ABCB1 p.Ile541Thr
[switch to full view]Comments [show]
None has been submitted yet.
PMID: 9169612
[PubMed]
Bakos E et al: "Characterization of the human multidrug resistance protein containing mutations in the ATP-binding cassette signature region."
No.
Sentence
Comment
20
Some amino acid replacements in the ABC-signature region (K536I, K536R, I541T and R543S) affected neither the expression and membrane insertion nor the ATPase function of MDR1.
X
ABCB1 p.Ile541Thr 9169612:20:72
status: NEW38 Mutations were engineered by the site-directed mutagenesis technique of Kunkel [18] utilizing the following mutagenic oligonucleotides: L531R, 5h CCACCACTCCGCTGGGCCC- CT; G534D, 5h TGCTTCTGAACACCACTCAAT; G534V, 5h TGCTTCTGATCACCACTCAAT; K536R, 5h GATCCTCTG- TCTCTGCCCACCAC; K536I, 5h GATCCTCTGTATCTGC- CCACCAC; R538M, 5h GCACGTGCAATGGCGATCATCT- GCTTG; I541R, 5h GCACGTGCTCTGGCGATCCTCTGCT- TG; I541T, 5h GCACGTGCTGTGGCGATCCTCTGCTTG; R543S, 5h AACCAGGGCACTTGCAATGGCGAT.
X
ABCB1 p.Ile541Thr 9169612:38:393
status: NEW64 Mutant Relative expression level Relative ATPase activity L531R 0.1 0.05 G534V 0.1 0.05 G534D 1.0 0.05 K536I 0.9 1.0 K536R 1.1 0.9 R538M 1.1 0.4 I541R 1.2 0.05 I541T 1.0 1.1 R543S 1.1 1.1 the mutants G534D, K536I, K536R, R538M, I541R, I541T and R543S the MDR1-immunoreactive proteins appeared with the expected size of underglycosylated wild-type MDR1 (about 130 kDa), characteristic of MDR1 expression in Sf9 cells [14,19].
X
ABCB1 p.Ile541Thr 9169612:64:160
status: NEWX
ABCB1 p.Ile541Thr 9169612:64:235
status: NEW74 We found similar full recognition for the mutants K536I, K536R, I541T and R543S, whereas the mutant proteins showing low expression levels on the immunoblots (L531R and G534V) were not detectable by immunoflow cytometry either (results not shown).
X
ABCB1 p.Ile541Thr 9169612:74:64
status: NEW84 For the MDR1 variants K536I, K536R, I541T and R543S, all four drugs concentration-dependently induced ATPase activities that were not significantly different from those seen in the wild-type MDR1 (Figure 4).
X
ABCB1 p.Ile541Thr 9169612:84:36
status: NEW94 We found similar KATP m values for the ABC-signature mutants showing normal drug-stimulated ATPase activity (K536I, K536R, I541T and R543S; results not shown).
X
ABCB1 p.Ile541Thr 9169612:94:123
status: NEW138 This view is supported by the finding that a mutation at the same position that did not introduce an extra charge (I541T) caused no apparent change in the activity of the MDR1 protein (Figure 4).
X
ABCB1 p.Ile541Thr 9169612:138:115
status: NEW158 It is important to note that, in the case of residue 541, an amino acid replacement causing no charge difference (I541T) was fully tolerated.
X
ABCB1 p.Ile541Thr 9169612:158:114
status: NEW