ABCB1 p.Gly534Val
| Predicted by SNAP2: | A: D (85%), C: D (85%), D: D (95%), E: D (95%), F: D (91%), H: D (95%), I: D (91%), K: D (95%), L: D (91%), M: D (91%), N: D (91%), P: D (95%), Q: D (95%), R: D (95%), S: D (91%), T: D (91%), V: D (91%), W: D (95%), Y: D (95%), |
| Predicted by PROVEAN: | A: D, C: D, D: D, E: D, F: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D, |
[switch to compact view]
Comments [show]
None has been submitted yet.
[hide] Insight in eukaryotic ABC transporter function by ... FEBS Lett. 2006 Feb 13;580(4):1064-84. Epub 2006 Jan 19. Frelet A, Klein M
Insight in eukaryotic ABC transporter function by mutation analysis.
FEBS Lett. 2006 Feb 13;580(4):1064-84. Epub 2006 Jan 19., 2006-02-13 [PMID:16442101]
Abstract [show]
With regard to structure-function relations of ATP-binding cassette (ABC) transporters several intriguing questions are in the spotlight of active research: Why do functional ABC transporters possess two ATP binding and hydrolysis domains together with two ABC signatures and to what extent are the individual nucleotide-binding domains independent or interacting? Where is the substrate-binding site and how is ATP hydrolysis functionally coupled to the transport process itself? Although much progress has been made in the elucidation of the three-dimensional structures of ABC transporters in the last years by several crystallographic studies including novel models for the nucleotide hydrolysis and translocation catalysis, site-directed mutagenesis as well as the identification of natural mutations is still a major tool to evaluate effects of individual amino acids on the overall function of ABC transporters. Apart from alterations in characteristic sequence such as Walker A, Walker B and the ABC signature other parts of ABC proteins were subject to detailed mutagenesis studies including the substrate-binding site or the regulatory domain of CFTR. In this review, we will give a detailed overview of the mutation analysis reported for selected ABC transporters of the ABCB and ABCC subfamilies, namely HsCFTR/ABCC7, HsSUR/ABCC8,9, HsMRP1/ABCC1, HsMRP2/ABCC2, ScYCF1 and P-glycoprotein (Pgp)/MDR1/ABCB1 and their effects on the function of each protein.
Comments [show]
None has been submitted yet.
No. Sentence Comment
227 G534V and L531R practically eliminated MDR1 expression [119].
X
ABCB1 p.Gly534Val 16442101:227:0
status: NEW[hide] Role of glycine-534 and glycine-1179 of human mult... Biochem J. 2001 May 15;356(Pt 1):71-5. Szakacs G, Ozvegy C, Bakos E, Sarkadi B, Varadi A
Role of glycine-534 and glycine-1179 of human multidrug resistance protein (MDR1) in drug-mediated control of ATP hydrolysis.
Biochem J. 2001 May 15;356(Pt 1):71-5., 2001-05-15 [PMID:11336637]
Abstract [show]
The human multidrug resistance protein (MDR1) (P-glycoprotein), a member of the ATP-binding cassette (ABC) family, causes multidrug resistance by an active transport mechanism, which keeps the intracellular level of hydrophobic compounds below a cell-killing threshold. Human MDR1 variants with mutations affecting a conserved glycine residue within the ABC signature of either or both ABC units (G534D, G534V, G1179D and G534D/G1179D) were expressed and characterized in Spodoptera frugiperda (Sf9) cell membranes. These mutations caused a loss of measurable ATPase activity but still allowed ATP binding and the formation of a transition-state intermediate (nucleotide trapping). In contrast with the wild-type protein, in which substrate drugs accelerate nucleotide trapping, in the ABC signature mutants nucleotide trapping was inhibited by MDR1-substrate drugs, suggesting a miscommunication between the drug-binding site(s) and the catalytic domains. Equivalent mutations of the two catalytic sites resulted in a similar effect, indicating the functional equivalence of the two sites. On the basis of these results and recent structural information on an ABC-ABC dimer [Hopfner, Karcher, Shin, Craig, Arthur, Carney and Tainer (2000) Cell 101, 789-800], we propose a key role of these glycine residues in the interdomain communication regulating drug-induced ATP hydrolysis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
6 Human MDR1 variants with mutations affecting a conserved glycine residue within the ABC signature of either or both ABC units (G534D, G534V, G1179D and G534D\G1179D) were expressed and characterized in Spodoptera frugiperda (Sf9) cell membranes.
X
ABCB1 p.Gly534Val 11336637:6:134
status: NEW79 In the same study we found that the MDR1 variant G534D was expressed at a level comparable with the wild-type protein, whereas the expression of a similar variant (G534V-MDR1) was not detected.
X
ABCB1 p.Gly534Val 11336637:79:164
status: NEW80 In the present study, with careful selection and subsequent amplification of individual clones, we were able to express high levels of the G534V mutant as well (Figure 1).
X
ABCB1 p.Gly534Val 11336637:80:139
status: NEW81 Figure 1 also shows that both the G1179D mutant (affecting the equipositional glycine in the C-terminal ABC unit) and the variant containing aspartic residues at both sides (G534D\ Figure 1 Expression of the MDR1 signature mutants Isolated Sf9 cell membranes (10 µg) expressing G534D-MDR1 (lane 1), G1179D-MDR1 (lane 2), G534D/G1179D-MDR1 (lane 3), G534V-MDR1 (lane 4) or wild-type MDR1 (lane 5) were run on SDS/7.5% (w/v) PAGE gels.
X
ABCB1 p.Gly534Val 11336637:81:356
status: NEW96 We observed nucleotide trapping in mutants G534D, Figure 2 Binding of [α-32 P]8-azido-ATP by the MDR1 signature mutants ATP-binding was performed with isolated Sf9 cell membranes (100 µg) expressing G534V-MDR1 (lane 1), wild-type MDR1 (lanes 2 and 8), G534D-MDR1 (lanes 3 and 4), β- galactosidase (lane 5), G534D/G1179D-MDR1 (lane 6) or G1179D-MDR1 (lane 7).
X
ABCB1 p.Gly534Val 11336637:96:210
status: NEW100 Membranes expressing G534D/G1179D-MDR1 (lanes 1 and 2), G534V-MDR1 (lanes 3-5), G534D-MDR1 (lanes 6-8) or G1179D-MDR1 (lanes 9-11) were incubated at 37 mC for 10 min in the presence of 20 µM [α-32 P]8-azido-Mg-ATP as described in the Materials and methods section.
X
ABCB1 p.Gly534Val 11336637:100:56
status: NEW104 G534V and G1179D in the presence of AlF % - (see Figure 3) or BeFx (results not shown).
X
ABCB1 p.Gly534Val 11336637:104:0
status: NEW107 Interestingly, neither G534D-MDR1 nor G1179D-MDR1 was labelled in the presence of vanadate, not even at higher azido-ATP concentrations and longer incubation times (up to 100 µM and 10 min respectively), whereas G534V showed vanadate-induced nucleotide trapping activity (results not shown).
X
ABCB1 p.Gly534Val 11336637:107:217
status: NEW114 Conversely, the same reaction with the ABC signature mutants G534D (ratio 0.32), G534V (ratio 0.41) and G1179D (ratio 0.48) was inhibited by verapamil (36 µM).
X
ABCB1 p.Gly534Val 11336637:114:81
status: NEW116 Inhibition persisted over a wide range of azido-ATP concentration (5-50 µM) and was observed in the presence of other drugs (calcein-AM, vincristine, cyclosporin A; results not Figure 4 Effect of verapamil on transition-state formation (nucleotide trapping) in the presence of AlF4 - Labelling was performed with isolated Sf9 cell membranes (100 µg) expressing wild-type MDR1 (lanes 1 and 2), G534V-MDR1 (lanes 3 and 4), G534D-MDR1 (lanes 5 and 6) or G1179D-MDR1 (lanes 7 and 8) as described in the Materials and methods section.
X
ABCB1 p.Gly534Val 11336637:116:405
status: NEW119 The positions of molecular-mass markers are indicated (in kDa) at the right. Figure 5 Limited proteolysis of the ABC signature mutants after nucleotide trapping in the presence of AlF4 - Labelling was performed with isolated Sf9 cell membranes (200 µg) expressing wild-type MDR1 (lane 1), G534D-MDR1 (lane 2), G534V-MDR1 (lane 3), G1179D-MDR1 (lane 4) or β- galactosidase (lane 5).
X
ABCB1 p.Gly534Val 11336637:119:315
status: NEW130 Nevertheless, as shown in Figure 5, catalytic intermediates stabilized by AlF % - were formed in both ABC domains of the G534D, G534V and the G1179D mutants (BeFx gave similar results; results not shown).
X
ABCB1 p.Gly534Val 11336637:130:128
status: NEW[hide] Characterization of the human multidrug resistance... Biochem J. 1997 May 1;323 ( Pt 3):777-83. Bakos E, Klein I, Welker E, Szabo K, Muller M, Sarkadi B, Varadi A
Characterization of the human multidrug resistance protein containing mutations in the ATP-binding cassette signature region.
Biochem J. 1997 May 1;323 ( Pt 3):777-83., 1997-05-01 [PMID:9169612]
Abstract [show]
A number of mutants with single amino acid replacements were generated in the highly conserved ATP-binding cassette (ABC)-signature region (amino acids 531-543) of the N-terminal half of the human multidrug resistance (MDR1) protein. The cDNA variants were inserted into recombinant baculoviruses and the MDR1 proteins were expressed in Spodoptera frugiperda (Sf9) insect cells. The level of expression and membrane insertion of the MDR1 variants was examined by immunostaining, and MDR1 function was followed by measuring drug-stimulated ATPase activity. We found that two mutations, L531R and G534V, practically eliminated MDR1 expression; thus these amino acid replacements seem to inhibit the formation of a stable MDR1 protein structure. The MDR1 variants G534D and I541R were expressed at normal levels with normal membrane insertion, but showed a complete loss of drug-stimulated ATPase activity, while mutant R538M yielded full protein expression but with greatly decreased ATPase activity. Increasing the ATP concentration did not restore MDR1 ATPase activity in these variants. Some amino acid replacements in the ABC-signature region (K536I, K536R, I541T and R543S) affected neither the expression and membrane insertion nor the ATPase function of MDR1. We found no alteration in the drug-sensitivity of ATP cleavage in any of the MDR1 variants that had measurable ATPase activity. These observations suggest that the ABC-signature region is essential for MDR1 protein stability and function, but alterations in this region do not seem to modulate MDR1-drug interactions directly.
Comments [show]
None has been submitted yet.
No. Sentence Comment
6 We found that two mutations, L531R and G534V, practically eliminated MDR1 expression; thus these amino acid replacements seem to inhibit the formation of a stable MDR1 protein structure.
X
ABCB1 p.Gly534Val 9169612:6:39
status: NEW38 Mutations were engineered by the site-directed mutagenesis technique of Kunkel [18] utilizing the following mutagenic oligonucleotides: L531R, 5h CCACCACTCCGCTGGGCCC- CT; G534D, 5h TGCTTCTGAACACCACTCAAT; G534V, 5h TGCTTCTGATCACCACTCAAT; K536R, 5h GATCCTCTG- TCTCTGCCCACCAC; K536I, 5h GATCCTCTGTATCTGC- CCACCAC; R538M, 5h GCACGTGCAATGGCGATCATCT- GCTTG; I541R, 5h GCACGTGCTCTGGCGATCCTCTGCT- TG; I541T, 5h GCACGTGCTGTGGCGATCCTCTGCTTG; R543S, 5h AACCAGGGCACTTGCAATGGCGAT.
X
ABCB1 p.Gly534Val 9169612:38:204
status: NEW64 Mutant Relative expression level Relative ATPase activity L531R 0.1 0.05 G534V 0.1 0.05 G534D 1.0 0.05 K536I 0.9 1.0 K536R 1.1 0.9 R538M 1.1 0.4 I541R 1.2 0.05 I541T 1.0 1.1 R543S 1.1 1.1 the mutants G534D, K536I, K536R, R538M, I541R, I541T and R543S the MDR1-immunoreactive proteins appeared with the expected size of underglycosylated wild-type MDR1 (about 130 kDa), characteristic of MDR1 expression in Sf9 cells [14,19].
X
ABCB1 p.Gly534Val 9169612:64:73
status: NEW66 In contrast, two of the mutants, L531R and G534V, gave very low yields of expression ( 10% of the wild-type).
X
ABCB1 p.Gly534Val 9169612:66:43
status: NEW74 We found similar full recognition for the mutants K536I, K536R, I541T and R543S, whereas the mutant proteins showing low expression levels on the immunoblots (L531R and G534V) were not detectable by immunoflow cytometry either (results not shown).
X
ABCB1 p.Gly534Val 9169612:74:169
status: NEW120 According to our experiments, two amino acid substitutions affecting the ABC-signature region, namely mutations L531R and G534V, led to the formation of unstable MDR1 proteins, which were probably mostly degraded before insertion into the membrane.
X
ABCB1 p.Gly534Val 9169612:120:122
status: NEW153 The L531R and G534V mutants were expressed in very low amounts in Sf9 cells, as they apparently could not form stable three-dimensional structures.
X
ABCB1 p.Gly534Val 9169612:153:14
status: NEW[hide] The power of the pump: mechanisms of action of P-g... Eur J Pharm Sci. 2006 Apr;27(5):392-400. Epub 2005 Dec 13. Ambudkar SV, Kim IW, Sauna ZE
The power of the pump: mechanisms of action of P-glycoprotein (ABCB1).
Eur J Pharm Sci. 2006 Apr;27(5):392-400. Epub 2005 Dec 13., [PMID:16352426]
Abstract [show]
Members of the superfamily of ATP-binding cassette (ABC) transporters mediate the movement of a variety of substrates including simple ions, complex lipids and xenobiotics. At least 18 ABC transport proteins are associated with disease conditions. P-glycoprotein (Pgp, ABCB1) is the archetypical mammalian ABC transport protein and its mechanism of action has received considerable attention. There is strong biochemical evidence that Pgp moves molecular cargo against a concentration gradient using the energy of ATP hydrolysis. However, the molecular details of how the energy of ATP hydrolysis is coupled to transport remain in dispute and it has not been possible to reconcile the data from various laboratories into a single model. The functional unit of Pgp consists of two nucleotide binding domains (NBDs) and two trans-membrane domains which are involved in the transport of drug substrates. Considerable progress has been made in recent years in characterizing these functionally and spatially distinct domains of Pgp. In addition, our understanding of the domains has been augmented by the resolution of structures of several non-mammalian ABC proteins. This review considers: (i) the role of specific conserved amino acids in ATP hydrolysis mediated by Pgp; (ii) emerging insights into the dimensions of the drug binding pocket and the interactions between Pgp and the transport substrates and (iii) our current understanding of the mechanisms of coupling between energy derived from ATP binding and/or hydrolysis and efflux of drug substrates.
Comments [show]
None has been submitted yet.
No. Sentence Comment
53 Hoof et al. (1994) Human L531R Decreased cell surface expression Bakos et al. (1997) G534V K536I Normal cell surface expression K536R Normal ATP hydrolysis I541T R543S LSGGQ or linker peptide or signature motif Human R538M Normal cell surface expression Decreased ATP hydrolysis Bakos et al. (1997) I541R Normal cell surface expression No ATP hydrolysis Walker B Mouse D551N D1196N No ATP hydrolysis, required for Mg2+ binding Urbatsch et al. (1998) Human D555A D1200A Same as above Hrycyna et al. (1999) Walker B Mouse E552A E1197A Trapping of ATP, no steady-state hydrolysis Tombline et al. (2004b) Mouse E552Q E1197Q No steady-state ATP hydrolysis Vigano et al. (2002) Human E556A E1201A Trapping of ATP or ADP in the absence of vanadate, low levels of ATP hydrolysis Sauna et al. (2002) D-loop Mouse D558N D1203N Decreased ATP hydrolysis Urbatsch et al. (2000b) the ABC transporter superfamily.
X
ABCB1 p.Gly534Val 16352426:53:85
status: NEW