ABCB1 p.Ile541Arg
| Predicted by SNAP2: | A: D (59%), C: N (61%), D: D (85%), E: D (80%), F: D (59%), G: D (80%), H: D (80%), K: D (80%), L: N (61%), M: D (53%), N: D (80%), P: D (85%), Q: D (75%), R: D (80%), S: D (71%), T: D (71%), V: N (82%), W: D (80%), Y: D (75%), |
| Predicted by PROVEAN: | A: D, C: D, D: D, E: D, F: D, G: D, H: D, K: D, L: N, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: N, W: D, Y: D, |
[switch to compact view]
Comments [show]
None has been submitted yet.
[hide] Insight in eukaryotic ABC transporter function by ... FEBS Lett. 2006 Feb 13;580(4):1064-84. Epub 2006 Jan 19. Frelet A, Klein M
Insight in eukaryotic ABC transporter function by mutation analysis.
FEBS Lett. 2006 Feb 13;580(4):1064-84. Epub 2006 Jan 19., 2006-02-13 [PMID:16442101]
Abstract [show]
With regard to structure-function relations of ATP-binding cassette (ABC) transporters several intriguing questions are in the spotlight of active research: Why do functional ABC transporters possess two ATP binding and hydrolysis domains together with two ABC signatures and to what extent are the individual nucleotide-binding domains independent or interacting? Where is the substrate-binding site and how is ATP hydrolysis functionally coupled to the transport process itself? Although much progress has been made in the elucidation of the three-dimensional structures of ABC transporters in the last years by several crystallographic studies including novel models for the nucleotide hydrolysis and translocation catalysis, site-directed mutagenesis as well as the identification of natural mutations is still a major tool to evaluate effects of individual amino acids on the overall function of ABC transporters. Apart from alterations in characteristic sequence such as Walker A, Walker B and the ABC signature other parts of ABC proteins were subject to detailed mutagenesis studies including the substrate-binding site or the regulatory domain of CFTR. In this review, we will give a detailed overview of the mutation analysis reported for selected ABC transporters of the ABCB and ABCC subfamilies, namely HsCFTR/ABCC7, HsSUR/ABCC8,9, HsMRP1/ABCC1, HsMRP2/ABCC2, ScYCF1 and P-glycoprotein (Pgp)/MDR1/ABCB1 and their effects on the function of each protein.
Comments [show]
None has been submitted yet.
No. Sentence Comment
226 However, some mutations in the ABC signature such as G534D and I541R abolished drug-stimulated ATPase activity.
X
ABCB1 p.Ile541Arg 16442101:226:63
status: NEW[hide] Characterization of the human multidrug resistance... Biochem J. 1997 May 1;323 ( Pt 3):777-83. Bakos E, Klein I, Welker E, Szabo K, Muller M, Sarkadi B, Varadi A
Characterization of the human multidrug resistance protein containing mutations in the ATP-binding cassette signature region.
Biochem J. 1997 May 1;323 ( Pt 3):777-83., 1997-05-01 [PMID:9169612]
Abstract [show]
A number of mutants with single amino acid replacements were generated in the highly conserved ATP-binding cassette (ABC)-signature region (amino acids 531-543) of the N-terminal half of the human multidrug resistance (MDR1) protein. The cDNA variants were inserted into recombinant baculoviruses and the MDR1 proteins were expressed in Spodoptera frugiperda (Sf9) insect cells. The level of expression and membrane insertion of the MDR1 variants was examined by immunostaining, and MDR1 function was followed by measuring drug-stimulated ATPase activity. We found that two mutations, L531R and G534V, practically eliminated MDR1 expression; thus these amino acid replacements seem to inhibit the formation of a stable MDR1 protein structure. The MDR1 variants G534D and I541R were expressed at normal levels with normal membrane insertion, but showed a complete loss of drug-stimulated ATPase activity, while mutant R538M yielded full protein expression but with greatly decreased ATPase activity. Increasing the ATP concentration did not restore MDR1 ATPase activity in these variants. Some amino acid replacements in the ABC-signature region (K536I, K536R, I541T and R543S) affected neither the expression and membrane insertion nor the ATPase function of MDR1. We found no alteration in the drug-sensitivity of ATP cleavage in any of the MDR1 variants that had measurable ATPase activity. These observations suggest that the ABC-signature region is essential for MDR1 protein stability and function, but alterations in this region do not seem to modulate MDR1-drug interactions directly.
Comments [show]
None has been submitted yet.
No. Sentence Comment
7 The MDR1 variants G534D and I541R were expressed at normal levels with normal membrane INTRODUCTION The multidrug resistance phenotype in cancer cells is often caused by the overexpression of special membrane transport proteins, the P-glycoprotein [also known as the multidrug resistance protein (MDR1)] and\or the multidrug resistance-associated protein.
X
ABCB1 p.Ile541Arg 9169612:7:28
status: NEW38 Mutations were engineered by the site-directed mutagenesis technique of Kunkel [18] utilizing the following mutagenic oligonucleotides: L531R, 5h CCACCACTCCGCTGGGCCC- CT; G534D, 5h TGCTTCTGAACACCACTCAAT; G534V, 5h TGCTTCTGATCACCACTCAAT; K536R, 5h GATCCTCTG- TCTCTGCCCACCAC; K536I, 5h GATCCTCTGTATCTGC- CCACCAC; R538M, 5h GCACGTGCAATGGCGATCATCT- GCTTG; I541R, 5h GCACGTGCTCTGGCGATCCTCTGCT- TG; I541T, 5h GCACGTGCTGTGGCGATCCTCTGCTTG; R543S, 5h AACCAGGGCACTTGCAATGGCGAT.
X
ABCB1 p.Ile541Arg 9169612:38:352
status: NEW64 Mutant Relative expression level Relative ATPase activity L531R 0.1 0.05 G534V 0.1 0.05 G534D 1.0 0.05 K536I 0.9 1.0 K536R 1.1 0.9 R538M 1.1 0.4 I541R 1.2 0.05 I541T 1.0 1.1 R543S 1.1 1.1 the mutants G534D, K536I, K536R, R538M, I541R, I541T and R543S the MDR1-immunoreactive proteins appeared with the expected size of underglycosylated wild-type MDR1 (about 130 kDa), characteristic of MDR1 expression in Sf9 cells [14,19].
X
ABCB1 p.Ile541Arg 9169612:64:145
status: NEWX
ABCB1 p.Ile541Arg 9169612:64:228
status: NEW73 In immunoflow cytometry experiments, the mutant MDR1 proteins G534D, R538M and I541R were recognized by both monoclonal antibodies, in a manner indistinguishable from that of the wild-type protein (Figure 3).
X
ABCB1 p.Ile541Arg 9169612:73:79
status: NEW88 On the other hand, when the isolated membranes contained similar amounts of the MDR1 proteins harbouring the mutation G534D or I541R (Table 1), none of the drugs examined was able to stimulate ATPase activity.
X
ABCB1 p.Ile541Arg 9169612:88:127
status: NEW100 Mutants G534D and I541R were unable to catalyse ATP hydrolysis, even when high concentrations of ATP were present in the incubation medium (Figure 5).
X
ABCB1 p.Ile541Arg 9169612:100:18
status: NEW125 In the case of the mutants G534D and I541R, we found full MDR1 protein expression but a complete loss of drug-stimulated ATPase activity.
X
ABCB1 p.Ile541Arg 9169612:125:37
status: NEW135 Mutation I541R introduces a positive charge into a highly conserved hydrophobic patch (Ile-Ala-Ile&%"-Ala) of the ABC-signature region.
X
ABCB1 p.Ile541Arg 9169612:135:9
status: NEW154 The (fully expressed) R538M mutant had decreased maximum MDR1 ATPase activity, while the G534D and I541R mutants showed a complete loss of activity despite retaining a wild-type ABC signature region in the C-terminal half of the protein.
X
ABCB1 p.Ile541Arg 9169612:154:99
status: NEW