ABCB1 p.Ile541Arg
[switch to full view]Comments [show]
None has been submitted yet.
PMID: 16442101
[PubMed]
Frelet A et al: "Insight in eukaryotic ABC transporter function by mutation analysis."
No.
Sentence
Comment
226
However, some mutations in the ABC signature such as G534D and I541R abolished drug-stimulated ATPase activity.
X
ABCB1 p.Ile541Arg 16442101:226:63
status: NEW
PMID: 9169612
[PubMed]
Bakos E et al: "Characterization of the human multidrug resistance protein containing mutations in the ATP-binding cassette signature region."
No.
Sentence
Comment
7
The MDR1 variants G534D and I541R were expressed at normal levels with normal membrane INTRODUCTION The multidrug resistance phenotype in cancer cells is often caused by the overexpression of special membrane transport proteins, the P-glycoprotein [also known as the multidrug resistance protein (MDR1)] and\or the multidrug resistance-associated protein.
X
ABCB1 p.Ile541Arg 9169612:7:28
status: NEW38 Mutations were engineered by the site-directed mutagenesis technique of Kunkel [18] utilizing the following mutagenic oligonucleotides: L531R, 5h CCACCACTCCGCTGGGCCC- CT; G534D, 5h TGCTTCTGAACACCACTCAAT; G534V, 5h TGCTTCTGATCACCACTCAAT; K536R, 5h GATCCTCTG- TCTCTGCCCACCAC; K536I, 5h GATCCTCTGTATCTGC- CCACCAC; R538M, 5h GCACGTGCAATGGCGATCATCT- GCTTG; I541R, 5h GCACGTGCTCTGGCGATCCTCTGCT- TG; I541T, 5h GCACGTGCTGTGGCGATCCTCTGCTTG; R543S, 5h AACCAGGGCACTTGCAATGGCGAT.
X
ABCB1 p.Ile541Arg 9169612:38:352
status: NEW64 Mutant Relative expression level Relative ATPase activity L531R 0.1 0.05 G534V 0.1 0.05 G534D 1.0 0.05 K536I 0.9 1.0 K536R 1.1 0.9 R538M 1.1 0.4 I541R 1.2 0.05 I541T 1.0 1.1 R543S 1.1 1.1 the mutants G534D, K536I, K536R, R538M, I541R, I541T and R543S the MDR1-immunoreactive proteins appeared with the expected size of underglycosylated wild-type MDR1 (about 130 kDa), characteristic of MDR1 expression in Sf9 cells [14,19].
X
ABCB1 p.Ile541Arg 9169612:64:145
status: NEWX
ABCB1 p.Ile541Arg 9169612:64:228
status: NEW73 In immunoflow cytometry experiments, the mutant MDR1 proteins G534D, R538M and I541R were recognized by both monoclonal antibodies, in a manner indistinguishable from that of the wild-type protein (Figure 3).
X
ABCB1 p.Ile541Arg 9169612:73:79
status: NEW88 On the other hand, when the isolated membranes contained similar amounts of the MDR1 proteins harbouring the mutation G534D or I541R (Table 1), none of the drugs examined was able to stimulate ATPase activity.
X
ABCB1 p.Ile541Arg 9169612:88:127
status: NEW100 Mutants G534D and I541R were unable to catalyse ATP hydrolysis, even when high concentrations of ATP were present in the incubation medium (Figure 5).
X
ABCB1 p.Ile541Arg 9169612:100:18
status: NEW125 In the case of the mutants G534D and I541R, we found full MDR1 protein expression but a complete loss of drug-stimulated ATPase activity.
X
ABCB1 p.Ile541Arg 9169612:125:37
status: NEW135 Mutation I541R introduces a positive charge into a highly conserved hydrophobic patch (Ile-Ala-Ile&%"-Ala) of the ABC-signature region.
X
ABCB1 p.Ile541Arg 9169612:135:9
status: NEW154 The (fully expressed) R538M mutant had decreased maximum MDR1 ATPase activity, while the G534D and I541R mutants showed a complete loss of activity despite retaining a wild-type ABC signature region in the C-terminal half of the protein.
X
ABCB1 p.Ile541Arg 9169612:154:99
status: NEW