ABCB1 p.Cys1125Ser
| Predicted by SNAP2: | A: D (59%), D: D (71%), E: D (66%), F: D (71%), G: D (63%), H: D (75%), I: D (71%), K: D (75%), L: D (71%), M: N (53%), N: D (66%), P: D (85%), Q: D (63%), R: N (53%), S: D (59%), T: N (61%), V: D (66%), W: D (91%), Y: D (66%), |
| Predicted by PROVEAN: | A: D, D: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D, |
[switch to compact view]
Comments [show]
None has been submitted yet.
[hide] Detailed characterization of cysteine-less P-glyco... Br J Pharmacol. 2001 Dec;134(8):1609-18. Taylor AM, Storm J, Soceneantu L, Linton KJ, Gabriel M, Martin C, Woodhouse J, Blott E, Higgins CF, Callaghan R
Detailed characterization of cysteine-less P-glycoprotein reveals subtle pharmacological differences in function from wild-type protein.
Br J Pharmacol. 2001 Dec;134(8):1609-18., [PMID:11739236]
Abstract [show]
1. Subtle alterations in the coupling of drug binding to nucleotide hydrolysis were observed following mutation of all seven endogenous cysteine residues to serines in the human multidrug resistance transporter, P-glycoprotein. Wild-type (wt) and the mutant (cys-less) forms of P-gp were expressed in Trichoplusia ni (High Five) cells and purified by metal affinity chromatography in order to undertake functional studies. 2. No significant differences were observed in substrate ([(3)H]-azidopine) binding to wt or cys-less P-gp. Furthermore, neither the transported substrate vinblastine, nor the modulator nicardipine, differed in their respective potencies to displace [(3)H]-azidopine from the wt or cys-less P-gp. These results suggest that respective binding sites for these drugs were unaffected by the introduced cysteine to serine substitutions. 3. The Michaelis-Menten characteristics of basal ATP hydrolysis of the two isoforms of P-gp were identical. The maximal ATPase activity in the presence of vinblastine was marginally reduced whilst the K(m) was unchanged in cys-less P-gp compared to control. However, cys-less P-gp displayed lower overall maximal ATPase activity (62%), a decreased K(m) and a lower degree of stimulation (76%) in the presence of the modulator nicardipine. 4. Therefore, the serine to cysteine mutations in P-gp may suggest that vinblastine and nicardipine transduce their effects on ATP hydrolysis through distinct conformational pathways. The wt and cys-less P-gp isoforms display similarity in their fundamental kinetic properties thereby validating the use of cys-less P-gp as a template for future cysteine-directed structure/function analysis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
83 ATP hydrolysis was stopped by addition of 40 ml of a 12% (w v71 ) SDS solution and released inorganic Table 1 Oligonucleotide sequences used to generate cDNA for P-gp devoid of cysteine residues Oligonucleotide Mutation Sequence (5'-3') 1 C137S GTTTCATTTTGGaGCCTGGCAGCTG 2 C431S GAAACAGTGGCTcTGGGAAGAGCAC 3 C717S TTGGTGTATTTTcTGCCATTATAAA 4 C956S TTTCCTATGCTGGATcTTTCCGGTTTGGAGC 5 C1074S GCAGCAGTGGCTcTGGGAAGAGCAC 6 C1125S-PstI+Xhol ATCCTGTTTGACTcgAGCATTGCTGAGA 7 C1227S GAAGGCCGCACCaGCATTGTGATTG 8 6xHis+XbaI+NotI AGGCTGGAACAAAGCGCCAGcaccatcaccatcaccactgatctagagcggccgc ATTTGTTTAGATATGACATTT 9 _BstEII (nt 671) GCAAATGCAGGtAAccTAGAAGATCTGATG 10 +PstI (nt 844) GGAGCCTGGCtGCaGGAAGACAAATA 11 +SacII (nt 1054) GTAGGATTTACcCGcGGTTGGAAGCTAACC 12 +SfiI (nt 1304) GGGATAAAGAAgGCcATTACgGCCAATATTTC 13 +AflII (nt 1387) GGGACCACCTTGGTCtTaagcGGGGAATATTCT 14 +SphI (nt 2812) CATGGTTTTCCGAagCATGCTCAGACAGG 15 7NdeI (nt 3177) AAGTTTGAACAcATGTATGCTCAG 16 +SpeI (nt 3349) GAGGATGTTCTacTAGTATTTTCAGC 17 +EagI (nt 4168) GTGGTGTTTCAGAAcGGCcGAGTCAAGGAGCATGGC phosphate was determined colorimetrically, as previously described (Chiet et al., 1988).
X
ABCB1 p.Cys1125Ser 11739236:83:416
status: NEW