10 c.1249 G>A p.V417I Benign None apparent [50] A: 0.163 rs2273697, [146] A: 0.158 rs17216184 A: 0.125 [62] A: 0.1830.312 [117] Exon 10 c.1457 C>T p.T486I Benign T: 0.002 rs8187670 T: 0.002 rs17222589 Exon 11 c.1483 A>G p.K495E Possibly damaging G: 0.002 rs8187672 G: 0.002 rs17222561 Exon 13 c.1686 T>G p.F562L Benign G: 0.002 rs8187673 G: 0.002 rs17216233 Exon 16 c.2009 T>C p.I670T Benign rs8187676 C: 0.006 rs17222632 Exon 16 c.2026 G>C p.G676R DJS Probably damaging [181] Exon 17 c.2125 T>C p.W709R DJS Probably damaging [111] Exon 17 c.2153 A>G p.N718S Possibly damaging rs3740072 Exon 17 c.2215 C>T p.L739F Probably damaging T: 0.006 [51] Exon 18 c.2302 C>T p.R768W DJS Probably damaging Deficient maturation and impaired sorting [47] T: 0.010 [62] [168, 180] Exon 18 c.2366 C>T p.S789F Probably damaging Reduced protein levels [50] T: 0.010 [62] Exon 19 c.2546 T>G p.L849R Benign G: 0.002 rs8187689 G: 0.006 rs17222617 Exon 20 c.2647 G>Ae p.D883N Benign A: 0.007 [63] Exon 20 c.2677 G>C p.E893Q Benign rs3740071 Exon 21 c.2882 A>Ge p.K961R Benign G: 0.007 [63] Exon 22 c.2901 C>A p.Y967Xf A: 0.002 rs8187683 A: 0.002 rs17222547 Exon 22 c.2944 A>G p.I982V Benign G: 0.002 rs8187684 G: 0.002 rs17222554 Exon 22 c.3057 G>Te p.Q1019H Benign T: 0.007 [63] Exon 23 c.3107 T>C p.I1036T Possibly damaging C: 0.002 rs8187685 C: 0.004 rs17216149 Exon 23 c.3188 A>G p.N1063S Benign G: 0.002 rs8187686 G: 0.002 rs17222540 Exon 23 c.3196 C>T p.R1066Xf DJS No ABCC2 protein in liver [134] Exon 25 c.3449 G>A p.R1150H DJS Probably damaging Deficient transport function A: 00.009 [117] Exon 25 c.3517 A>T p.I1173F DJS Probably damaging Deficient maturation and impaired sorting, deficient transport function T: 00.029 [117] [80, 117] Exon 25 c.3521 G>Ae p.R1174H Probably damaging A: 0.007 [63] Exon 25 c.3542 G>T p.R1181L Possibly damaging T: 0.039 rs8187692 T: 0.034 rs17222702 Exon 25 c.3563 T>A p.V1188E Benign A: 0.059 rs8187694 A: 0.059 rs17222723 Exon 26 c.3732 T>Ge p.N1244K Possibly damaging G: 0.014 [63] Exon 27 c.3817 A>G p.T1273A Benign G: 0.002 rs8187699 G: 0.004 rs17222582 Exon 27 c.3825 C>G p.Y1275Xf DJS No ABCC2 protein in liver [104] Exon 28 c.3872 C>T p.P1291L Possibly damaging T: 0.012 rs8187700 T: 0.010 rs17216317 Exon 28 c.3895 A>C p.K1299Q Benign rs4148400, [146] Exon 28 c.3928 C>T p.R1310Xf DJS [166] Exon 29 c.4100 C>Ge p.S1367C Possibly damaging G: 0.007 [63] Exon 29 c.4145 A>G p.Q1382R DJS Probably Deficient [47, 168] Table 3 (continued) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references functionally active ABCC2 protein from the canalicular membrane, their effects on the synthesis and function of the ABCC2 protein differ. Login to comment

PMID: 11901087 [PubMed] Itoda M et al: "Polymorphisms in the ABCC2 (cMOAT/MRP2) gene found in 72 established cell lines derived from Japanese individuals: an association between single nucleotide polymorphisms in the 5'-untranslated region and exon 28."

No. Sentence Comment

22 Of those, 12 nucleotide changes were nonsynonymous, and the frequency for c1457t (T486I) was approximately 0.03 (Table 1). Login to comment
26 The amino acid substitutions S789F (c2366t) and S1367C (c4100g) were reportedly located in nucleotide binding domains 1 and 2, respectively, those of V417I (g1249a) and T486I (c1457t) in membrane-spanning domain 2, and that of Q1019H (g3057t) in membrane spanning domain 3 (Toh et al., 1999). Login to comment
57 Location Substitution Genotype 72 Cell Linesa (48 Subjects)b Nucleotide Amino Acid w/w w/m m/m 5Ј-Flanking t-751a 71 1 0 5Ј-Flanking c-717t 71 1 0 5Ј-UTR c-24t 52 (31) 14 (16) 6 (1) 5Ј-UTR g-23a 70 2 0 Exon 2 c56t P19L 71 1 0 Exon 3 a234g L78L 71 1 0 Exon 3 g299a R100Q 71 1 0 Exon 7 g842a S281N 71 1 0 Exon 10 g1249a V417I 59 (37) 9 (10) 4 (1) Exon 10 c1457t T486I 69 2 1 Exon 18 c2302t R768W 72 (47) 0 (1) 0 (0) Exon 18 c2366t S789F 71 (47) 1 (1) 0 (0) Exon 20 g2647a D883N 71 1 0 Exon 21 a2882g K961R 71 1 0 Exon 22 g2934a S978S 66 5 1 Exon 22 c3039t T1013T 71 0 1 Exon 22 g3057t Q1019H 71 1 0 Exon 24 g3321t L1107L 71 1 0 Exon 25 g3521a R1174H 71 1 0 Exon 25 t3563a V1188E 71 1 0 Exon 26 t3732g N1244K 71 0 1 Exon 28 c3972t I1324I 49 (29) 14 (17) 9 (2) Exon 29 c4100g S1367C 71 1 0 Exon 30 g4290t V1430V 71 1 0 Exon 31 g4348a A1450T 72 (47) 0 (1) 0 (0) Exon 31 c4488t H1496H 71 1 0 Exon 32 g4544a C1515Y 71 1 0 UTR, untranslated region. Login to comment

PMID: 24465238 [PubMed] Yi JH et al: "Genetic Variations of ABCC2 Gene Associated with Adverse Drug Reactions to Valproic Acid in Korean Epileptic Patients."

No. Sentence Comment

76 Based on logistic regression, ADRs were more likely to occur in Variant Allele Control Epilepsy patient p-value CNS ADR-Yes CNS ADR-No g.ߜ1774delG G 146 (66.4) 65 (79.3) 158 (62.7) 0.0057** del 74 (33.6) 17 (20.7) 94 (37.3) g.ߜ1549G > A G 174 (79.1) 59 (72.0) 199 (80.2) 0.1151 A 46 (20.6) 23 (28.0) 49 (19.8) g.ߜ24C > T C 182 (72.7) 54 (65.9) 198 (78.0) 0.0278* rs717620 T 38 (17.3) 28 (34.1) 56 (22.0) g.ߜ23G > A G 215 (97.7) 82 (100.0) 253 (99.6) 0.5693 A 5 (2.3) 0 (0.0) 1 (0.4) c.1249G > A G 199 (90.5) 73 (89.0) 235 (92.5) 0.3194 (p.V417I, rs2273697) A 21 (9.5) 9 (11.0) 19 (7.5) c.1457C > T C 217 (98.6) 82 (100.0) 254 (100.0) - (p.T486I) T 3 (1.4) 0 (0.0) 0 (0.0) c.2620 + 3A > G A 220 (100) 82 (100.0) 254 (100.0) - G 0 0 (0.0) 0 (0.0) c.2934G > A G 209 (95.0) 79 (96.3) 244 (96.1) 0.9095 (p.S978S, rs3740070) A 11 (5.0) 3 (3.7) 10 (3.9) c.3972C > T C 169 (76.8) 53 (64.6) 192 (75.6) 0.0522 (p.I1324I, rs3740066) T 51 (23.2) 29 (35.4) 62 (24.4) c.4147 ߜ 35G > A G 217 (98.6) 80 (97.6) 253 (99.6) 0.0869 A 3 (1.4) 2 (2.4) 1 (0.4) c.4508 + 12G > A G 218 (99.1) 82 (100.0) 254 (100.0) - A 2 (0.9) 0 (0.0) 0 (0.0) Values are presented as number (%). Login to comment
95 The frequency of haplotype 3 was higher in ID ߜ1774 Gdel ߜ1549 G/A ߜ24C/T ߜ23G/A V471I T486I 2620+ 3A/G 2934 G/A 3972C/ T 4147&#ff0d; 35G/A 4508+ 12G/A Group Control CNS ADR -Yes CNS ADR -No 1 del G C G V C A G C G G 69 (31.3) 13 (15.8) 82 (32.3)** 2 G G C G V C A G C G G 54 (24.4) 24 (29.0) 65 (25.7) 3 G A T G V C A G T G G 31 (14.2) 18 (22.3)* 29 (11.4) 4 G G C G I C A G C G G 19 (8.7) 8 (9.3) 17 (6.7) 5 G G T G V C A G T G G 4 (1.7) 9 (10.6) 25 (9.8) ľd; ľd; ľd; ľd; ľd; ľd; ľd; ľd; ľd; ľd; ľd; ľd; ľd; ľd; ľd; Total 220 82 254 Values are presented as number (%). Login to comment
104 Frequency of MRP2 haplotypes in control and epilepsy patients Variant Control Epilepsy patient p-value CNS ADR-Yes CNS ADR-No g.ߜ1774delG +/+a 50 (45.5) 25 (61.0) 50 (39.7) 0.019* +/ߜ 46 (41.8) 15 (36.6) 58 (46.0) ߜ/ߜ 14 (12.7) 1 (2.4) 18 (14.3) g.ߜ1549G > A +/+ 66 (60.0) 21 (51.2) 82 (66.1) 0.440 +/ߜ 42 (38.2) 17 (41.5) 35 (28.2) ߜ/ߜ 2 (1.8) 3 (7.3) 7 (5.6) g.ߜ24C > T +/+ 74 (67.3) 17 (41.5) 79 (62.2) 0.243 rs717620 +/ߜ 34 (30.9) 20 (48.8) 40 (31.5) ߜ/ߜ 2 (1.8) 4 (9.8) 8 (6.3) g.ߜ23G > A +/+ 105 (95.5) 41 (100.0) 126 (99.2) >0.999 +/ߜ 5 (4.5) 0 (0.0) 1 (0.8) c.1249G > A +/+ 92 (83.6) 32 (78.0) 109 (85.8) >0.999 (p.V417I) +/ߜ 15 (13.6) 9 (22.0) 17 (13.4) rs2273697 ߜ/ߜ 3 (2.7) 0 (0.0) 1 (0.8) c.1457C > T +/+ 107 (97.3) 41 (100.0) 127 (100.0) - (p.T486I) +/ߜ 3 (2.7) 0 (0.0) 0 (0.0) c.2620 + 3A > G +/+ 110 (100.0) 41 (100.0) 127 (100.0) - c.2934G > A +/+ 100 (90.9) 38 (92.7) 117 (92.1) - (p.S978S) +/ߜ 9 (8.2) 3 (7.3) 10 (7.9) rs3740070 ߜ/ߜ 1 (0.9) 0 (0.0) 0 (0.0) c.3972C > T +/+ 61 (55.5) 17 (41.5) 74 (58.3) 0.164 (p.I1324I) +/ߜ 47 (42.7) 19 (46.3) 44 (34.6) rs3740066 ߜ/ߜ 2 (1.8) 5 (12.2) 9 (7.1) c.4147 ߜ 35G > A +/+ 107 (97.3) 39 (95.1) 126 (99.2) 0.141 +/ߜ 3 (2.7) 2 (4.9) 1 (0.8) c.4508 + 12G > A +/+ 108 (98.2) 41 (100.0) 127 (100.0) - +/ߜ 2 (1.8) 0 (0.0) 0 (0.0) Values are presented as number (%). Login to comment