ABCB1 p.Ile541Thr
| Predicted by SNAP2: | A: D (59%), C: N (61%), D: D (85%), E: D (80%), F: D (59%), G: D (80%), H: D (80%), K: D (80%), L: N (61%), M: D (53%), N: D (80%), P: D (85%), Q: D (75%), R: D (80%), S: D (71%), T: D (71%), V: N (82%), W: D (80%), Y: D (75%), |
| Predicted by PROVEAN: | A: D, C: D, D: D, E: D, F: D, G: D, H: D, K: D, L: N, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: N, W: D, Y: D, |
[switch to compact view]
Comments [show]
None has been submitted yet.
[hide] Characterization of the human multidrug resistance... Biochem J. 1997 May 1;323 ( Pt 3):777-83. Bakos E, Klein I, Welker E, Szabo K, Muller M, Sarkadi B, Varadi A
Characterization of the human multidrug resistance protein containing mutations in the ATP-binding cassette signature region.
Biochem J. 1997 May 1;323 ( Pt 3):777-83., 1997-05-01 [PMID:9169612]
Abstract [show]
A number of mutants with single amino acid replacements were generated in the highly conserved ATP-binding cassette (ABC)-signature region (amino acids 531-543) of the N-terminal half of the human multidrug resistance (MDR1) protein. The cDNA variants were inserted into recombinant baculoviruses and the MDR1 proteins were expressed in Spodoptera frugiperda (Sf9) insect cells. The level of expression and membrane insertion of the MDR1 variants was examined by immunostaining, and MDR1 function was followed by measuring drug-stimulated ATPase activity. We found that two mutations, L531R and G534V, practically eliminated MDR1 expression; thus these amino acid replacements seem to inhibit the formation of a stable MDR1 protein structure. The MDR1 variants G534D and I541R were expressed at normal levels with normal membrane insertion, but showed a complete loss of drug-stimulated ATPase activity, while mutant R538M yielded full protein expression but with greatly decreased ATPase activity. Increasing the ATP concentration did not restore MDR1 ATPase activity in these variants. Some amino acid replacements in the ABC-signature region (K536I, K536R, I541T and R543S) affected neither the expression and membrane insertion nor the ATPase function of MDR1. We found no alteration in the drug-sensitivity of ATP cleavage in any of the MDR1 variants that had measurable ATPase activity. These observations suggest that the ABC-signature region is essential for MDR1 protein stability and function, but alterations in this region do not seem to modulate MDR1-drug interactions directly.
Comments [show]
None has been submitted yet.
No. Sentence Comment
20 Some amino acid replacements in the ABC-signature region (K536I, K536R, I541T and R543S) affected neither the expression and membrane insertion nor the ATPase function of MDR1.
X
ABCB1 p.Ile541Thr 9169612:20:72
status: NEW38 Mutations were engineered by the site-directed mutagenesis technique of Kunkel [18] utilizing the following mutagenic oligonucleotides: L531R, 5h CCACCACTCCGCTGGGCCC- CT; G534D, 5h TGCTTCTGAACACCACTCAAT; G534V, 5h TGCTTCTGATCACCACTCAAT; K536R, 5h GATCCTCTG- TCTCTGCCCACCAC; K536I, 5h GATCCTCTGTATCTGC- CCACCAC; R538M, 5h GCACGTGCAATGGCGATCATCT- GCTTG; I541R, 5h GCACGTGCTCTGGCGATCCTCTGCT- TG; I541T, 5h GCACGTGCTGTGGCGATCCTCTGCTTG; R543S, 5h AACCAGGGCACTTGCAATGGCGAT.
X
ABCB1 p.Ile541Thr 9169612:38:393
status: NEW64 Mutant Relative expression level Relative ATPase activity L531R 0.1 0.05 G534V 0.1 0.05 G534D 1.0 0.05 K536I 0.9 1.0 K536R 1.1 0.9 R538M 1.1 0.4 I541R 1.2 0.05 I541T 1.0 1.1 R543S 1.1 1.1 the mutants G534D, K536I, K536R, R538M, I541R, I541T and R543S the MDR1-immunoreactive proteins appeared with the expected size of underglycosylated wild-type MDR1 (about 130 kDa), characteristic of MDR1 expression in Sf9 cells [14,19].
X
ABCB1 p.Ile541Thr 9169612:64:160
status: NEWX
ABCB1 p.Ile541Thr 9169612:64:235
status: NEW74 We found similar full recognition for the mutants K536I, K536R, I541T and R543S, whereas the mutant proteins showing low expression levels on the immunoblots (L531R and G534V) were not detectable by immunoflow cytometry either (results not shown).
X
ABCB1 p.Ile541Thr 9169612:74:64
status: NEW84 For the MDR1 variants K536I, K536R, I541T and R543S, all four drugs concentration-dependently induced ATPase activities that were not significantly different from those seen in the wild-type MDR1 (Figure 4).
X
ABCB1 p.Ile541Thr 9169612:84:36
status: NEW94 We found similar KATP m values for the ABC-signature mutants showing normal drug-stimulated ATPase activity (K536I, K536R, I541T and R543S; results not shown).
X
ABCB1 p.Ile541Thr 9169612:94:123
status: NEW138 This view is supported by the finding that a mutation at the same position that did not introduce an extra charge (I541T) caused no apparent change in the activity of the MDR1 protein (Figure 4).
X
ABCB1 p.Ile541Thr 9169612:138:115
status: NEW158 It is important to note that, in the case of residue 541, an amino acid replacement causing no charge difference (I541T) was fully tolerated.
X
ABCB1 p.Ile541Thr 9169612:158:114
status: NEW