ABCB1 p.Gly534Val
[switch to full view]Comments [show]
None has been submitted yet.
PMID: 16442101
[PubMed]
Frelet A et al: "Insight in eukaryotic ABC transporter function by mutation analysis."
No.
Sentence
Comment
227
G534V and L531R practically eliminated MDR1 expression [119].
X
ABCB1 p.Gly534Val 16442101:227:0
status: NEW
PMID: 11336637
[PubMed]
Szakacs G et al: "Role of glycine-534 and glycine-1179 of human multidrug resistance protein (MDR1) in drug-mediated control of ATP hydrolysis."
No.
Sentence
Comment
6
Human MDR1 variants with mutations affecting a conserved glycine residue within the ABC signature of either or both ABC units (G534D, G534V, G1179D and G534D\G1179D) were expressed and characterized in Spodoptera frugiperda (Sf9) cell membranes.
X
ABCB1 p.Gly534Val 11336637:6:134
status: NEW79 In the same study we found that the MDR1 variant G534D was expressed at a level comparable with the wild-type protein, whereas the expression of a similar variant (G534V-MDR1) was not detected.
X
ABCB1 p.Gly534Val 11336637:79:164
status: NEW80 In the present study, with careful selection and subsequent amplification of individual clones, we were able to express high levels of the G534V mutant as well (Figure 1).
X
ABCB1 p.Gly534Val 11336637:80:139
status: NEW81 Figure 1 also shows that both the G1179D mutant (affecting the equipositional glycine in the C-terminal ABC unit) and the variant containing aspartic residues at both sides (G534D\ Figure 1 Expression of the MDR1 signature mutants Isolated Sf9 cell membranes (10 µg) expressing G534D-MDR1 (lane 1), G1179D-MDR1 (lane 2), G534D/G1179D-MDR1 (lane 3), G534V-MDR1 (lane 4) or wild-type MDR1 (lane 5) were run on SDS/7.5% (w/v) PAGE gels.
X
ABCB1 p.Gly534Val 11336637:81:356
status: NEW96 We observed nucleotide trapping in mutants G534D, Figure 2 Binding of [α-32 P]8-azido-ATP by the MDR1 signature mutants ATP-binding was performed with isolated Sf9 cell membranes (100 µg) expressing G534V-MDR1 (lane 1), wild-type MDR1 (lanes 2 and 8), G534D-MDR1 (lanes 3 and 4), β- galactosidase (lane 5), G534D/G1179D-MDR1 (lane 6) or G1179D-MDR1 (lane 7).
X
ABCB1 p.Gly534Val 11336637:96:210
status: NEW100 Membranes expressing G534D/G1179D-MDR1 (lanes 1 and 2), G534V-MDR1 (lanes 3-5), G534D-MDR1 (lanes 6-8) or G1179D-MDR1 (lanes 9-11) were incubated at 37 mC for 10 min in the presence of 20 µM [α-32 P]8-azido-Mg-ATP as described in the Materials and methods section.
X
ABCB1 p.Gly534Val 11336637:100:56
status: NEW104 G534V and G1179D in the presence of AlF % - (see Figure 3) or BeFx (results not shown).
X
ABCB1 p.Gly534Val 11336637:104:0
status: NEW107 Interestingly, neither G534D-MDR1 nor G1179D-MDR1 was labelled in the presence of vanadate, not even at higher azido-ATP concentrations and longer incubation times (up to 100 µM and 10 min respectively), whereas G534V showed vanadate-induced nucleotide trapping activity (results not shown).
X
ABCB1 p.Gly534Val 11336637:107:217
status: NEW114 Conversely, the same reaction with the ABC signature mutants G534D (ratio 0.32), G534V (ratio 0.41) and G1179D (ratio 0.48) was inhibited by verapamil (36 µM).
X
ABCB1 p.Gly534Val 11336637:114:81
status: NEW116 Inhibition persisted over a wide range of azido-ATP concentration (5-50 µM) and was observed in the presence of other drugs (calcein-AM, vincristine, cyclosporin A; results not Figure 4 Effect of verapamil on transition-state formation (nucleotide trapping) in the presence of AlF4 - Labelling was performed with isolated Sf9 cell membranes (100 µg) expressing wild-type MDR1 (lanes 1 and 2), G534V-MDR1 (lanes 3 and 4), G534D-MDR1 (lanes 5 and 6) or G1179D-MDR1 (lanes 7 and 8) as described in the Materials and methods section.
X
ABCB1 p.Gly534Val 11336637:116:405
status: NEW119 The positions of molecular-mass markers are indicated (in kDa) at the right. Figure 5 Limited proteolysis of the ABC signature mutants after nucleotide trapping in the presence of AlF4 - Labelling was performed with isolated Sf9 cell membranes (200 µg) expressing wild-type MDR1 (lane 1), G534D-MDR1 (lane 2), G534V-MDR1 (lane 3), G1179D-MDR1 (lane 4) or β- galactosidase (lane 5).
X
ABCB1 p.Gly534Val 11336637:119:315
status: NEW130 Nevertheless, as shown in Figure 5, catalytic intermediates stabilized by AlF % - were formed in both ABC domains of the G534D, G534V and the G1179D mutants (BeFx gave similar results; results not shown).
X
ABCB1 p.Gly534Val 11336637:130:128
status: NEW
PMID: 9169612
[PubMed]
Bakos E et al: "Characterization of the human multidrug resistance protein containing mutations in the ATP-binding cassette signature region."
No.
Sentence
Comment
6
We found that two mutations, L531R and G534V, practically eliminated MDR1 expression; thus these amino acid replacements seem to inhibit the formation of a stable MDR1 protein structure.
X
ABCB1 p.Gly534Val 9169612:6:39
status: NEW38 Mutations were engineered by the site-directed mutagenesis technique of Kunkel [18] utilizing the following mutagenic oligonucleotides: L531R, 5h CCACCACTCCGCTGGGCCC- CT; G534D, 5h TGCTTCTGAACACCACTCAAT; G534V, 5h TGCTTCTGATCACCACTCAAT; K536R, 5h GATCCTCTG- TCTCTGCCCACCAC; K536I, 5h GATCCTCTGTATCTGC- CCACCAC; R538M, 5h GCACGTGCAATGGCGATCATCT- GCTTG; I541R, 5h GCACGTGCTCTGGCGATCCTCTGCT- TG; I541T, 5h GCACGTGCTGTGGCGATCCTCTGCTTG; R543S, 5h AACCAGGGCACTTGCAATGGCGAT.
X
ABCB1 p.Gly534Val 9169612:38:204
status: NEW64 Mutant Relative expression level Relative ATPase activity L531R 0.1 0.05 G534V 0.1 0.05 G534D 1.0 0.05 K536I 0.9 1.0 K536R 1.1 0.9 R538M 1.1 0.4 I541R 1.2 0.05 I541T 1.0 1.1 R543S 1.1 1.1 the mutants G534D, K536I, K536R, R538M, I541R, I541T and R543S the MDR1-immunoreactive proteins appeared with the expected size of underglycosylated wild-type MDR1 (about 130 kDa), characteristic of MDR1 expression in Sf9 cells [14,19].
X
ABCB1 p.Gly534Val 9169612:64:73
status: NEW66 In contrast, two of the mutants, L531R and G534V, gave very low yields of expression ( 10% of the wild-type).
X
ABCB1 p.Gly534Val 9169612:66:43
status: NEW74 We found similar full recognition for the mutants K536I, K536R, I541T and R543S, whereas the mutant proteins showing low expression levels on the immunoblots (L531R and G534V) were not detectable by immunoflow cytometry either (results not shown).
X
ABCB1 p.Gly534Val 9169612:74:169
status: NEW120 According to our experiments, two amino acid substitutions affecting the ABC-signature region, namely mutations L531R and G534V, led to the formation of unstable MDR1 proteins, which were probably mostly degraded before insertion into the membrane.
X
ABCB1 p.Gly534Val 9169612:120:122
status: NEW153 The L531R and G534V mutants were expressed in very low amounts in Sf9 cells, as they apparently could not form stable three-dimensional structures.
X
ABCB1 p.Gly534Val 9169612:153:14
status: NEW
PMID: 16352426
[PubMed]
Ambudkar SV et al: "The power of the pump: mechanisms of action of P-glycoprotein (ABCB1)."
No.
Sentence
Comment
53
Hoof et al. (1994) Human L531R Decreased cell surface expression Bakos et al. (1997) G534V K536I Normal cell surface expression K536R Normal ATP hydrolysis I541T R543S LSGGQ or linker peptide or signature motif Human R538M Normal cell surface expression Decreased ATP hydrolysis Bakos et al. (1997) I541R Normal cell surface expression No ATP hydrolysis Walker B Mouse D551N D1196N No ATP hydrolysis, required for Mg2+ binding Urbatsch et al. (1998) Human D555A D1200A Same as above Hrycyna et al. (1999) Walker B Mouse E552A E1197A Trapping of ATP, no steady-state hydrolysis Tombline et al. (2004b) Mouse E552Q E1197Q No steady-state ATP hydrolysis Vigano et al. (2002) Human E556A E1201A Trapping of ATP or ADP in the absence of vanadate, low levels of ATP hydrolysis Sauna et al. (2002) D-loop Mouse D558N D1203N Decreased ATP hydrolysis Urbatsch et al. (2000b) the ABC transporter superfamily.
X
ABCB1 p.Gly534Val 16352426:53:85
status: NEW