ABCMdb

ABCB1 p.Ala999Thr

Predicted by SNAP2:	C: D (71%), D: D (85%), E: D (80%), F: D (85%), G: D (66%), H: D (75%), I: D (71%), K: D (80%), L: D (80%), M: D (53%), N: D (66%), P: D (85%), Q: D (66%), R: D (75%), S: N (78%), T: N (66%), V: D (71%), W: D (85%), Y: D (85%),
Predicted by PROVEAN:	C: D, D: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, R: D, S: N, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Mechanisms of resistance to anticancer drugs: the ... Pharmacogenomics. 2005 Mar;6(2):115-38. Lepper ER, Nooter K, Verweij J, Acharya MR, Figg WD, Sparreboom A
Mechanisms of resistance to anticancer drugs: the role of the polymorphic ABC transporters ABCB1 and ABCG2.
Pharmacogenomics. 2005 Mar;6(2):115-38., [PMID:15882131]

Abstract [show]
ATP-binding cassette (ABC) genes play a role in the resistance of malignant cells to anticancer agents. The ABC gene products, including ABCB1 (P-glycoprotein) and ABCG2 (breast cancer-resistance protein [BCRP], mitoxantrone-resistance protein [MXR], or ABC transporter in placenta [ABCP]), are also known to influence oral absorption and disposition of a wide variety of drugs. As a result, the expression levels of these proteins in humans have important consequences for an individual's susceptibility to certain drug-induced side effects, interactions, and treatment efficacy. Naturally occurring variants in ABC transporter genes have been identified that might affect the function and expression of the protein. This review focuses on recent advances in the pharmacogenetics of the ABC transporters ABCB1 and ABCG2, and discusses potential implications of genetic variants for the chemotherapeutic treatment of cancer.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
126 In addition to the possible decrease in expression levels, ATPase activity in the ABCG2 +24 Intron 20 G A +40 Intron 20 C T 2547 Exon 21 A G 849 Ile to Met 2650 Exon 21 C T 884 Syn 2677 Exon 21 G T 893 Ala to Ser 2677# Exon 21 G A 893 Ala to Thr +31 Intron 22 G A 2956 Exon 24 A G 986 Met to Val 2995 Exon 24 G A 999 Ala to Thr 3151 Exon 25 C G 1051 Pro to Ala 3320 Exon 26 A C 1107 Gln to Pro 3322 Exon 26 T C 1108 Trp to Arg 3396 Exon 26 C T 1132 Syn 3421 Exon 26 T A 1141 Ser to Thr 3435** Exon 26 C T 1145 Syn 3751 Exon 28 G A 1251 Val to Ile 3767 Exon 28 C A 1256 Thr to Lys 4030 Exon 28 G C Non-coding 4036 Exon 28 A G Non-coding +21 Intron 28 T C Table 2. Summary of common genetic variants in the ABCB1 gene (continued) *cDNA numbers are relative to the ATG site and based on the cDNA sequence from GenBank accession number M14758 with an A as the reference at position 43. Login to comment

[hide] Genetic polymorphisms of ATP-binding cassette tran... Expert Opin Pharmacother. 2005 Nov;6(14):2455-73. Sakurai A, Tamura A, Onishi Y, Ishikawa T
Genetic polymorphisms of ATP-binding cassette transporters ABCB1 and ABCG2: therapeutic implications.
Expert Opin Pharmacother. 2005 Nov;6(14):2455-73., [PMID:16259577]

Abstract [show]
Pharmacogenomics, the study of the influence of genetic factors on drug action, is increasingly important for predicting pharmacokinetics profiles and/or adverse reactions to drugs. Drug transporters, as well as drug metabolism play pivotal roles in determining the pharmacokinetic profiles of drugs and their overall pharmacological effects. There is an increasing number of reports addressing genetic polymorphisms of drug transporters. However, information regarding the functional impact of genetic polymorphisms in drug transporter genes is still limited. Detailed functional analysis in vitro may provide clear insight into the biochemical and therapeutic significance of genetic polymorphisms. This review addresses functional aspects of the genetic polymorphisms of human ATP-binding cassette transporters, ABCB1 and ABCG2, which are critically involved in the pharmacokinetics of drugs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
94 Kimchi-Sarfaty et al. [73] assessed the five most common coding SNPs (i.e., N21D, F103L, S400N, A893S and A999T) by using a vaccinia virus-based transient expression system. Login to comment
115 For this purpose, ABCB1 cDNA cloned from a human liver cDNA library was prepared, and several variant forms (i.e., N183S, S400N, R492C, R669C, I849M, A893T, M986V, A999T, P1051A and G1063A) were generated by site-directed mutagenesis. Login to comment
124 The variant forms (i.e., N183S, S400N, R492C, R669C, I849M, A893T, M986V, A999T, P1051A and G1063A), as well as the wild type, of ABCB1 exhibited the verapamil-enhanced ATPase activity. Login to comment
129 N21D M89T N44S H2N F103L E108K N183S G185V I261V S400N R492C A599T L662R R669C V801M A893S/T I829V I849M M986V A999T G1063A P1051A Q1107P W1108R I1145M S1141T V1251I T1256K COOH ATP-binding site ATP-binding site EXTRACELLULAR INTRACELLULAR A80E Figure 2. Login to comment
139 The I849M and A999T variants had Km values lower than that of wild-type ABCB1, whereas the Km value of the N183S variant was higher. Login to comment

[hide] High-speed screening of human ATP-binding cassette... Methods Enzymol. 2005;400:485-510. Ishikawa T, Sakurai A, Kanamori Y, Nagakura M, Hirano H, Takarada Y, Yamada K, Fukushima K, Kitajima M
High-speed screening of human ATP-binding cassette transporter function and genetic polymorphisms: new strategies in pharmacogenomics.
Methods Enzymol. 2005;400:485-510., [PMID:16399366]

Abstract [show]
Drug transporters represent an important mechanism in cellular uptake and efflux of drugs and their metabolites. Hitherto a variety of drug transporter genes have been cloned and classified into either solute carriers or ATP-binding cassette (ABC) transporters. Such drug transporters are expressed in various tissues such as the intestine, brain, liver, kidney, and, importantly, cancer cells, where they play critical roles in the absorption, distribution, and excretion of drugs. We developed high-speed functional screening and quantitative structure-activity relationship analysis methods to study the substrate specificity of ABC transporters and to evaluate the effect of genetic polymorphisms on their function. These methods would provide powerful and practical tools for screening synthetic and natural compounds, and the deduced data can be applied to the molecular design of new drugs. Furthermore, we demonstrate a new "SNP array" method to detect genetic polymorphisms of ABC transporters in human samples.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
167 For this purpose, we have prepared several variant forms (i.e., N183S, S400N, R492C, R669C, I849M, A893T, M986V, A999T, P1051A, and G1063A) by site‐ directed mutagenesis. Login to comment

[hide] Role of pharmacogenetics of ATP-binding cassette t... Pharmacol Ther. 2006 Nov;112(2):457-73. Cascorbi I
Role of pharmacogenetics of ATP-binding cassette transporters in the pharmacokinetics of drugs.
Pharmacol Ther. 2006 Nov;112(2):457-73., [PMID:16766035]

Abstract [show]
Interindividual differences of drug response are an important cause of treatment failures and adverse drug reactions. The identification of polymorphisms explaining distinct phenotypes of drug metabolizing enzymes contributed in part to the understanding of individual variations of drug plasma levels. However, bioavailability also depends on a major extent from the expression and activity of drug transport across biomembranes. In particular efflux transporters of the ATP-binding cassette (ABC) family such as ABCB1 (P-glycoprotein, P-gp), the ABCC (multidrug resistance-related protein, MRP) family and ABCG2 (breast cancer resistance protein, BCRP) have been identified as major determinants of chemoresistance in tumor cells. They are expressed in the apical membranes of many barrier tissue such as the intestine, liver, blood-brain barrier, kidney, placenta, testis and in lymphocytes, thus contributing to plasma, liquor, but also intracellular drug disposition. Since expression and function exhibit a broad variability, it was hypothesized that hereditary variances in the genes of membrane transporters could explain at least in part interindividual differences of pharmacokinetics and clinical outcome of a variety of drugs. This review focuses on the functional significance of single nucleotide polymorphisms (SNP) of ABCB1, ABCC1, ABCC2, and ABCG2 in in vitro systems, in vivo tissues and drug disposition, as well as on the clinical outcome of major indications.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
706 Mickley et al. (1998) discovered 2 non-synonymous SNP, a 2677G>T transversion in exon 21 and a 2995G>A transition in exon 24 of ABCB1 leading to an A893S and A999T exchanges, respectively. Login to comment

[hide] Pharmacogenetics/genomics of membrane transporters... Cancer Metastasis Rev. 2007 Mar;26(1):183-201. Huang Y
Pharmacogenetics/genomics of membrane transporters in cancer chemotherapy.
Cancer Metastasis Rev. 2007 Mar;26(1):183-201., [PMID:17323126]

Abstract [show]
Inter-individual variability in drug response and the emergence of adverse drug reactions are main causes of treatment failure in cancer therapy. Recently, membrane transporters have been recognized as an important determinant of drug disposition, thereby affecting chemosensitivity and -resistance. Genetic factors contribute to inter-individual variability in drug transport and targeting. Therefore, pharmacogenetic studies of membrane transporters can lead to new approaches for optimizing cancer therapy. This review discusses genetic variations in efflux transporters of the ATP-binding cassette (ABC) family such as ABCB1 (MDR1, P-glycoprotein), ABCC1 (MRP1), ABCC2 (MRP2) and ABCG2 (BCRP), and uptake transporters of the solute carrier (SLC) family such as SLC19A1 (RFC1) and SLCO1B1 (SLC21A6), and their relevance to cancer chemotherapy. Furthermore, a pharmacogenomic approach is outlined, which using correlations between the growth inhibitory potency of anticancer drugs and transporter gene expression in multiple human cancer cell lines, has shown promise for determining the relevant transporters for any given drugs and predicting anticancer drug response.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
124 Moreover, Letourneau et al. examined 10 non-synonymous ABCC1 SNPs to determine Table 2 Summary of genetic variants in ABC transporters ABCB1, ABCC1, ABCC2 and ABCG2 involved in cancer chemotherapy Variants (location, effect) Phenotype Drug Sample Reference ABCB1 +103T>C (5'flanking, non-coding) Increased transcription Doxorubicin vincristine osteosarcoma Stein et al., 1994 [19] +8T>C (5'flanking, non-coding) Unknown Leukemia Rund et al., 1999 [21] 1236C>T (exon12, synonymous) Higher expression AML blasts Illmer et al., 2002 [47] Lower clearance Irinotecan Cancer patients Sai et al., 2003 [44] Higher exposure Irinotecan, SN-38 Cancer patients Mathijssen et al., 2003 [45] 2677G>T/A (exon21, A893S/T) Lower expression placenta Tanabe et al., 2001 [42] Lower expression placenta Hitzl et al., 2004 [37] Higher expression AML blasts Illmer et al., 2002 [47] Allele specific expression Cell lines, lymphoma Mickley et al., 1998 [22] Lower clearance Irinotecan Cancer patients Sai et al., 2003 [44] Survival leukemia Illmer et al., 2002 [47] Survival leukemia van den Heuvel-Eibrink et al., 2001 [48] Worse survival AML blasts Kim et al., 2006 [10] Higher efficacy Paclitaxel Ovarian cancer Green et al., 2006 [50] 2995G>A (exon24, A999T) None Cell lines, lymphoma Mickley et al., 1998 [22] 3435C>T (exon26, synonymous) Lower expression Duodenal protein Hoffmeyer et al., 2000 [26] Lower expression placenta Hitzl et al., 2004 [37] Higher expression Intestine mRNA Nakamura et al., 2002 [32] Higher expression AML blasts Illmer et al., 2002 [47] Lower clearance Irinotecan Cancer patients Sai et al., 2003 [44] Lower efflux Digoxin CD56+ NK cells Hitzl et al., 2001 [27] Higher plasma level Digoxin Healthy volunteers Hoffmeyer et al., 2000 [26] Higher AUC Cyclosporin transplant patients Bonhomme-Faivre et al., 2004 [36] Lower CNS relapse Cancer patients Stanulla et al., 2005 [46] Better survival leukemia Illmer et al., 2002 [47] Higher efficacy Breast cancer Kafka et al., 2003 [49] Higher activity, worse survival AML Kim et al., 2006 [10] Better survival Platinums Esophageal cancer Wu et al., 2006 [43] No difference Docetaxel patients Puisset et al., 2004 [41] No difference Irinotecan Cancer patients Mathijssen et al., 2004 [39] No difference Vincristine patients Plasschaert et al., 2004 [40] No difference colon Taniguchi et al., 2003 [24] ABCC1 -260G>C (5'flanking, non-coding) Higher activity Transfected cell line Wang et al., 2005 [62] Table 2 (Continued) Variants (location, effect) Phenotype Drug Sample Reference 128G>C (exon2, C43S) Reduced resistance Vincristine, arsenite Transfected cell line Leslie et al., 2003 [60] 1299G>T (exon10, R433S) Reduced transport of LTC4, increased resistance to doxorubicin Leukotriene C4, doxorubicin Transfected cell line Conrad et al., 2002 [59] 2012G>T (exon16, G671V) No change in activityLeukotriene C4 Transfected cell line Conrad et al., 2001 [58] Heart toxicity Doxorubicin nLon-Hodgkin lymphoma Wojnowski et al., 2005 [63] 2965G>A (exon22, A989T) Reduced transport Estradiol 17β-glucuronide Transfected cell line Letourneau et al., 2005 [61] ABCC2 1271A>G (exon10, R421G) Reduced drug elimination, increased nephrotoxicity Methotrexate One lymphoma patient Hulot et al., 2005 [79] 3972C>T (exon28, nonsynonymous) Reduced drug clearance Irinotecan Cancer patients Innocenti et al., 2004 [80] ABCG2 376C>T (exon4, Q126stop) Reduced transport Porphyrin Trensfected cell Tamura et al., 2006 [104] 421C>A (exon5, Q141K) Lower expression Transfected cell lines Imai et al., 2002 [94] Lower expression Transfected cell lines Kondo et al., 2004 [95] Lower expression Placenta Kobayashi et al., 2005 [98] Reduced ATPase activity Trensfected cell lines Mizuarai et al., 2004 [97] Higher plasma levels Diflomotecan patients Sparreboom et al., 2004 [100] Increased bioavailability Topotecan patients Sparreboom et al., 2005 [101] Increased bioavailability 9-Aminocamptothecin patients Zamboni et al., 2006 [81] Increased drug accumulation Imatinib Transfected cell lines Gardner et al., 2006 [96] Increased drug accumulation Topotecan Trensfected cell lines Imai et al., 2002 [94] No difference Imatinib patients Gardner et al., 2006 [96] No difference intestine Zamber et al., 2003 [99] No difference MTX Trensfected cell lines Kondo et al., 2004 [95] the effects on expression and function of this transporter in transfected HEK293T cells [61]. Login to comment
57 2677G>T in exon 21 and 2995G>A/T in exon 24 were reported by Mickley et al. [22], leading to amino acid changes of A893S and A999T, respectively. Login to comment

[hide] ABC drug transporters: hereditary polymorphisms an... Pharmacogenomics. 2001 Feb;2(1):51-64. Kerb R, Hoffmeyer S, Brinkmann U
ABC drug transporters: hereditary polymorphisms and pharmacological impact in MDR1, MRP1 and MRP2.
Pharmacogenomics. 2001 Feb;2(1):51-64., [PMID:11258197]

Abstract [show]
Transport by ATP-dependent efflux pumps, such as P-glycoprotein (PGP) and multi-drug resistance related proteins (MRPs), influences bioavailability and disposition of drugs. These efflux pumps serve as defence mechanisms and determine bioavailability and CNS concentrations of many drugs. However, despite the fact that substantial data have been accumulated on the structure, function and pharmacological role of ABC transporters and even though modification of PGP function is an important mechanism of drug interactions and adverse effects in humans, there is a striking lack of data on variability of the underlying genes. This review focuses on the human drug transporter proteins PGP (MDR1) and the multi-drug resistance proteins MRP1 and MRP2. An overview is provided of pharmacologically relevant genetic, structural and functional data as well as on hereditary polymorphisms, their phenotypical consequences and pharmacological implications.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
97 SNP Region N Frequency of SNPs (%) Effect Heterozygous Homozygous Observed Estimated T-12C E1 85 11.8 0 0.4 Non-coding G-1A E2 188 11.2 0 0.4 TL initiation A61G E2 188 17.6 0.5 0.81 Asn21Asp G-25T I4 85 26 3.5 2.3 G-35C I4 85 1.2 0 0.01 # T307C E5 85 1.2 0 0.01 Phe103Leu C+139T I5 85 48.2 16.5 16.8 C+145T I5 85 2.4 0 0.01 G1199A E11 85 12.9 0 0.4 Ser400Asn C1236T E12 188 48.9 13.3 14.4 Gly412Gly # C+44T I12 188 11.7 0 0.4 T-76A I16 85 45.9 22.4 20.3 A+137G I17 85 1.2 0 0.01 G2677T E21 83b 43.4 42.2 38.4 Ala893Ser G2995A E24 36b 11.1 38.4 Ala999Thr C3435T E26 537 47.7 26.4 24.1 Ile1145Ile C3396T E26 188 0.53 0 0.01 Wobble § MDR1 sequences gb:AC002457 and AC005068 are defined as 'wild type`. Login to comment

[hide] Genetic polymorphisms of the human MDR1 drug trans... Annu Rev Pharmacol Toxicol. 2003;43:285-307. Epub 2002 Jan 10. Schwab M, Eichelbaum M, Fromm MF
Genetic polymorphisms of the human MDR1 drug transporter.
Annu Rev Pharmacol Toxicol. 2003;43:285-307. Epub 2002 Jan 10., [PMID:12359865]

Abstract [show]
P-glycoprotein is an ATP-dependent efflux pump that contributes to the protection of the body from environmental toxins. It transports a huge variety of structurally diverse compounds. P-glycoprotein is involved in limiting absorption of xenobiotics from the gut lumen, in protection of sensitive tissues (brain, fetus, testis), and in biliary and urinary excretion of its substrates. P-glycoprotein can be inhibited or induced by xenobiotics, thereby contributing to variable drug disposition and drug interactions. Recently, several SNPs have been identified in the MDR1 gene, some of which can affect P-glycoprotein expression and function. Potential implications of MDR1 polymorphisms for drug disposition, drug effects, and disease risk are discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
60 In a Northern Italian population, the extent of linkage disequilibrium TABLE 2 Summary of MDR1 genetic variants in different ethnic groups Location Position Allele Effect Reference promotor 5 flanking/-41a A (28) G exon 1a exon 1a/-145 C (28) G exon 1b exon 1b/-129 T (25, 33) C intron 1 exon 2/-4 C (29) T intron 1 exon 2/-1 G initiation of translation (25, 27, 29) A exon 2 exon 2/61 A Asn21Asp (25-27, 29) G intron 4 exon 5/-35 G (25) C intron 4 exon 5/-25 G (25) T exon 5 exon 5/307 T Phe103Leu (25) C intron 6 exon 6/+139 C (25, 27) T intron 6 exon 6/+145 C (25) T exon 7 exon 7/548 A Asn183Ser (29) G exon 11 exon 11/1199 G Ser400Asn (25, 27, 29) A exon 12 exon 12/1236 C wobble (23, 25, 27, 29) T (Gly412Gly) intron 12 exon 12/+44 C (25, 27) T exon 13 exon 13/1474 C Arg492Cys (29) T intron 16 exon 17/-76 T (25, 27) A intron 17 exon 17/137 A (25) G exon 21 exon 21/2650 C wobble (29) T (Leu884Leu) (Continued ) TABLE 2 (Continued) Location Position Allele Effect Reference exon 21 exon 21/2677 G (22, 23, 27, 29) T Ala893Ser A Ala893Thr exon 24 exon 24/2956 A Met986Val (33) G exon 24 exon 24/2995 G Ala999Thr (22) A exon 26 exon 26/3320 A Gln1107Pro (27) C exon 26 exon 26/3396 C wobble (25) T exon 26 exon 26/3421 T Ser1141Thr (29, 30) A exon 26 exon 26/3435 C wobble (23, 25, 29) T (Ile1145Ile) exon 28 exon 28/4030 G (33) C exon 28 exon 28/4036 A (23, 33) G The positions of the polymorphisms correspond to positions of MDR1 cDNA with the first base of the ATG start codon set to 1 (GenBank accession # M14758). Login to comment
73 Both polymorphisms, G2677T/A and G2995A, resulting in amino acid exchanges in exon 21 (Ala893Ser/Thr) and exon 24 (Ala999Thr), respectively, are located in the second transmembrane domain, the exon G2995A polymorphism closer to the ABC domain. Login to comment
86 However, a recent publication characterized the functional consequences of five coding SNPs (Asn21Asp, Phe103Leu, Ser400Asn, Ala893Ser, Ala999Thr) using a vaccinia virus-based transient expression system (40a). Login to comment

[hide] MDR1 genotype-related pharmacokinetics and pharmac... Biol Pharm Bull. 2002 Nov;25(11):1391-400. Sakaeda T, Nakamura T, Okumura K
MDR1 genotype-related pharmacokinetics and pharmacodynamics.
Biol Pharm Bull. 2002 Nov;25(11):1391-400., [PMID:12419946]

Abstract [show]
The multidrug resistant transporter MDR1/P-glycoprotein, the gene product of MDR1, is a glycosylated membrane protein of 170 kDa, belonging to the ATP-binding cassette superfamily of membrane transporters. MDR1 acts as an energy-dependent efflux pump that exports its substrates out of cells. MDR1 was originally isolated from resistant tumor cells as part of the mechanism of multidrug resistance, but over the last decade, it has been elucidated that human MDR1 is also expressed throughout the body to confer intrinsic resistance to the tissues by exporting unnecessary or toxic exogeneous substances or metabolites. A number of structurally unrelated drugs are substrates for MDR1, and MDR1 and other transporters are recognized as an important class of proteins for regulating pharmacokinetics and pharmacodynamics. In 2000, Hoffmeyer et al. performed a systemic screening for MDR1 polymorphisms and detected 15 single nucleotide polymorphisms (SNPs). They also indicated that a polymorphism in exon 26 at position 3435 (C3435T), a silent mutation, affected the expression level of MDR1 protein in duodenum, and thereby the intestinal absorption of digoxin. To date, the genotype frequencies of C3435T have been investigated extensively using a larger population and interethnic difference has been elucidated, and a total of 28 SNPs have been found at 27 positions on the MDR1 gene. Clinical studies on MDR1 genotype-related MDR1 expression and pharmacokinetics have also been performed around the world; however, results were not always consistent with Hoffmeyer's report. In this review, published reports are summarized for the future individualization of pharmacotherapy based on MDR1 genotyping. In addition, recent investigations have raised the possibility that MDR1 and related transporters play a fundamental role in regulating apoptosis and immunology, and in fact, there are reports of MDR1-related susceptibility to inflammatory bowel disease, HIV infection and renal cell carcinoma. Herein, these issues are also summarized, and the current status of the knowledge in the area of pharmacogenomics of other transporters is briefly introduced.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 In 2001, Hitzl et al. also indicated that healthy Caucasian subjects with T/T3435 had a more decreased efflux of rhodamine from CD56ϩ NK cells and a lower MDR1 mRNA expression in leukocytes than those with C/C3435 .65) In renal tissues, the C3435T polymorphism is reported to be associated with reduced MDR1 expression.31) However, Tanabe et al. suggested that C3435T had no effect on the placental MDR1 expression based on 89 subjects and Western blotting.53) We determined MDR1 mRNA levels in biopsy specimens of the duodenum obtained from 13 healthy Japanese subjects by real time quantitative RT-PCR and found that MDR1 mRNA expression was higher in T/T3435 than C/C3435 or C/T3435 (Fig. 1).66) The discrepancies between the reports might be ex- November 2002 1393 Table 2. Summary of Genetic Polymorphisms in MDR1 Position Location Effect A1a/-41G Intron Noncoding C-145G Exon 1a Noncoding T-129C (T12C) Exon 1b Noncoding C-4T Exon 2 Noncoding G-1A Exon 2 Noncoding A61G Exon 2 Asn21Asp G5/-25T Intron G5/-35C Intron T307C Exon 5 Phe103Leu C6/ϩ139T Intron A548G Exon 7 Asn183Ser G1199A Exon 11 Ser400Asn C1236T Exon 12 Silent C12/ϩ44T Intron C1474T Exon 13 Arg492Cys T17/-76A Intron A17/ϩ137G Intron C2650T Exon 21 Silent G2677(A,T) Exon 21 Ala893Thr (G2677A) Ala893Ser (G2677T) A2956G Exon 24 Met986Val G2995A Exon 24 Ala999Thr A3320C Exon 26 Gln1107Pro C3396T Exon 26 Silent T3421A Exon 26 Ser1141Thr C3435T Exon 26 Silent G4030C Exon 28 Silent A4036G Exon 28 Silent This list was based on the literature (refs. 49-54). Login to comment

[hide] [Significance of drug transporter for the internal... Internist (Berl). 2003 Feb;44(2):219-26. Siegmund W, Cascorbi I, Weitschies W, Kroemer HK
[Significance of drug transporter for the internal medicine clinic].
Internist (Berl). 2003 Feb;44(2):219-26., [PMID:12674742]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 [58] und Mickley et al. [40] wiesen 2 weitere Basenaustausche G2677T im Exon 21 und G2995AimExon24nach,diezudenAmi- nosäureaustauschen Ala893Ser und Ala999Thr führen.MDR1 liegt auf Chro- mosom7q21.1,umfasst28Exonsundweist eine cDNA-Länge von 3843 Basenpaaren auf. Login to comment

[hide] Pharmacogenetics of MDR1 and its impact on the pha... Pharmacogenomics. 2003 Jul;4(4):397-410. Sakaeda T, Nakamura T, Okumura K
Pharmacogenetics of MDR1 and its impact on the pharmacokinetics and pharmacodynamics of drugs.
Pharmacogenomics. 2003 Jul;4(4):397-410., [PMID:12831320]

Abstract [show]
The multi-drug resistant transporter MDR1/P-glycoprotein, the gene product of MDR1, is a glycosylated membrane protein of 170 kDa, belonging to the ATP-binding cassette (ABC) superfamily of membrane transporters. MDR1 was originally isolated from resistant tumor cells as part of the mechanism of multi-drug resistance, but over the last decade, it has been elucidated that human MDR1 is also expressed throughout the body to confer intrinsic resistance to the tissues by exporting unnecessary or toxic exogeneous substances or metabolites. A number of various types of structurally unrelated drugs are substrates for MDR1, and MDR1 and other transporters are recognized as an important class of proteins for regulating pharmacokinetics and pharmacodynamics. In 2000, Hoffmeyer et al. performed a systemic screening for MDR1 polymorphisms and indicated that a single nucleotide polymorphism (SNP), C3435T in exon 26, which caused no amino acid change, was associated with the duodenal expression of MDR1 and thereby the plasma concentrations of digoxin after oral administration. Interethnic differences in genotype frequencies of C3435T have been clarified, and, at present, a total of 28 SNPs have been found at 27 positions on the MDR1 gene. Clinical studies on the effects of C3435T on MDR1 expression and function in the tissues, and also on the pharmacokinetics and pharmacodynamics have been performed around the world; however, there are still discrepancies in the results, suggesting that the haplotype analysis of the gene should be included instead of SNP detection, and the design of clinical trials must be carefully planned to avoid misinterpretations. A polymorphism of C3435T is also reported to be a risk factor for a certain class of diseases such as the inflammatory bowel diseases, Parkinson's disease and renal epithelial tumor, and this might also be explained by the effects on MDR1 expression and function. In this review, the latest reports are summarized for the future individualization of pharmacotherapy based on MDR1 genotyping.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
75 Position Location Effect A1a/-41G Intron Non-coding C-145G Exon 1a Non-coding T-129C (T12C) Exon 1b Non-coding C-4T Exon 2 Non-coding G-1A Exon 2 Non-coding A61G Exon 2 Asn21Asp G5/-25T Intron G5/-35C Intron T307C Exon 5 Phe103Leu C6/+139T Intron A548G Exon 7 Asn183Ser G1199A Exon 11 Ser400Asn C1236T Exon 12 Silent C12/+44T Intron C1474T Exon 13 Arg492Cys T17/-76A Intron A17/+137G Intron C2650T Exon 21 Silent G2677(A,T) Exon 21 Ala893Thr (G2677A) Ala893Ser (G2677T) A2956G Exon 24 Met986Val G2995A Exon 24 Ala999Thr A3320C Exon 26 Gln1107Pro C3396T Exon 26 Silent T3421A Exon 26 Ser1141Thr C3435T Exon 26 Silent G4030C Exon 28 Silent A4036G Exon 28 Silent See references [34-39]. Login to comment

[hide] P-glycoprotein: from genomics to mechanism. Oncogene. 2003 Oct 20;22(47):7468-85. Ambudkar SV, Kimchi-Sarfaty C, Sauna ZE, Gottesman MM
P-glycoprotein: from genomics to mechanism.
Oncogene. 2003 Oct 20;22(47):7468-85., 2003-10-20 [PMID:14576852]

Abstract [show]
Resistance to chemically different natural product anti-cancer drugs (multidrug resistance, or MDR) results from decreased drug accumulation, resulting from expression of one or more ATP-dependent efflux pumps. The first of these to be identified was P-glycoprotein (P-gp), the product of the human MDR1 gene, localized to chromosome 7q21. P-gp is a member of the large ATP-binding cassette (ABC) family of proteins. Although its crystallographic 3-D structure is yet to be determined, sequence analysis and comparison to other ABC family members suggest a structure consisting of two transmembrane (TM) domains, each with six TM segments, and two nucleotide-binding domains. In the epithelial cells of the gastrointestinal tract, liver, and kidney, and capillaries of the brain, testes, and ovaries, P-gp acts as a barrier to the uptake of xenobiotics, and promotes their excretion in the bile and urine. Polymorphisms in the MDR1 gene may affect the pharmacokinetics of many commonly used drugs, including anticancer drugs. Substrate recognition of many different drugs occurs within the TM domains in multiple-overlapping binding sites. We have proposed a model for how ATP energizes transfer of substrates from these binding sites on P-gp to the outside of the cell, which accounts for the apparent stoichiometry of two ATPs hydrolysed per molecule of drug transported. Understanding of the biology, genetics, and biochemistry of P-gp promises to improve the treatment of cancer and explain the pharmacokinetics of many commonly used drugs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
85 Kioka et al. (1989) showed a slight increase in resistance to doxorubicin, but no effect on colchicine or vinblastine Table 2 Common MDR1 exonic polymorphisms Exon number Polymorphic nucleotide variant Change in amino acid References 1 À145 - Ito et al. (2001) 1 À129 - Hoffmeyer et al. (2000); Tanabe et al. (2001) 2 61 N21D Cascorbi et al. (2001); Decleves et al. (2000); Hoffmeyer et al. (2000); Kim et al. (2001) 5 307 F103L Hoffmeyer et al. (2000) 7 548 N183S Kim et al. (2001) 10 1107 G369P Hoffmeyer et al. (2000) 11 1199 S400N Cascorbi et al. (2001); Hoffmeyer et al. (2000); Kim et al. (2001) 12 1236 Wobble Cascorbi et al. (2001); Hoffmeyer et al. (2000); Kim et al. (2001); Kioka et al. (1989) 13 1474 R492C Kim et al. (2001) 21 2650 Wobble Kim et al. (2001) 21 2677 893A, S, or T Cascorbi et al. (2001); Kim et al. (2001); Kioka et al. (1989); Mickley et al. (1998) 24 2956 M986V Tanabe et al. (2001) 24 2995 A999T Mickley et al. (1998) 26 3320 Q1107P Cascorbi et al. (2001) 26 3396 Wobble Hoffmeyer et al. (2000) 26 3421 S1141T Kim et al. (2001) 26a 3435 Wobble Hoffmeyer et al. (2000); Kim et al. (2001); Kioka et al. (1989) 28 4030 - Tanabe et al. (2001) 28 4036 - Kioka et al. (1989); Tanabe et al. (2001) a The only polymorphism that correlates with changes in drug delivery and disposition P-glycoprotein SV Ambudkar et al resistance in the SNP located on exon 21, position 2677, Ser893 (Kioka et al., 1989). Login to comment

[hide] Polymorphisms in human MDR1 (P-glycoprotein): rece... Clin Pharmacol Ther. 2004 Jan;75(1):13-33. Marzolini C, Paus E, Buclin T, Kim RB
Polymorphisms in human MDR1 (P-glycoprotein): recent advances and clinical relevance.
Clin Pharmacol Ther. 2004 Jan;75(1):13-33., [PMID:14749689]

Abstract [show]
Drug transporters are increasingly recognized to be important to drug disposition and response. P-glycoprotein, the encoded product of the human MDR1 (ABCB1) gene, is of particular clinical relevance in that this transporter has broad substrate specificity, including a variety of structurally divergent drugs in clinical use today. Moreover, expression of this efflux transporter in certain tissue compartments such as the gastrointestinal tract and brain capillary endothelial cells limits oral absorption and central nervous system entry of many drugs. Recently, a number of single-nucleotide polymorphisms (SNPs) in MDR1 have been identified. An increasing number of studies have also implicated certain commonly occurring SNPs in MDR1 in problems including altered drug levels and host susceptibility to diseases such as Parkinson's disease, inflammatory bowel disease, refractory seizures, and CD4 cell recovery during human immunodeficiency virus therapy. However, in many such cases, the reported effects of MDR1 SNPs have been inconsistent and, in some cases, conflicting. In this review SNPs in MDR1 in relation to population frequencies, drug levels, and phenotypes are outlined. In addition, issues relating to MDR1 haplotypes, environmental factors, and study design, as potential confounding factors of the observed MDR1 polymorphism effect in vivo, are also discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
75 Summary of genetic polymorphisms in MDR1 Location Position Mutation Effect Mutant allele frequency (%) Hoffmeyer et al89 : C Cascorbi et al90 : C Siegmund et al91 : C Promotor 5' flanking/-41 A/G Noncoding Exon 1a Exon 1a/-145 C/G Noncoding Exon 1b Exon 1b/-129 T/C Noncoding 5.9 Intron 1 Exon 2/-4 C/T Noncoding Intron 1 Exon 2/-1 G/A Initial translation 5.6 9 3.7 Exon 2 Exon 2/61 A/G Asn21Asp 9.3 11.2 8.9 Intron 4 Exon 5/-35 G/C 0.6 Intron 4 Exon 5/-25 G/T 16.5 Exon 5 Exon 5/307 T/C Phe103Leu 0.6 0 Intron 6 Exon 6/ϩ139 C/T 40.6 37.2 35.8 Intron 6 Exon 6/ϩ145 C/T 1.2 Exon 7 Exon 7/548 A/G Asn183Ser Exon 11 Exon 11/1199 G/A Ser400Asn 6.5 5.5 2.9 Exon 12 Exon 12/1236 C/T Silent 37.8 41 34.3 Intron 12 Exon 12/ϩ44 C/T 5.9 4.9 7.5 Exon 13 Exon 13/1474 C/T Arg492Cys Intron 16 Exon 17/-76 T/A 45.3 46.2 49.3 Intron 17 Exon 17/ϩ137 A/G 0.6 Exon 21 Exon 21/2650 C/T Silent Exon 21 Exon 21/2677 G/T Ala893Ser 41.6 40.3 G/A Ala893Thr 1.9 3.7 Exon 24 Exon 24/2956 A/G Met986Val Exon 24 Exon 24/2995 G/A Ala999Thr Exon 26 Exon 26/3320 A/C Gln1107Pro 0.2 Exon 26 Exon 26/3396 C/T Silent 0.3 Exon 26 Exon 26/3421 T/A Ser1141Thr Exon 26 Exon 26/3435 C/T Silent 48.1 53.9 50.7 Exon 28 Exon 28/4030 G/C Exon 28 Exon 28/4036 A/G The positions of the polymorphisms were established with the first base of the ATG start codon set to 1. Login to comment

[hide] Pharmacogenetics of drug transporters and its impa... Curr Top Med Chem. 2004;4(13):1385-98. Sakaeda T, Nakamura T, Okumura K
Pharmacogenetics of drug transporters and its impact on the pharmacotherapy.
Curr Top Med Chem. 2004;4(13):1385-98., [PMID:15379652]

Abstract [show]
Most drug responses are determined by the interplay of several gene products that influence pharmacokinetics and pharmacodynamics, i.e., drug metabolizing enzymes, drug transporters, and drug targets. With the sequencing of the human genome, it has been estimated that approximately 500-1200 genes code for drug transporters. Concerning the effects of genetic polymorphisms on pharmacotherapy, the best characterized drug transporter is the multidrug resistant transporter P-glycoprotein/MDR1, the gene product of MDR1. Little such information is available on other drug transporters. MDR1 is a glycosylated membrane protein of 170 kDa, belonging to the ATP-binding cassette superfamily, and is expressed mainly in intestines, liver, kidneys and brain. A number of various types of structurally unrelated drugs are substrates for MDR1, and their intestinal absorption, hepatobiliary secretion, renal secretion and brain transport are regulated by MDR1. The first investigation on the effects of MDR1 genotypes on pharmacotherapy was reported in 2000: a silent single nucleotide polymorphism (SNP), C3435T in exon 26, was found to be associated with the duodenal expression of MDR1, and thereby the plasma concentration of digoxin after oral administration. At present, a total of 28 SNPs have been found at 27 positions on the MDR1 gene. Clinical investigations on the association of MDR1 genotypes with the expression and function of MDR1 in tissues, and with pharmacokinetics and pharmacodynamics have mainly focused on C3435T; however, there are still discrepancies in the results, suggesting that the haplotype of the gene should be analyzed instead of a SNP. C3435T is also reported to be a risk factor for a certain class of diseases including the inflammatory bowel diseases, Parkinson's disease and renal epithelial tumor, and this also might be explained by the effects on MDR1 expression and function. In this review, the latest reports on the effects of genetic polymorphisms of MDR1 on pharmacotherapy are summarized, and the pharmacogenetics of other transporters is briefly introduced.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
127 Position Location Effect A1a/-41G intron noncoding C-145G exon 1a noncoding T-129C (T12C) exon 1b noncoding C-4T exon 2 noncoding G-1A exon 2 noncoding A61G G5/-25T G5/-35C exon 2 intron intron Asn21Asp T307C C6/+139T exon 5 intron Phe103Leu A548G exon 7 Asn183Ser G1199A exon 11 Ser400Asn C1236T C12/+44T exon 12 intron silent C1474T T17/-76A A17/+137G exon 13 intron intron Arg492Cys C2650T exon 21 silent G2677(A,T) exon 21 Ala893Thr (G2677A) Ala893Ser (G2677T) A2956G exon 24 Met986Val G2995A exon 24 Ala999Thr A3320C exon 26 Gln1107Pro C3396T exon 26 silent T3421A exon 26 Ser1141Thr C3435T exon 26 silent G4030C exon 28 silent A4036G exon 28 silent The list was based on the reports [67,68,71-74]. Login to comment

[hide] Twelve novel single nucleotide polymorphisms in AB... Drug Metab Pharmacokinet. 2002;17(6):566-71. Itoda M, Saito Y, Komamura K, Ueno K, Kamakura S, Ozawa S, Sawada J
Twelve novel single nucleotide polymorphisms in ABCB1/MDR1 among Japanese patients with ventricular tachycardia who were administered amiodarone.
Drug Metab Pharmacokinet. 2002;17(6):566-71., [PMID:15618713]

Abstract [show]
Twelve novel single nucleotide polymorphisms (SNPs) were found in the gene encoding the ATP-binding cassette transporter, P-glycoprotein, from 60 Japanese individuals who were administered the anti-antiarrythmic drug, amiodarone. The detected SNPs were as follows: 1) SNP, MPJ6_AB1017 (IVS6-109); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 2) SNP, MPJ6_AB1018 (IVS7+14); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 3) SNP, MPJ6_AB1021 (IVS9-44); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 4) SNP, MPJ6_AB1052 (IVS12+17); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 5) SNP, MPJ6_AB1029 (IVS15-69); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 6) SNP, MPJ6_AB1040 (IVS24+16); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 7) SNP, MPJ6_AB1053 (IVS27-189); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 8) SNP, MPJ6_AB1054 (IVS27-172); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 9) SNP, MPJ6_AB1048 (IVS27-167); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 10) SNP, MPJ6_AB1055 (IVS27-152); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 11) SNP, MPJ6_AB1049 (IVS27-119); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168; 12) SNP, MPJ6_AB1051 (at nucleotide 3751 (exon 28) from the A of the translation initiation codon); GENE NAME, ABCB1; ACCESSION NUMBER, NT_017168. Among these SNPs, only MPJ6_AB1051 resulted in an amino acid alteration, V1251I.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
18 Much eort has been taken to uncover polymorphisms in the ABCB1WMDR1 gene since a synonymous SNP, which correlated with diminished MDR1 expression levels in the human duodenum, was reported by Homeyer et al.7) To date, information on 19 single nucleotide polymorphisms (SNPs) including 7 nonsynonymous ones (N21D, F103L, S400N, A893S, A893T, A999T and Q1107P) for ABCB1WMDR1 have been reported in Caucasians.8,9) ABCB1WMDR1 gene SNPs including intronic10) and 2 nonsynonymous SNPs (E108K, M986V)11,12) were also reported in Japanese population. Login to comment
78 Moreover, the reported nonsynonymous polymorphisms, N21D, F103L, S400N, A893S and A999T have been shown not to substantially aect the activity of P-glycoprotein14) . Login to comment

[hide] Single nucleotide polymorphisms in human P-glycopr... Expert Opin Drug Deliv. 2006 Jan;3(1):23-35. Dey S
Single nucleotide polymorphisms in human P-glycoprotein: its impact on drug delivery and disposition.
Expert Opin Drug Deliv. 2006 Jan;3(1):23-35., [PMID:16370938]

Abstract [show]
Drug efflux pumps belong to a large family of ATP-binding cassette transporter proteins. These pumps bind their substrate and export it through the membrane using energy derived from ATP hydrolysis. P-glycoprotein, the main efflux pump in this family, is expressed not only in tumour cells but also in normal tissues with excretory function (liver, kidney and the intestine). It has a broad specificity of substrates and plays an important role in drug delivery and disposition. Recently, genetic screening of P-glycoprotein has yielded multiple single nucleotide polymorphisms, which seem to alter transporter function and expression. This review discusses the various polymorphisms of this gene and its impact on drug disposition and diseases.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
123 Location Position Mutation Effect Promoter 5`/-41 A→G Noncoding Exon 1a Exon 1a/-145 C→G Noncoding Exon 1b Exon 1b/-129 T→C Noncoding Intron 1 Exon 2/-4 C→T Noncoding Intron 1 Exon 2/-1 G→A Initiation of translation Exon 2 Exon 2/61 A→G Asn21Asp Intron 4 Exon 5/-35 G→C Intron 4 Exon 5/-25 G→T Exon 5 Exon 5/307 T→C Phe103Leu Intron 6 Exon 6/+139 C→T Intron 6 Exon 6/+145 C→T Exon 7 Exon 7/548 A→G Asn183Ser Exon 11 Exon 11/1119 G→A Ser400Asn Exon 12 Exon 12/1236 C→T Silent base change Intron 12 Exon 12/+44 C→T Exon 13 Exon 13/1474 C→T Arg492Cys Intron 16 Exon 17/-76 T→A Intron 17 Exon 17/+137 A→G Exon 21 Exon 21/2650 C→T Silent base change Exon 21 Exon 21/2677 G→T G→A Ala893Ser Ala893Thr Exon 24 Exon 24/2956 A→G Met986Val Exon 24 Exon 24/2995 G→A Ala999Thr Exon 26 Exon 26/3320 A→C Gln1107Pro Exon 26 Exon 26/3396 C→T Silent base change Exon 26 Exon 26/3421 T→A Ser1141Thr Exon 26 Exon 26/3435 C→T Silent base change Exon 28 Exon 28/4030 G→C Exon 28 Exon 28/4036 A→G The positions of the polymorphism are from the first base of the ATG start codon set to 1. Login to comment

[hide] MDR1 genotype-related pharmacokinetics: fact or fi... Drug Metab Pharmacokinet. 2005 Dec;20(6):391-414. Sakaeda T
MDR1 genotype-related pharmacokinetics: fact or fiction?
Drug Metab Pharmacokinet. 2005 Dec;20(6):391-414., [PMID:16415525]

Abstract [show]
Multidrug resistant transporter MDR1/P-glycoprotein, the gene product of MDR1, is a glycosylated membrane protein of 170 kDa, belonging to the ATP-binding cassette superfamily of membrane transporters. A number of various types of structurally unrelated drugs are substrates for MDR1, and MDR1 and other transporters are recognized as an important class of proteins for regulating pharmacokinetics. The first investigation of the effects of MDR1 genotypes on pharmacotherapy was reported in 2000; a silent single nucleotide polymorphism (SNP), C3435T in exon 26, was found to be associated with the duodenal expression of MDR1, and thereby the plasma concentration of digoxin after oral administration. In the last 5 years, clinical studies have been conducted around the world on the association of MDR1 genotype with MDR1 expression and function in tissues, and with the pharmacokinetics and pharmacodynamics of drugs; however, there are still discrepancies in the results on C3435T. In 1995, a novel concept to predict in vivo oral pharmacokinetic performance from data on in vivo permeability and in vitro solubility has been proposed, and this Biopharmaceutical Classification System strongly suggested that the effects of intestinal MDR1 on the intestinal absorption of substrates is minimal in the case of commercially available oral drugs, and therefore MDR1 genotypes are little associated with the pharmacokinetics after oral administration. This review summarizes the latest reports for the future individualization of pharmacotherapy based on MDR1 genotyping, and attempts to explain discrepancies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
29 Representative genetic polymorphisms in MDR1 Position Location EŠect A1aW-41G intron noncoding C-145G exon 1a noncoding T-129C (T12C) exon 1b noncoding C-4T exon 2 noncoding G-1A exon 2 noncoding A61G exon 2 Asn21Asp G5W-25T intron G5W-35C intron T307C exon 5 Phe103Leu C6W＋139T intron C6W＋145T intron A548G exon 7 Asn183Ser G1199A exon 11 Ser400Asn C1236T exon 12 silent C12W＋44T intron C1474T exon 13 Arg492Cys T17W-76A intron A17W＋137G intron C2650T exon 21 silent G2677A,T exon 21 Ala893Thr (G2677A) Ala893Ser (G2677T) A2956G exon 24 Met986Val G2995A exon 24 Ala999Thr A3320C exon 26 Gln1107Pro C3396T exon 26 silent T3421A exon 26 Ser1141Thr C3435T exon 26 silent G4030C exon 28 silent A4036G exon 28 silent See references 27, 32-36. Login to comment

[hide] Quantitative structure--activity relationship anal... Biochemistry. 2007 Jul 3;46(26):7678-93. Epub 2007 Jun 9. Sakurai A, Onishi Y, Hirano H, Seigneuret M, Obanayama K, Kim G, Liew EL, Sakaeda T, Yoshiura K, Niikawa N, Sakurai M, Ishikawa T
Quantitative structure--activity relationship analysis and molecular dynamics simulation to functionally validate nonsynonymous polymorphisms of human ABC transporter ABCB1 (P-glycoprotein/MDR1).
Biochemistry. 2007 Jul 3;46(26):7678-93. Epub 2007 Jun 9., 2007-07-03 [PMID:17559192]

Abstract [show]
Several preclinical and clinical studies suggest the importance of naturally occurring polymorphisms of drug transporters in the individual difference of drug response. To functionally validate the nonsynonymous polymorphisms of ABCB1 (P-glycoprotein/MDR1) in vitro, we generated SNP variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) and expressed them in Sf9 cells. The kinetic properties (Km and Vmax) of those variants were analyzed by measuring the ATPase activity to obtain the ATPase profile for each variant toward structurally unrelated substrates. On the basis of the experimental data, we determined the substrate specificity of ABCB1 WT and its variants by the quantitative structure-activity relationship (QSAR) analysis method. While several SNP variants appeared to influence the substrate specificity of ABCB1, the nonsynonymous polymorphisms of 2677G > T, A, or C at amino acid position 893 (Ala > Ser, Thr, or Pro) have great impacts on both the activity and the substrate specificity of ABCB1. The A893P variant (2677G > C), a rare mutation, exhibited markedly high activity of ATPase toward different test compounds. Molecular dynamics (MD) simulation based on a three-dimensional structural model of human ABCB1 revealed that multiple kinks are formed in the intracellular loop between transmembrane domains 10 and 11 of the A893P variant (2677G > C) protein. The polymorphisms of 2677G, 2677T, and 2677A exhibit wide ethnic differences in the allele frequency, and these nonsynonymous polymorphisms are suggested to be clinically important because of their altered ATPase activity and substrate specificity toward different drugs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1 To functionally validate the nonsynonymous polymorphisms of ABCB1 (P-glycoprotein/MDR1) in vitro, we generated SNP variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) and expressed them in Sf9 cells. Login to comment
38 For this purpose, ABCB1 cDNA cloned from a human liver cDNA library was prepared, and several variant forms (i.e., S400N, R492C, R669C, I849M, A893S, A893T, A893P, M986V, A999T, P1051A, and G1063A) were generated by site-directed mutagenesis. Login to comment
53 SNP data were obtained from the NCBI dbSNP database and recent publications: S400N (6, 7, 29, 31); R492C (7); R669C (16); I849M (16); A893P (NCBI dbSNP, rs2032582); A893S (8, 16, 23, 29-31); A893T (8, 16, 23, 29-31); M986V (30); A999T (28); P1051A (16); G1063A (NCBI dbSNP, rs2707944). Login to comment
80 Briefly, seventy-two hours after Table 1: Data on Oligonucleotide Primers Used for Site-Directed Mutagenesis and Experimental Conditionsa SNP amino acid cDNA F/R primers primer sequence (5' f 3') primer length (bases) % GC Tm (°C) S400N 1199G > A F CAGAAATGTTCACTTCAATTACCCATCTCGAAAAG 35 36.5 77.2 R CTTTTCGAGATGGGTAATTGAAGTGAACATTTCTG 35 36.5 77.2 R492C 1474C > T F TGAAAACATTCGCTATGGCTGTGAAAATGTCACCATGG 38 42.1 81.0 R CCATGGTGACATTTTCACAGCCATAGCGAATGTTTTCA 38 42.1 81.0 R669C 2005C > T F TCTAATAAGAAAAAGATCAACTTGTAGGAGTGTCCGTGGATC 42 37.9 80.9 R GATCCACGGACACTCCTACAAGTTGATCTTTTTCTTATTAGA 42 37.9 80.9 I849M 2547A > G F GGGACAGGAATAATTATGTCCTTCATCTATGGTTGGCA 38 34.5 77.9 R TGCCAACCATAGATGAAGGACATAATTATTCCTGTCCC 38 34.5 77.9 A893P 2677G > C F AGAAAGAACTAGAAGGTCCTGGGAAGATCGCTAC 34 47.1 80.9 R GTAGCGATCTTCCCAGGACCTTCTAGTTCTTTCT 34 47.1 80.9 A893S 2677G > T F GAAAGAACTAGAAGGTTCTGGGAAGATCGCTAC 33 45.4 79.6 R GTAGCGATCTTCCCAGAACCTTCTAGTTCTTTC 33 45.4 79.6 A893T 2677G > A F GAAAGAACTAGAAGGTACTGGGAAGATCGCTAC 33 45.4 79.6 R GTAGCGATCTTCCCAGTACCTTCTAGTTCTTTC 33 45.4 79.6 M986V 2956A > G F GTCTTTGGTGCCGTGGCCGTGGGGC 25 73.8 84.7 R GCCCCACGGCCACGGCACCAAAGAC 25 73.8 84.7 A999T 2995G > A F GTTCATTTGCTCCTGACTATACCAAAGCCAAAATATCAGCAG 42 40.5 82.0 R CTGCTGATATTTTGGCTTTGGTATAGTCAGGAGCAAATGAAC 42 40.5 82.0 P1051A 3151C > G F CGACCGGACATCGCAGTGCTTCAGGG 26 60.0 80.1 R CCCTGAAGCACTGCGATGTCCGGTCG 26 60.0 80.1 G1063A 3188G > C F GAGGTGAAGAAGGCCCAGACGCTGGCTC 28 64.3 83.7 R GAGCCAGCGTCTGGGCCTTCTTCACCTC 28 64.3 83.7 a F, forward; R, reverse. Login to comment
142 On the basis of the ABCB1 (WT) cDNA cloned from a human liver cDNA library, those variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) were generated by site-directed mutagenesis as described in Experimental Procedures. Login to comment
180 Figure 3 depicts the verapamil-stimulated ATPase activity of ABCB1 WT, S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A, where the verapamil-stimulated ATPase activities are normalized by considering the ABCB1 protein amounts. Login to comment
186 Sf9 plasma membranes (2 µg of protein) expressing ABCB1 WT and variants (S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) were incubated with ATP (2 mM) and verapamil at different concentrations (0, 1, 2, 5, 10, 20, 50, and 100 µM) at 37 °C for 30 min. After the incubation, the amount of liberated phosphate was measured as described in Experimental Procedures. All activities are expressed as mean values ( SD (n ) 6). Login to comment
187 Table 2: Km and Vmax Values for ATPase Activity of ABCB1 WT and Variants toward Verapamila SNP Km (µM) Vmax [nmol min-1 (mg of protein)-1 ] Vmax/Km WT 5.8 ( 2.3 62.4 ( 7.8 10.8 S400N 5.8 ( 2.8 46.7 ( 5.3** 8.0 R492C 5.6 ( 1.9 49.6 ( 10.0* 8.9 R669C 3.2 ( 1.6* 64.7 ( 6.9 20.1 I849M 1.5 ( 0.7** 80.3 ( 9.5** 51.8 A893P 1.5 ( 0.5** 405.2 ( 16.5** 274.6 A893S 11.1 ( 5.4 43.1 ( 7.1** 3.9 A893T 4.3 ( 1.4 98.9 ( 9.5** 22.9 M986V 5.1 ( 1.1 114.9 ( 13.6** 22.5 A999T 2.0 ( 0.8** 143.1 ( 21.2** 70.9 P1051A 6.2 ( 3.0 52.1 ( 13.6 8.4 G1063A 6.2 ( 3.7 117.9 ( 16.4** 19.0 a Data are expressed as mean ( SD, n ) 6. Login to comment
189 Table 3: Km and Vmax Values for ATPase Activity of ABCB1 WT and Variants toward Nicardipinea SNP Km (µM) Vmax [nmol min-1 (mg of protein)-1 Vmax/Km WT 1.1 ( 0.6 45.2 ( 8.7 41.0 S400N 1.7 ( 0.8 39.1 ( 9.1 23.4 R492C 1.1 ( 0.5 46.6 ( 6.4 43.5 R669C 0.3 ( 0.3** 53.5 ( 13.1 164.6 I849M 0.8 ( 0.9 80.2 ( 9.6** 102.9 A893P 0.1 ( 0.0** 341.2 ( 36.6** 4858.4 A893S 2.0 ( 0.6 39.2 ( 6.0 19.5 A893T 0.4 ( 0.2** 77.0 ( 16.9** 207.8 M986V 0.7 ( 0.4 89.7 ( 17.7** 129.9 A999T 0.3 ( 0.3** 115.4 ( 21.2** 393.6 P1051A 0.9 ( 0.3 33.1 ( 8.8* 36.3 G1063A 0.8 ( 0.4 93.2 ( 27.6** 121.4 a Data are expressed as mean ( SD, n ) 6. Login to comment
240 On the other hand, the benzene structure linked to the other ring by a single or double bond (CFC ) M113) negatively contributed to the drug-stimulated ATPase activity of M986V, G1063A, A999T, S400N, and A893S variants and WT, whereas the activity of the other variants was not affected by this structural component. Login to comment
269 The present study addresses the impact of nonsynonymous polymorphisms of ABCB1 (i.e., S400N, R492C, R669C, I849M, A893S, A893T, A893P, M986V, A999T, P1051A, and G1063A) on its function. Login to comment
273 Table 5: ABCB1 WT and Variant-Specific Descriptors and Corresponding Coefficients Deduced from QSAR Analysisa coefficients (95% reliability) for ABCB1 WT and vatiants descriptor WT S400N R492C R669C I849M A893P A893S A893T M986V A999T P1051A G1063A M532 24.3 21.2 18.5 35.9 52.7 169.8 14.0 61.2 39.4 63.0 13.9 52.1 (3.76) (5.81) (5.87) (7.68) (11.30) (18.84) (4.03) (7.75) (8.76) (9.39) (4.78) (10.94) M132 21.5 14.1 13.6 32.8 61.4 135.6 11.2 52.8 38.2 65.9 7.6 24.3 (3.89) (5.34) (5.78) (6.89) (12.66) (22.95) (4.06) (7.16) (8.62) (8.44) (5.71) (10.46) C-CHN-BT 3.3 3.8 1.7 3.5 5.7 11.6 1.2 6.1 7.1 7.3 2.0 2.8 (0.72) (0.95) (0.87) (1.08) (1.55) (2.48) (0.65) (1.29) (1.43) (1.44) (0.66) (1.86) ESTR -10.1 -12.5 (4.93) (5.00) OH-Ar -6.4 (4.03) R-CC 16.1 -4.4 (7.86) (1.73) RT -8.9 -17.7 (4.21) (8.22) -O-Ar 5.7 (3.67) D012 5.5 (4.10) G010 -15.4 (9.59) H100 4.9 (3.59) H181 -7.3 (5.04) H421 14.6 (6.84) H521 14.1 (10.42) M113 -5.8 -11.7 -7.7 -22.8 -16.4 -16.5 (3.69) (5.30) (3.70) (8.75) (8.19) (10.58) M232 -14.5 (9.38) M280 4.8 (2.65) M313 -5.2 (3.18) M332 -5.0 (3.11) M370 4.2 (3.14) M372 10.0 14.4 (5.46) (7.91) M392 73.3 10.3 (25.03) (6.38) M531 -5.1 (3.05) M540 15.8 (11.27) H7 7.3 24.0 (4.01) (10.91) H8 10.7 (4.74) L1 -6.7 (2.52) L9 13.8 (6.93) constant -12.2 -5.5 -0.2 -2.3 -24.0 -7.1 1.3 -4.3 0.9 9.0 0.6 -11.2 R2 0.934 0.847 0.853 0.906 0.893 0.981 0.782 0.954 0.915 0.956 0.836 0.831 FO(6, 29) 68.9 26.8 28.1 46.4 40.5 254.5 17.3 100.3 51.8 106.2 24.6 23.7 Q2 0.883 0.710 0.767 0.729 0.826 0.968 0.572 0.923 0.828 0.909 0.617 0.760 a R2 , correlation coefficient; FO, Fisher value (level of statistical significance). Login to comment
293 The values of those coefficients for WT and SNP variants (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) are the same as those shown in Table 5. Login to comment
316 Other nonsynonymous polymorphisms, such as S400N, R492C, R669C, P1051A, and G1063A occurring in intracellular loops as well as I849M, M986V, and A999T alterations in transmembrane domains, exhibited moderate changes in the kinetic properties of ABCB1. Login to comment
340 of samples allele frequency (%) allele frequency (%) ref S400N 1199 G > A African 111 G 100.0 A 0.0 23 African-American 100 G 99.0 A 1.0 16 German 461 G 94.5 A 5.5 29 Caucasian 85 G 87.1 A 12.9 6 Caucasian 50 G 98.0 A 2.0 31 Caucasian 100 G 97.5 A 2.5 16 Mexican-American 10 G 100.0 A 0.0 16 Asian-American 30 G 100.0 A 0.0 16 Pacific Islander 7 G 100.0 A 0.0 16 R492C 1474 C > T African-American 23 C 100.0 T 0.0 7 Caucasian 37 C 98.6 T 1.4 7 R669C 2005 C > T African-American 100 C 99.0 T 1.0 16 Caucasian 100 C 100.0 T 0.0 16 Mexican-American 10 C 100.0 T 0.0 16 Asian-American 30 C 100.0 T 0.0 16 Pacific Islander 7 C 100.0 T 0.0 16 I849M 2547 A > G African-American 100 C 100.0 T 0.0 16 Caucasian 100 C 99.5 T 0.5 16 Mexican-American 10 C 100.0 T 0.0 16 Asian-American 30 C 100.0 T 0.0 16 Pacific Islander 7 C 100.0 T 0.0 16 A893P/S/T 2677 G > T/A/C African (Beninese) 111 G 99.1 T 0.9 23 A 0.0 African-American 100 G 89.5 T 10.0 16 A 0.5 Caucasian 100 G 50.0 T 46.5 16 A 3.5 Caucasian 50 G 52.0 T 38.0 31 A 10.0 German 461 G 56.5 T 41.6 29 A 1.9 Mexican-American 10 G 60.0 T 40.0 16 A 0.0 Asian-American 30 G 33.3 T 45.0 16 A 21.7 Japanese 117 G 44.0 T 35.5 8 A 20.5 Japanese (placenta) 100 G 43.0 T 39.0 30 A 18.0 Japanese 48 G 36.5 T 41.7 30 A 21.8 Pacific Islander 7 G 28.6 T 35.7 16 A 35.7 ND ND G ND C ND NCBI dbSNP (rs2032582) M986V 2956 A > G Japanese (placenta) 100 A 99.5 G 0.5 30 Japanese 48 A 100.0 G 0.0 30 A999T 2995 G > A cell lines 36 G 94.4 A 5.6 28 P1051A 3151 C > G African-American 100 C 99.5 G 0.5 16 Caucasian 100 C 100.0 G 0.0 16 Mexican-American 10 C 100.0 G 0.0 16 Asian-American 30 C 100.0 G 0.0 16 Pacific Islander 7 C 100.0 G 0.0 16 G1063A 3188 G > A ND ND G ND A ND NCBI dbSNP (rs2707944) a ND, not determined. Login to comment

[hide] P-glycoprotein: tissue distribution, substrates, a... Handb Exp Pharmacol. 2011;(201):261-83. Cascorbi I
P-glycoprotein: tissue distribution, substrates, and functional consequences of genetic variations.
Handb Exp Pharmacol. 2011;(201):261-83., [PMID:21103972]

Abstract [show]
P-glycoprotein (ABCB1, MDR1) belongs to the ABC transporter family transporting a wide range of drugs and xenobiotics from intra- to extracellular at many biological interfaces such as the intestine, liver, blood-brain barrier, and kidney. The ABCB1 gene is highly polymorphic. Starting with the observation of lower duodenal protein expression and elevated digoxin bioavailability in relation to the 3435C>T single nucleotide polymorphism, hundreds of pharmacokinetic and outcome studies have been performed, mostly genotyping 1236C>T, 2677G>T/A, and 3435C>T. Though some studies pointed out that intracellular concentrations of anticancer drugs, for example, within lymphocytes, might be affected by ABCB1 variants resulting in differential outcome, current knowledge of the functional significance genetic variants of ABC membrane transporters does not allow selection of a particular SNP to predict an individual's pharmacokinetics.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
60 These SNPs caused an Ala893Ser and Ala999Thr exchange, respectively. Login to comment

[hide] Pharmacogenetics of drug transporters in the enter... Pharmacogenomics. 2011 May;12(5):611-31. Stieger B, Meier PJ
Pharmacogenetics of drug transporters in the enterohepatic circulation.
Pharmacogenomics. 2011 May;12(5):611-31., [PMID:21619426]

Abstract [show]
This article summarizes the impact of the pharmacogenetics of drug transporters expressed in the enterohepatic circulation on the pharmacokinetics and pharmacodynamics of drugs. The role of pharmacogenetics in the function of drug transporter proteins in vitro is now well established and evidence is rapidly accumulating from in vivo pharmacokinetic studies, which suggests that genetic variants of drug transporter proteins can translate into clinically relevant phenotypes. However, a large amount of conflicting information on the clinical relevance of drug transporter proteins has so far precluded the emergence of a clear picture regarding the role of drug transporter pharmacogenetics in medical practice. This is very well exemplified by the case of P-glycoprotein (MDR1, ABCB1). The challenge is now to develop pharmacogenetic models with sufficient predictive power to allow for translation into drug therapy. This will require a combination of pharmacogenetics of drug transporters, drug metabolism and pharmacodynamics of the respective drugs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
91 Gene name Transporter SNP Protein Population size (n) Invitro function Ref. Intestinal uptake transporters SLC15A1 PEPT1 p.P586L 44 Reduced Vmax [81] p.F28Y 247 Increased Km [82] Intestinal efflux transporters ABCB1 MDR1 c.571G>A p.G191R N/A Reduced drug resistance [201] c.1199G>A p.S440N N/A Reduced activity (substrate dependent) [202] c.11199G>A c.1199G>t p.S440N p.S440I N/A N/A Increased drug resistance Reduced drug resistance [203] c.1292-3GT>TG p.C431L N/A Reduced drug resistance [204] c.2005C>T p.R669C N/A Reduced substrate affinity [202] c.2547A>G p.I849M N/A Increased transport activity [202] c.2677G>T p.A893S 60 Lower intracellular digoxin accumulation [205] c.2677G>T c.2677G>A p.A893S p.A893T N/A N/A Unchanged Unchanged [206] c.2677G>T p.A893S 46 No change in rhodamine 123 efflux from peripheral blood lymphocytes [207] c.2667G>T p.A893S N/A Reduced transport function [208] c.2667G>T c.2677G>A p.A893S p.A893T N/A N/A Increased transport function Increased transport function [209] c.2667G>T c.2677G>A p.A893S p.A893T N/A N/A Increased activity (substrate dependent) Increased substrate affinity and transportactivity [202] c.2667G>T p.A893S 48 No change in rhodamine 123 efflux activity in peripheral blood mononuclear cells [210] c.2956A>G p.M986V N/A Increased transport activity [202] c.2995G>A p.A999T N/A Increased substrate affinity and transportactivity [202] c.3151C>G p.P1051A N/A Increased transport activity (substratedependent) [202] c.3188G>C p.G1063A N/A Increased transport activity [202] ABCG2 ABCG2 c.34G>A p.V12M N/A Low transport protein expression invitro [211] c.34G>A p.V12M N/A Unchanged [212] c.34G>A p.V12M N/A No change in HEK-293, lowered transport activity in Sf9 cells invitro [213] c.34G>A p.V12M N/A Unchanged [214] c.421C>A p.Q141K N/A Lower transport protein expression, normal transport activity [212] c.421C>A p.Q141K N/A Reduced drug resistance and lower ATPaseactivity [213] c.421C>A p.Q141K N/A Reduced drug extrusion [215] c.421C>A p.Q141K N/A Reduced drug resistance [216] c.421C>A p.Q141K N/A Unchanged [217] c.421C>A p.Q141K N/A No change of intracellular porphyrin accumulation [218] c.421C>A p.Q141K N/A Reduced transport activity [219] c.421C>A p.Q141K N/A Reduced transport activity [55] c.421C>A p.Q141K N/A Increased Km [220] For more information on members of the SLC superfamily of transporters please consult [301] and for more information of ABC transporters please consult [302]. Login to comment
94 Gene name Transporter SNP Protein Population size (n) In vitro function Ref. Intestinal uptake transporters SLC15A1 PEPT1 p.P586L 44 Reduced Vmax [81] p.F28Y 247 Increased Km [82] Intestinal efflux transporters ABCB1 MDR1 c.571G>A p.G191R N/A Reduced drug resistance [201] c.1199G>A p.S440N N/A Reduced activity (substrate dependent) [202] c.11199G>A c.1199G>t p.S440N p.S440I N/A N/A Increased drug resistance Reduced drug resistance [203] c.1292-3GT>TG p.C431L N/A Reduced drug resistance [204] c.2005C>T p.R669C N/A Reduced substrate affinity [202] c.2547A>G p.I849M N/A Increased transport activity [202] c.2677G>T p.A893S 60 Lower intracellular digoxin accumulation [205] c.2677G>T c.2677G>A p.A893S p.A893T N/A N/A Unchanged Unchanged [206] c.2677G>T p.A893S 46 No change in rhodamine 123 efflux from peripheral blood lymphocytes [207] c.2667G>T p.A893S N/A Reduced transport function [208] c.2667G>T c.2677G>A p.A893S p.A893T N/A N/A Increased transport function Increased transport function [209] c.2667G>T c.2677G>A p.A893S p.A893T N/A N/A Increased activity (substrate dependent) Increased substrate affinity and transport activity [202] c.2667G>T p.A893S 48 No change in rhodamine 123 efflux activity in peripheral blood mononuclear cells [210] c.2956A>G p.M986V N/A Increased transport activity [202] c.2995G>A p.A999T N/A Increased substrate affinity and transport activity [202] c.3151C>G p.P1051A N/A Increased transport activity (substrate dependent) [202] c.3188G>C p.G1063A N/A Increased transport activity [202] ABCG2 ABCG2 c.34G>A p.V12M N/A Low transport protein expression in vitro [211] c.34G>A p.V12M N/A Unchanged [212] c.34G>A p.V12M N/A No change in HEK-293, lowered transport activity in Sf9 cells in vitro [213] c.34G>A p.V12M N/A Unchanged [214] c.421C>A p.Q141K N/A Lower transport protein expression, normal transport activity [212] c.421C>A p.Q141K N/A Reduced drug resistance and lower ATPase activity [213] c.421C>A p.Q141K N/A Reduced drug extrusion [215] c.421C>A p.Q141K N/A Reduced drug resistance [216] c.421C>A p.Q141K N/A Unchanged [217] c.421C>A p.Q141K N/A No change of intracellular porphyrin accumulation [218] c.421C>A p.Q141K N/A Reduced transport activity [219] c.421C>A p.Q141K N/A Reduced transport activity [55] c.421C>A p.Q141K N/A Increased Km [220] For more information on members of the SLC superfamily of transporters please consult [301] and for more information of ABC transporters please consult [302]. Login to comment

[hide] Emerging new technologies in Pharmacogenomics: rap... Pharmacol Ther. 2010 Apr;126(1):69-81. Epub 2010 Feb 4. Ishikawa T, Sakurai A, Hirano H, Lezhava A, Sakurai M, Hayashizaki Y
Emerging new technologies in Pharmacogenomics: rapid SNP detection, molecular dynamic simulation, and QSAR analysis methods to validate clinically important genetic variants of human ABC Transporter ABCB1 (P-gp/MDR1).
Pharmacol Ther. 2010 Apr;126(1):69-81. Epub 2010 Feb 4., [PMID:20138191]

Abstract [show]
Pharmacogenomics, the study of the influence of genetic factors on drug action, is increasingly important for predicting pharmacokinetics profiles and/or adverse reactions to drugs. Drug transporters as well as drug-metabolism play pivotal roles in determining the pharmacokinetic profiles of drugs and, by extension, their overall pharmacological effects. There are an increasing number of reports addressing genetic polymorphisms of drug transporters. A key requirement for the development of individualized medicine or personalized therapy is the ability to rapidly and conveniently test patients for genetic polymorphisms and/or mutations. We have recently developed a rapid and cost-effective method for single nucleotide polymorphism (SNP) detection, named Smart Amplification Process 2 (SmartAmp2), which enables us to detect genetic polymorphisms or mutations in 30 to 45min under isothermal conditions without DNA isolation and PCR amplification. Furthermore, high-speed functional screening, quantitative structure-activity relationship (QSAR) analysis, and molecular dynamic (MD) simulation methods have been developed to study the substrate specificity of ABC transporters and to evaluate the effect of genetic polymorphisms on their function and substrate specificity. These methods would provide powerful and practical tools for screening synthetic and natural compounds, and the deduced data can be applied to the molecular design of new drugs. This review addresses such new methods for validating genetic polymorphisms of human ABC transporter ABCB1 (P-gp/MDR1) which is critically involved in the pharmacokinetics of drugs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
478 To functionally validate the non-synonymous polymorphisms of ABCB1 (P-glycoprotein/MDR1) in vitro, we generated SNP variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A; refer to Fig. 6) and expressed them in Sf9 cells. Login to comment
500 SNP Km Vmax Vmax / Km (µM) (nmol/min/mg protein) WT 5.8±2.3 62.4±7.8 10.8 S400N 5.8±2.8 46.7±5.3⁎⁎ 8.0 R492C 5.6±1.9 49.6±10.0⁎ 8.9 R669C 3.2±1.6⁎ 64.7±6.9 20.1 I849M 1.5±0.7⁎⁎ 80.3±9.5⁎⁎ 51.8 A893P 1.5±0.5⁎⁎ 405.2±16.5⁎⁎ 274.6 A893S 11.1±5.4 43.1±7.1⁎⁎ 3.9 A893T 4.3±1.4 98.9±9.5⁎⁎ 22.9 M986V 5.1±1.1 114.9±13.6⁎⁎ 22.5 A999T 2.0±0.8⁎⁎ 143.1±21.2⁎⁎ 70.9 P1051A 6.2±3.0 52.1±13.6 8.4 G1063A 6.2±3.7 117.9±16.4⁎⁎ 19.0 Data are expressed as mean±S.D., n=6. Login to comment
533 The values of those coefficients for WT and SNP variants (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) are shown in Sakurai et al. (2007). Login to comment
476 To functionally validate the non-synonymous polymorphisms of ABCB1 (P-glycoprotein/MDR1) in vitro, we generated SNP variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A; refer to Fig. 6) and expressed them in Sf9 cells. Login to comment
498 SNP Km Vmax Vmax / Km (&#b5;M) (nmol/min/mg protein) WT 5.8&#b1;2.3 62.4&#b1;7.8 10.8 S400N 5.8&#b1;2.8 46.7&#b1;5.3Ìe;Ìe; 8.0 R492C 5.6&#b1;1.9 49.6&#b1;10.0Ìe; 8.9 R669C 3.2&#b1;1.6Ìe; 64.7&#b1;6.9 20.1 I849M 1.5&#b1;0.7Ìe;Ìe; 80.3&#b1;9.5Ìe;Ìe; 51.8 A893P 1.5&#b1;0.5Ìe;Ìe; 405.2&#b1;16.5Ìe;Ìe; 274.6 A893S 11.1&#b1;5.4 43.1&#b1;7.1Ìe;Ìe; 3.9 A893T 4.3&#b1;1.4 98.9&#b1;9.5Ìe;Ìe; 22.9 M986V 5.1&#b1;1.1 114.9&#b1;13.6Ìe;Ìe; 22.5 A999T 2.0&#b1;0.8Ìe;Ìe; 143.1&#b1;21.2Ìe;Ìe; 70.9 P1051A 6.2&#b1;3.0 52.1&#b1;13.6 8.4 G1063A 6.2&#b1;3.7 117.9&#b1;16.4Ìe;Ìe; 19.0 Data are expressed as mean&#b1;S.D., n=6. Login to comment
502 Descriptor Coefficients (95% reliability) for ABCB1 WT and vatiants WT S400N R492C R669C I849M A893P A893S A893T M986V A999T P1051A G1063A M532 24.3 (3.76) 21.2 (5.81) 18.5 (5.87) 35.9 (7.68) 52.7 (11.30) 169.8 (18.84) 14.0 (4.03) 61.2 (7.75) 39.4 (8.76) 63.0 (9.39) 13.9 (4.78) 52.1 (10.94) M132 21.5 (3.89) 14.1 (5.34) 13.6 (5.78) 32.8 (6.89) 61.4 (12.66) 135.6 (22.95) 11.2 (4.06) 52.8 (7.16) 38.2 (8.62) 65.9 (8.44) 7.6 (5.71) 24.3 (10.46) C-CHN-BT 3.3 (0.72) 3.8 (0.95) 1.7 (0.87) 3.5 (1.08) 5.7 (1.55) 11.6 (2.48) 1.2 (0.65) 6.1 (1.29) 7.1 (1.43) 7.3 (1.44) 2.0 (0.66) 2.8 (1.86) ESTR -10.1 (4.93) -12.5 (5.00) OH-Ar -6.4 (4.03) R-CC 16.1 (7.86) -4.4 (1.73) RT -8.9 (4.21) -17.7 (8.22) -O-Ar 5.7 (3.67) D012 5.5 (4.10) G010 -15.4 (9.59) H100 4.9 (3.59) H181 -7.3 (5.04) H421 14.6 (6.84) H521 14.1 (10.42) M113 -5.8 (3.69) -11.7 (5.30) -7.7 (3.70) -22.8 (8.75) -16.4 (8.19) -16.5 (10.58) M232 -14.5 (9.38) M280 4.8 (2.65) M313 -5.2 (3.18) M332 -5.0 (3.11) M370 4.2 (3.14) M372 10.0 (5.46) 14.4 (7.91) M392 73.3 (25.03) 10.3 (6.38) M531 -5.1 (3.05) M540 15.8 (11.27) H7 7.3 (4.01) 24.0 (10.91) H8 10.7 (4.74) L1 -6.7 (2.52) L9 13.8 (6.93) Const. Login to comment
534 The values of those coefficients for WT and SNP variants (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) are shown in Sakurai et al. (2007). Login to comment

[hide] A synonymous polymorphism in a common MDR1 (ABCB1)... Biochim Biophys Acta. 2009 May;1794(5):860-71. Epub 2009 Mar 11. Fung KL, Gottesman MM
A synonymous polymorphism in a common MDR1 (ABCB1) haplotype shapes protein function.
Biochim Biophys Acta. 2009 May;1794(5):860-71. Epub 2009 Mar 11., [PMID:19285158]

Abstract [show]
The MDR1 (ABCB1) gene encodes a membrane-bound transporter that actively effluxes a wide range of compounds from cells. The overexpression of MDR1 by multidrug-resistant cancer cells is a serious impediment to chemotherapy. MDR1 is expressed in various tissues to protect them from the adverse effect of toxins. The pharmacokinetics of drugs that are also MDR1 substrates also influence disease outcome and treatment efficacy. Although MDR1 is a well-conserved gene, there is increasing evidence that its polymorphisms affect substrate specificity. Three single nucleotide polymorphisms (SNPs) occur frequently and have strong linkage, creating a common haplotype at positions 1236C>T (G412G), 2677G>T (A893S) and 3435C>T (I1145I). The frequency of the synonymous 3435C>T polymorphism has been shown to vary significantly according to ethnicity. Existing literature suggests that the haplotype plays a role in response to drugs and disease susceptibility. This review summarizes recent findings on the 3435C>T polymorphism of MDR1 and the haplotype to which it belongs. A possible molecular mechanism of action by ribosome stalling that can change protein structure and function by altering protein folding is discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
152 A study in our lab showed that common polymorphisms of MDR1 at 61ANG (N21D), 307TNC (F103L), 1199GNA (S400N), 2677GNT (A893S) and 2995GNA (A999T) do not change the transport of four MDR1 substrates when expressed at high levels in human cells [66]. Login to comment
151 A study in our lab showed that common polymorphisms of MDR1 at 61ANG (N21D), 307TNC (F103L), 1199GNA (S400N), 2677GNT (A893S) and 2995GNA (A999T) do not change the transport of four MDR1 substrates when expressed at high levels in human cells [66]. Login to comment

[hide] MDR1 gene polymorphisms and clinical relevance. Yi Chuan Xue Bao. 2006 Feb;33(2):93-104. Li YH, Wang YH, Li Y, Yang L
MDR1 gene polymorphisms and clinical relevance.
Yi Chuan Xue Bao. 2006 Feb;33(2):93-104., [PMID:16529292]

Abstract [show]
In vivo and in vitro studies have demonstrated that P-glycoprotein (P-gp) plays a very significant role in the ADME processes (absorption, distribution, metabolism, excretion) and drug-drug interaction (DDI) of drugs in humans. P-gp is the product of multidrug resistance gene (MDR1/ABCB1). Pharmacogenomics and pharmacogenetics studies have revealed that genetic polymorphisms of MDR1 are associated with alteration in P-gp expression and function in different ethnicities and subjects. By now, 50 single nucleotide polymorphisms (SNPs) and 3 insertion/deletion polymorphisms have been found in the MDR1 gene. Some of them, such as C3435T, have been identified to be a risk factor for numerous diseases. It is believed that further understanding of the physiology and biochemistry of P-gp with respect to its genetic variations may be important for individualized pharmacotherapy. Therefore, based on the latest public information and our studies, this review focuses on the following four aspects: 1) the impact of P-gp on pharmacokinetics; 2) MDR1 genetic polymorphisms and their impacts on pharmacogenetics; 3) relationship between altered P-gp expression and function and the MDR1(C3435T) SNP, and 4) relevance of MDR1 polymorphisms to certain human diseases.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 Table 1 Geneticpolymorphismsin MDRl ~~~~~~~~~~ Position Location Effect C-l4SG T-l29C(T12C) C-4T G-IA A61C G.51-2ST G.51-3SC T307C C6/+139C A548G G119YA C1236T c12li44T C1474T TIlJ-76A A 17/+137G C26SOT G2677T A2956G G2995A A3320C C3396T T342l A C343ST T3421A C343ST G4030C A4036G Intron Exon la Exon 1b Exon 2 Exon 2 Exon 2 lntron Intron Exon 5 Intron Exon 7 Exon 11 Exon 12 lntron Exon 13 Intron Intron Exon 21 Exon 21 Exon 21 Exon 24 Exon 24 Exon 26 Exon 26 Exon 26 Exon 26 Exon 28 Exon 26 Non-coding Non-coding Non-coding Non-coding Non-coding Am21Asp Phe103Leu Asnl83Ser Ser400Asn Wobble(Gly412Gly) Arg492Cys Wobble(Leu884Leu) Ala893Thr Ala893Ser Met986Val Ala999Thr Gln1I 07Pro Wobble Serll41Thr Wobble(1le114SIIe) Silent Silent In recent years, most of the MDR1 SNPs were identified, with some resulting in changes in P-gp . Login to comment
47 This SNP is located on the cytoplasmic side just ahead of the first ATP-binding domain'291.C1236T in exon 12, the synonymous polymorphism, is one of the SNPs with the highest freq~encies[~".G2677T/A, a missense mutation in exon 21 that results in an amino acid change from Ala 893 to Ser or Thr, has also been associated with altered P-gp expre~sion"~,~~'.Another polymorphism, G2995A in exon 24 changes Ala 999 to Thr in the second transmembrance domain closer to the ATP-binding domain[361.Finally, MDR is another wobble mutation that doesn't alter the amino acid Ile at the position 1145.The potential functional significance of these polymorphisms can be deduced by pinpointingthem on the domain structureof P-gp. Login to comment
52 Furthermore, Kimchi-Sarfaty and his colleagues carried out a study to characterize the functional consequences of five coding SNPs (Asn21Asp,Phel03Leu, Ser400Asn, Ala893Ser, Ala999Thr) using a vaccinia virus-based transient expression system, but it was found that the distribution and function of P-gp in the cells were similar to wild-type P-gp in the human body'431.The mechanism of these contradictory results regarding the C2677T/A and C3435T polymorphisms function is unclear until now. Login to comment
49 Table 1 Geneticpolymorphismsin MDRl ~~~~~~~~~~ Position Location Effect C-l4SG T-l29C(T12C) C-4T G-IA A61C G.51-2ST G.51-3SC T307C C6/+139C A548G G119YA C1236T c12li44T C1474T TIlJ-76A A 17/+137G C26SOT G2677T A2956G G2995A A3320C C3396T T342l A C343ST T3421A C343ST G4030C A4036G Intron Exon la Exon 1b Exon 2 Exon 2 Exon 2 lntron Intron Exon 5 Intron Exon 7 Exon 11 Exon 12 lntron Exon 13 Intron Intron Exon 21 Exon 21 Exon 21 Exon 24 Exon 24 Exon 26 Exon 26 Exon 26 Exon 26 Exon 28 Exon 26 Non-coding Non-coding Non-coding Non-coding Non-coding Am21Asp Phe103Leu Asnl83Ser Ser400Asn Wobble(Gly412Gly) Arg492Cys Wobble(Leu884Leu) Ala893Thr Ala893Ser Met986Val Ala999Thr Gln1I 07Pro Wobble Serll41Thr Wobble(1le114SIIe) Silent Silent In recent years, most of the MDR1 SNPs were identified, with some resulting in changes in P-gp . Login to comment
58 Another polymorphism, G2995A in exon 24 changes Ala 999 to Thr in the second transmembrance domain closer to the ATP-binding domain[361. Login to comment
64 Furthermore, Kimchi-Sarfaty and his colleagues carried out a study to characterize the functional consequences of five coding SNPs (Asn21Asp,Phel03Leu, Ser400Asn, Ala893Ser, Ala999Thr) using a vaccinia virus-based transient expression system, but it was found that the distribution and function of P-gp in the cells were similar to wild-type P-gp in the human body'431.The mechanism of these contradictory results regarding the C2677T/A and C3435T polymorphisms function is unclear until now. Login to comment

[hide] Pharmacogenetics of the human drug-transporter gen... Drug Discov Today. 2001 Aug 15;6(16):835-839. Brinkmann U, Roots I, Eichelbaum M
Pharmacogenetics of the human drug-transporter gene MDR1: impact of polymorphisms on pharmacotherapy.
Drug Discov Today. 2001 Aug 15;6(16):835-839., [PMID:11495756]

Abstract [show]
The blood- and tissue-concentrations, and thus the activity, of many drugs are influenced by factors that are subject to inter-individual variation. Variables that influence blood levels are metabolizing enzymes and transporters. Transporters control drug uptake, distribution and elimination. Transport by efflux pumps such as MDR1-encoded P-glycoprotein can influence the bioavailability of drugs. Knowledge of the transporter 'status' might allow for compensation of differences in drug uptake, such as by dose adjustment, which is important for drugs with narrow therapeutic windows. So far, intestinal expression of MDR1 has been determined by cumbersome methods, such as biopsies, although recently a functional polymorphism has been identified, which discriminates individual high or low-expressor alleles. As a result, clinical trials and therapy can be adapted to the 'MDR1-status' of individual patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
68 Single nucleotide polymorphisms (SNPs) in the MDR1 gene SNP Region Number Frequency of SNPsa [%] Effect Heterozygous Homozygous Observed Estimated T-12C E1 85 11.8 0 0.4 Non-coding G-1A E2 188 11.2 0 0.4 Translation initiation A61G E2 188 17.6 0.5 0.81 Asn21Asp G-25T I4 85 26.0 3.5 2.3 G-35C I4 85 1.2 0 0.01 T307C E5 85 1.2 0 0.01 Phe103Leu C+139T I5 85 48.2 16.5 16.8 C+145T I5 85 2.4 0 0.01 G1199A E11 85 12.9 0 0.4 Ser400Asn C1236T E12 188 48.9 13.3 14.4 Gly412Gly C+44T I12 188 11.7 0 0.4 T-76A I16 85 45.9 22.4 20.3 A+137G I17 85 1.2 0 0.01 G2677T E21 83b 43.4 42.2 38.4 Ala893Ser G2995A E24 36b 11.1 0 Ala999Thr C3435T E26 537 47.7 26.4 24.1 Ile1145Ile C3396T E26 188 0.53 0 0.01 Wobble aMDR1 sequences Genbank (gb) accession numbers AC002457 and AC005068 are defined as wildtype. Login to comment