126 In addition to the possible decrease in expression levels, ATPase activity in the ABCG2 +24 Intron 20 G A +40 Intron 20 C T 2547 Exon 21 A G 849 Ile to Met 2650 Exon 21 C T 884 Syn 2677 Exon 21 G T 893 Ala to Ser 2677# Exon 21 G A 893 Ala to Thr +31 Intron 22 G A 2956 Exon 24 A G 986 Met to Val 2995 Exon 24 G A 999 Ala to Thr 3151 Exon 25 C G 1051 Pro to Ala 3320 Exon 26 A C 1107 Gln to Pro 3322 Exon 26 T C 1108 Trp to Arg 3396 Exon 26 C T 1132 Syn 3421 Exon 26 T A 1141 Ser to Thr 3435** Exon 26 C T 1145 Syn 3751 Exon 28 G A 1251 Val to Ile 3767 Exon 28 C A 1256 Thr to Lys 4030 Exon 28 G C Non-coding 4036 Exon 28 A G Non-coding +21 Intron 28 T C Table 2. Summary of common genetic variants in the ABCB1 gene (continued) *cDNA numbers are relative to the ATG site and based on the cDNA sequence from GenBank accession number M14758 with an A as the reference at position 43.

X

ABCB1 p.Ala999Thr 15882131:126:313

status: NEW

Login to comment

94 Kimchi-Sarfaty et al. [73] assessed the five most common coding SNPs (i.e., N21D, F103L, S400N, A893S and A999T) by using a vaccinia virus-based transient expression system.

X

ABCB1 p.Ala999Thr 16259577:94:106

status: NEW

Login to comment
115 For this purpose, ABCB1 cDNA cloned from a human liver cDNA library was prepared, and several variant forms (i.e., N183S, S400N, R492C, R669C, I849M, A893T, M986V, A999T, P1051A and G1063A) were generated by site-directed mutagenesis.

X

ABCB1 p.Ala999Thr 16259577:115:164

status: NEW

Login to comment
124 The variant forms (i.e., N183S, S400N, R492C, R669C, I849M, A893T, M986V, A999T, P1051A and G1063A), as well as the wild type, of ABCB1 exhibited the verapamil-enhanced ATPase activity.

X

ABCB1 p.Ala999Thr 16259577:124:74

status: NEW

Login to comment
129 N21D M89T N44S H2N F103L E108K N183S G185V I261V S400N R492C A599T L662R R669C V801M A893S/T I829V I849M M986V A999T G1063A P1051A Q1107P W1108R I1145M S1141T V1251I T1256K COOH ATP-binding site ATP-binding site EXTRACELLULAR INTRACELLULAR A80E Figure 2.

X

ABCB1 p.Ala999Thr 16259577:129:111

status: NEW

Login to comment
139 The I849M and A999T variants had Km values lower than that of wild-type ABCB1, whereas the Km value of the N183S variant was higher.

X

ABCB1 p.Ala999Thr 16259577:139:14

status: NEW

Login to comment

167 For this purpose, we have prepared several variant forms (i.e., N183S, S400N, R492C, R669C, I849M, A893T, M986V, A999T, P1051A, and G1063A) by site‐ directed mutagenesis.

X

ABCB1 p.Ala999Thr 16399366:167:113

status: NEW

Login to comment

706 Mickley et al. (1998) discovered 2 non-synonymous SNP, a 2677G>T transversion in exon 21 and a 2995G>A transition in exon 24 of ABCB1 leading to an A893S and A999T exchanges, respectively.

X

ABCB1 p.Ala999Thr 16766035:706:158

status: NEW

Login to comment

124 Moreover, Letourneau et al. examined 10 non-synonymous ABCC1 SNPs to determine Table 2 Summary of genetic variants in ABC transporters ABCB1, ABCC1, ABCC2 and ABCG2 involved in cancer chemotherapy Variants (location, effect) Phenotype Drug Sample Reference ABCB1 +103T>C (5'flanking, non-coding) Increased transcription Doxorubicin vincristine osteosarcoma Stein et al., 1994 [19] +8T>C (5'flanking, non-coding) Unknown Leukemia Rund et al., 1999 [21] 1236C>T (exon12, synonymous) Higher expression AML blasts Illmer et al., 2002 [47] Lower clearance Irinotecan Cancer patients Sai et al., 2003 [44] Higher exposure Irinotecan, SN-38 Cancer patients Mathijssen et al., 2003 [45] 2677G>T/A (exon21, A893S/T) Lower expression placenta Tanabe et al., 2001 [42] Lower expression placenta Hitzl et al., 2004 [37] Higher expression AML blasts Illmer et al., 2002 [47] Allele specific expression Cell lines, lymphoma Mickley et al., 1998 [22] Lower clearance Irinotecan Cancer patients Sai et al., 2003 [44] Survival leukemia Illmer et al., 2002 [47] Survival leukemia van den Heuvel-Eibrink et al., 2001 [48] Worse survival AML blasts Kim et al., 2006 [10] Higher efficacy Paclitaxel Ovarian cancer Green et al., 2006 [50] 2995G>A (exon24, A999T) None Cell lines, lymphoma Mickley et al., 1998 [22] 3435C>T (exon26, synonymous) Lower expression Duodenal protein Hoffmeyer et al., 2000 [26] Lower expression placenta Hitzl et al., 2004 [37] Higher expression Intestine mRNA Nakamura et al., 2002 [32] Higher expression AML blasts Illmer et al., 2002 [47] Lower clearance Irinotecan Cancer patients Sai et al., 2003 [44] Lower efflux Digoxin CD56+ NK cells Hitzl et al., 2001 [27] Higher plasma level Digoxin Healthy volunteers Hoffmeyer et al., 2000 [26] Higher AUC Cyclosporin transplant patients Bonhomme-Faivre et al., 2004 [36] Lower CNS relapse Cancer patients Stanulla et al., 2005 [46] Better survival leukemia Illmer et al., 2002 [47] Higher efficacy Breast cancer Kafka et al., 2003 [49] Higher activity, worse survival AML Kim et al., 2006 [10] Better survival Platinums Esophageal cancer Wu et al., 2006 [43] No difference Docetaxel patients Puisset et al., 2004 [41] No difference Irinotecan Cancer patients Mathijssen et al., 2004 [39] No difference Vincristine patients Plasschaert et al., 2004 [40] No difference colon Taniguchi et al., 2003 [24] ABCC1 -260G>C (5'flanking, non-coding) Higher activity Transfected cell line Wang et al., 2005 [62] Table 2 (Continued) Variants (location, effect) Phenotype Drug Sample Reference 128G>C (exon2, C43S) Reduced resistance Vincristine, arsenite Transfected cell line Leslie et al., 2003 [60] 1299G>T (exon10, R433S) Reduced transport of LTC4, increased resistance to doxorubicin Leukotriene C4, doxorubicin Transfected cell line Conrad et al., 2002 [59] 2012G>T (exon16, G671V) No change in activityLeukotriene C4 Transfected cell line Conrad et al., 2001 [58] Heart toxicity Doxorubicin nLon-Hodgkin lymphoma Wojnowski et al., 2005 [63] 2965G>A (exon22, A989T) Reduced transport Estradiol 17β-glucuronide Transfected cell line Letourneau et al., 2005 [61] ABCC2 1271A>G (exon10, R421G) Reduced drug elimination, increased nephrotoxicity Methotrexate One lymphoma patient Hulot et al., 2005 [79] 3972C>T (exon28, nonsynonymous) Reduced drug clearance Irinotecan Cancer patients Innocenti et al., 2004 [80] ABCG2 376C>T (exon4, Q126stop) Reduced transport Porphyrin Trensfected cell Tamura et al., 2006 [104] 421C>A (exon5, Q141K) Lower expression Transfected cell lines Imai et al., 2002 [94] Lower expression Transfected cell lines Kondo et al., 2004 [95] Lower expression Placenta Kobayashi et al., 2005 [98] Reduced ATPase activity Trensfected cell lines Mizuarai et al., 2004 [97] Higher plasma levels Diflomotecan patients Sparreboom et al., 2004 [100] Increased bioavailability Topotecan patients Sparreboom et al., 2005 [101] Increased bioavailability 9-Aminocamptothecin patients Zamboni et al., 2006 [81] Increased drug accumulation Imatinib Transfected cell lines Gardner et al., 2006 [96] Increased drug accumulation Topotecan Trensfected cell lines Imai et al., 2002 [94] No difference Imatinib patients Gardner et al., 2006 [96] No difference intestine Zamber et al., 2003 [99] No difference MTX Trensfected cell lines Kondo et al., 2004 [95] the effects on expression and function of this transporter in transfected HEK293T cells [61].

X

ABCB1 p.Ala999Thr 17323126:124:1236

status: NEW

Login to comment
57 2677G>T in exon 21 and 2995G>A/T in exon 24 were reported by Mickley et al. [22], leading to amino acid changes of A893S and A999T, respectively.

X

ABCB1 p.Ala999Thr 17323126:57:125

status: NEW

Login to comment

97 SNP Region N Frequency of SNPs (%) Effect Heterozygous Homozygous Observed Estimated T-12C E1 85 11.8 0 0.4 Non-coding G-1A E2 188 11.2 0 0.4 TL initiation A61G E2 188 17.6 0.5 0.81 Asn21Asp G-25T I4 85 26 3.5 2.3 G-35C I4 85 1.2 0 0.01 # T307C E5 85 1.2 0 0.01 Phe103Leu C+139T I5 85 48.2 16.5 16.8 C+145T I5 85 2.4 0 0.01 G1199A E11 85 12.9 0 0.4 Ser400Asn C1236T E12 188 48.9 13.3 14.4 Gly412Gly # C+44T I12 188 11.7 0 0.4 T-76A I16 85 45.9 22.4 20.3 A+137G I17 85 1.2 0 0.01 G2677T E21 83b 43.4 42.2 38.4 Ala893Ser G2995A E24 36b 11.1 38.4 Ala999Thr C3435T E26 537 47.7 26.4 24.1 Ile1145Ile C3396T E26 188 0.53 0 0.01 Wobble § MDR1 sequences gb:AC002457 and AC005068 are defined as 'wild type`.

X

ABCB1 p.Ala999Thr 11258197:97:544

status: NEW

Login to comment

60 In a Northern Italian population, the extent of linkage disequilibrium TABLE 2 Summary of MDR1 genetic variants in different ethnic groups Location Position Allele Effect Reference promotor 5 flanking/-41a A (28) G exon 1a exon 1a/-145 C (28) G exon 1b exon 1b/-129 T (25, 33) C intron 1 exon 2/-4 C (29) T intron 1 exon 2/-1 G initiation of translation (25, 27, 29) A exon 2 exon 2/61 A Asn21Asp (25-27, 29) G intron 4 exon 5/-35 G (25) C intron 4 exon 5/-25 G (25) T exon 5 exon 5/307 T Phe103Leu (25) C intron 6 exon 6/+139 C (25, 27) T intron 6 exon 6/+145 C (25) T exon 7 exon 7/548 A Asn183Ser (29) G exon 11 exon 11/1199 G Ser400Asn (25, 27, 29) A exon 12 exon 12/1236 C wobble (23, 25, 27, 29) T (Gly412Gly) intron 12 exon 12/+44 C (25, 27) T exon 13 exon 13/1474 C Arg492Cys (29) T intron 16 exon 17/-76 T (25, 27) A intron 17 exon 17/137 A (25) G exon 21 exon 21/2650 C wobble (29) T (Leu884Leu) (Continued ) TABLE 2 (Continued) Location Position Allele Effect Reference exon 21 exon 21/2677 G (22, 23, 27, 29) T Ala893Ser A Ala893Thr exon 24 exon 24/2956 A Met986Val (33) G exon 24 exon 24/2995 G Ala999Thr (22) A exon 26 exon 26/3320 A Gln1107Pro (27) C exon 26 exon 26/3396 C wobble (25) T exon 26 exon 26/3421 T Ser1141Thr (29, 30) A exon 26 exon 26/3435 C wobble (23, 25, 29) T (Ile1145Ile) exon 28 exon 28/4030 G (33) C exon 28 exon 28/4036 A (23, 33) G The positions of the polymorphisms correspond to positions of MDR1 cDNA with the first base of the ATG start codon set to 1 (GenBank accession # M14758).

X

ABCB1 p.Ala999Thr 12359865:60:1113

status: NEW

Login to comment
73 Both polymorphisms, G2677T/A and G2995A, resulting in amino acid exchanges in exon 21 (Ala893Ser/Thr) and exon 24 (Ala999Thr), respectively, are located in the second transmembrane domain, the exon G2995A polymorphism closer to the ABC domain.

X

ABCB1 p.Ala999Thr 12359865:73:115

status: NEW

Login to comment
86 However, a recent publication characterized the functional consequences of five coding SNPs (Asn21Asp, Phe103Leu, Ser400Asn, Ala893Ser, Ala999Thr) using a vaccinia virus-based transient expression system (40a).

X

ABCB1 p.Ala999Thr 12359865:86:136

status: NEW

Login to comment

56 In 2001, Hitzl et al. also indicated that healthy Caucasian subjects with T/T3435 had a more decreased efflux of rhodamine from CD56ϩ NK cells and a lower MDR1 mRNA expression in leukocytes than those with C/C3435 .65) In renal tissues, the C3435T polymorphism is reported to be associated with reduced MDR1 expression.31) However, Tanabe et al. suggested that C3435T had no effect on the placental MDR1 expression based on 89 subjects and Western blotting.53) We determined MDR1 mRNA levels in biopsy specimens of the duodenum obtained from 13 healthy Japanese subjects by real time quantitative RT-PCR and found that MDR1 mRNA expression was higher in T/T3435 than C/C3435 or C/T3435 (Fig. 1).66) The discrepancies between the reports might be ex- November 2002 1393 Table 2. Summary of Genetic Polymorphisms in MDR1 Position Location Effect A1a/-41G Intron Noncoding C-145G Exon 1a Noncoding T-129C (T12C) Exon 1b Noncoding C-4T Exon 2 Noncoding G-1A Exon 2 Noncoding A61G Exon 2 Asn21Asp G5/-25T Intron G5/-35C Intron T307C Exon 5 Phe103Leu C6/ϩ139T Intron A548G Exon 7 Asn183Ser G1199A Exon 11 Ser400Asn C1236T Exon 12 Silent C12/ϩ44T Intron C1474T Exon 13 Arg492Cys T17/-76A Intron A17/ϩ137G Intron C2650T Exon 21 Silent G2677(A,T) Exon 21 Ala893Thr (G2677A) Ala893Ser (G2677T) A2956G Exon 24 Met986Val G2995A Exon 24 Ala999Thr A3320C Exon 26 Gln1107Pro C3396T Exon 26 Silent T3421A Exon 26 Ser1141Thr C3435T Exon 26 Silent G4030C Exon 28 Silent A4036G Exon 28 Silent This list was based on the literature (refs. 49-54).

X

ABCB1 p.Ala999Thr 12419946:56:1348

status: NEW

Login to comment

51 [58] und Mickley et al. [40] wiesen 2 weitere Basenaustausche G2677T im Exon 21 und G2995AimExon24nach,diezudenAmi- nosäureaustauschen Ala893Ser und Ala999Thr führen.MDR1 liegt auf Chro- mosom7q21.1,umfasst28Exonsundweist eine cDNA-Länge von 3843 Basenpaaren auf.

X

ABCB1 p.Ala999Thr 12674742:51:154

status: NEW

Login to comment

75 Position Location Effect A1a/-41G Intron Non-coding C-145G Exon 1a Non-coding T-129C (T12C) Exon 1b Non-coding C-4T Exon 2 Non-coding G-1A Exon 2 Non-coding A61G Exon 2 Asn21Asp G5/-25T Intron G5/-35C Intron T307C Exon 5 Phe103Leu C6/+139T Intron A548G Exon 7 Asn183Ser G1199A Exon 11 Ser400Asn C1236T Exon 12 Silent C12/+44T Intron C1474T Exon 13 Arg492Cys T17/-76A Intron A17/+137G Intron C2650T Exon 21 Silent G2677(A,T) Exon 21 Ala893Thr (G2677A) Ala893Ser (G2677T) A2956G Exon 24 Met986Val G2995A Exon 24 Ala999Thr A3320C Exon 26 Gln1107Pro C3396T Exon 26 Silent T3421A Exon 26 Ser1141Thr C3435T Exon 26 Silent G4030C Exon 28 Silent A4036G Exon 28 Silent See references [34-39].

X

ABCB1 p.Ala999Thr 12831320:75:510

status: NEW

Login to comment

85 Kioka et al. (1989) showed a slight increase in resistance to doxorubicin, but no effect on colchicine or vinblastine Table 2 Common MDR1 exonic polymorphisms Exon number Polymorphic nucleotide variant Change in amino acid References 1 À145 - Ito et al. (2001) 1 À129 - Hoffmeyer et al. (2000); Tanabe et al. (2001) 2 61 N21D Cascorbi et al. (2001); Decleves et al. (2000); Hoffmeyer et al. (2000); Kim et al. (2001) 5 307 F103L Hoffmeyer et al. (2000) 7 548 N183S Kim et al. (2001) 10 1107 G369P Hoffmeyer et al. (2000) 11 1199 S400N Cascorbi et al. (2001); Hoffmeyer et al. (2000); Kim et al. (2001) 12 1236 Wobble Cascorbi et al. (2001); Hoffmeyer et al. (2000); Kim et al. (2001); Kioka et al. (1989) 13 1474 R492C Kim et al. (2001) 21 2650 Wobble Kim et al. (2001) 21 2677 893A, S, or T Cascorbi et al. (2001); Kim et al. (2001); Kioka et al. (1989); Mickley et al. (1998) 24 2956 M986V Tanabe et al. (2001) 24 2995 A999T Mickley et al. (1998) 26 3320 Q1107P Cascorbi et al. (2001) 26 3396 Wobble Hoffmeyer et al. (2000) 26 3421 S1141T Kim et al. (2001) 26a 3435 Wobble Hoffmeyer et al. (2000); Kim et al. (2001); Kioka et al. (1989) 28 4030 - Tanabe et al. (2001) 28 4036 - Kioka et al. (1989); Tanabe et al. (2001) a The only polymorphism that correlates with changes in drug delivery and disposition P-glycoprotein SV Ambudkar et al resistance in the SNP located on exon 21, position 2677, Ser893 (Kioka et al., 1989).

X

ABCB1 p.Ala999Thr 14576852:85:931

status: NEW

Login to comment

75 Summary of genetic polymorphisms in MDR1 Location Position Mutation Effect Mutant allele frequency (%) Hoffmeyer et al89 : C Cascorbi et al90 : C Siegmund et al91 : C Promotor 5' flanking/-41 A/G Noncoding Exon 1a Exon 1a/-145 C/G Noncoding Exon 1b Exon 1b/-129 T/C Noncoding 5.9 Intron 1 Exon 2/-4 C/T Noncoding Intron 1 Exon 2/-1 G/A Initial translation 5.6 9 3.7 Exon 2 Exon 2/61 A/G Asn21Asp 9.3 11.2 8.9 Intron 4 Exon 5/-35 G/C 0.6 Intron 4 Exon 5/-25 G/T 16.5 Exon 5 Exon 5/307 T/C Phe103Leu 0.6 0 Intron 6 Exon 6/ϩ139 C/T 40.6 37.2 35.8 Intron 6 Exon 6/ϩ145 C/T 1.2 Exon 7 Exon 7/548 A/G Asn183Ser Exon 11 Exon 11/1199 G/A Ser400Asn 6.5 5.5 2.9 Exon 12 Exon 12/1236 C/T Silent 37.8 41 34.3 Intron 12 Exon 12/ϩ44 C/T 5.9 4.9 7.5 Exon 13 Exon 13/1474 C/T Arg492Cys Intron 16 Exon 17/-76 T/A 45.3 46.2 49.3 Intron 17 Exon 17/ϩ137 A/G 0.6 Exon 21 Exon 21/2650 C/T Silent Exon 21 Exon 21/2677 G/T Ala893Ser 41.6 40.3 G/A Ala893Thr 1.9 3.7 Exon 24 Exon 24/2956 A/G Met986Val Exon 24 Exon 24/2995 G/A Ala999Thr Exon 26 Exon 26/3320 A/C Gln1107Pro 0.2 Exon 26 Exon 26/3396 C/T Silent 0.3 Exon 26 Exon 26/3421 T/A Ser1141Thr Exon 26 Exon 26/3435 C/T Silent 48.1 53.9 50.7 Exon 28 Exon 28/4030 G/C Exon 28 Exon 28/4036 A/G The positions of the polymorphisms were established with the first base of the ATG start codon set to 1.

X

ABCB1 p.Ala999Thr 14749689:75:1025

status: NEW

Login to comment

127 Position Location Effect A1a/-41G intron noncoding C-145G exon 1a noncoding T-129C (T12C) exon 1b noncoding C-4T exon 2 noncoding G-1A exon 2 noncoding A61G G5/-25T G5/-35C exon 2 intron intron Asn21Asp T307C C6/+139T exon 5 intron Phe103Leu A548G exon 7 Asn183Ser G1199A exon 11 Ser400Asn C1236T C12/+44T exon 12 intron silent C1474T T17/-76A A17/+137G exon 13 intron intron Arg492Cys C2650T exon 21 silent G2677(A,T) exon 21 Ala893Thr (G2677A) Ala893Ser (G2677T) A2956G exon 24 Met986Val G2995A exon 24 Ala999Thr A3320C exon 26 Gln1107Pro C3396T exon 26 silent T3421A exon 26 Ser1141Thr C3435T exon 26 silent G4030C exon 28 silent A4036G exon 28 silent The list was based on the reports [67,68,71-74].

X

ABCB1 p.Ala999Thr 15379652:127:505

status: NEW

Login to comment

18 Much eŠort has been taken to uncover polymorphisms in the ABCB1WMDR1 gene since a synonymous SNP, which correlated with diminished MDR1 expression levels in the human duodenum, was reported by HoŠmeyer et al.7) To date, information on 19 single nucleotide polymorphisms (SNPs) including 7 nonsynonymous ones (N21D, F103L, S400N, A893S, A893T, A999T and Q1107P) for ABCB1WMDR1 have been reported in Caucasians.8,9) ABCB1WMDR1 gene SNPs including intronic10) and 2 nonsynonymous SNPs (E108K, M986V)11,12) were also reported in Japanese population.

X

ABCB1 p.Ala999Thr 15618713:18:353

status: NEW

Login to comment
78 Moreover, the reported nonsynonymous polymorphisms, N21D, F103L, S400N, A893S and A999T have been shown not to substantially aŠect the activity of P-glycoprotein14) .

X

ABCB1 p.Ala999Thr 15618713:78:82

status: NEW

Login to comment

123 Location Position Mutation Effect Promoter 5`/-41 A→G Noncoding Exon 1a Exon 1a/-145 C→G Noncoding Exon 1b Exon 1b/-129 T→C Noncoding Intron 1 Exon 2/-4 C→T Noncoding Intron 1 Exon 2/-1 G→A Initiation of translation Exon 2 Exon 2/61 A→G Asn21Asp Intron 4 Exon 5/-35 G→C Intron 4 Exon 5/-25 G→T Exon 5 Exon 5/307 T→C Phe103Leu Intron 6 Exon 6/+139 C→T Intron 6 Exon 6/+145 C→T Exon 7 Exon 7/548 A→G Asn183Ser Exon 11 Exon 11/1119 G→A Ser400Asn Exon 12 Exon 12/1236 C→T Silent base change Intron 12 Exon 12/+44 C→T Exon 13 Exon 13/1474 C→T Arg492Cys Intron 16 Exon 17/-76 T→A Intron 17 Exon 17/+137 A→G Exon 21 Exon 21/2650 C→T Silent base change Exon 21 Exon 21/2677 G→T G→A Ala893Ser Ala893Thr Exon 24 Exon 24/2956 A→G Met986Val Exon 24 Exon 24/2995 G→A Ala999Thr Exon 26 Exon 26/3320 A→C Gln1107Pro Exon 26 Exon 26/3396 C→T Silent base change Exon 26 Exon 26/3421 T→A Ser1141Thr Exon 26 Exon 26/3435 C→T Silent base change Exon 28 Exon 28/4030 G→C Exon 28 Exon 28/4036 A→G The positions of the polymorphism are from the first base of the ATG start codon set to 1.

X

ABCB1 p.Ala999Thr 16370938:123:915

status: NEW

Login to comment

29 Representative genetic polymorphisms in MDR1 Position Location EŠect A1aW-41G intron noncoding C-145G exon 1a noncoding T-129C (T12C) exon 1b noncoding C-4T exon 2 noncoding G-1A exon 2 noncoding A61G exon 2 Asn21Asp G5W-25T intron G5W-35C intron T307C exon 5 Phe103Leu C6W＋139T intron C6W＋145T intron A548G exon 7 Asn183Ser G1199A exon 11 Ser400Asn C1236T exon 12 silent C12W＋44T intron C1474T exon 13 Arg492Cys T17W-76A intron A17W＋137G intron C2650T exon 21 silent G2677A,T exon 21 Ala893Thr (G2677A) Ala893Ser (G2677T) A2956G exon 24 Met986Val G2995A exon 24 Ala999Thr A3320C exon 26 Gln1107Pro C3396T exon 26 silent T3421A exon 26 Ser1141Thr C3435T exon 26 silent G4030C exon 28 silent A4036G exon 28 silent See references 27, 32-36.

X

ABCB1 p.Ala999Thr 16415525:29:597

status: NEW

Login to comment

1 To functionally validate the nonsynonymous polymorphisms of ABCB1 (P-glycoprotein/MDR1) in vitro, we generated SNP variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) and expressed them in Sf9 cells.

X

ABCB1 p.Ala999Thr 17559192:1:192

status: NEW

Login to comment
38 For this purpose, ABCB1 cDNA cloned from a human liver cDNA library was prepared, and several variant forms (i.e., S400N, R492C, R669C, I849M, A893S, A893T, A893P, M986V, A999T, P1051A, and G1063A) were generated by site-directed mutagenesis.

X

ABCB1 p.Ala999Thr 17559192:38:171

status: NEW

Login to comment
53 SNP data were obtained from the NCBI dbSNP database and recent publications: S400N (6, 7, 29, 31); R492C (7); R669C (16); I849M (16); A893P (NCBI dbSNP, rs2032582); A893S (8, 16, 23, 29-31); A893T (8, 16, 23, 29-31); M986V (30); A999T (28); P1051A (16); G1063A (NCBI dbSNP, rs2707944).

X

ABCB1 p.Ala999Thr 17559192:53:229

status: NEW

Login to comment
80 Briefly, seventy-two hours after Table 1: Data on Oligonucleotide Primers Used for Site-Directed Mutagenesis and Experimental Conditionsa SNP amino acid cDNA F/R primers primer sequence (5' f 3') primer length (bases) % GC Tm (°C) S400N 1199G > A F CAGAAATGTTCACTTCAATTACCCATCTCGAAAAG 35 36.5 77.2 R CTTTTCGAGATGGGTAATTGAAGTGAACATTTCTG 35 36.5 77.2 R492C 1474C > T F TGAAAACATTCGCTATGGCTGTGAAAATGTCACCATGG 38 42.1 81.0 R CCATGGTGACATTTTCACAGCCATAGCGAATGTTTTCA 38 42.1 81.0 R669C 2005C > T F TCTAATAAGAAAAAGATCAACTTGTAGGAGTGTCCGTGGATC 42 37.9 80.9 R GATCCACGGACACTCCTACAAGTTGATCTTTTTCTTATTAGA 42 37.9 80.9 I849M 2547A > G F GGGACAGGAATAATTATGTCCTTCATCTATGGTTGGCA 38 34.5 77.9 R TGCCAACCATAGATGAAGGACATAATTATTCCTGTCCC 38 34.5 77.9 A893P 2677G > C F AGAAAGAACTAGAAGGTCCTGGGAAGATCGCTAC 34 47.1 80.9 R GTAGCGATCTTCCCAGGACCTTCTAGTTCTTTCT 34 47.1 80.9 A893S 2677G > T F GAAAGAACTAGAAGGTTCTGGGAAGATCGCTAC 33 45.4 79.6 R GTAGCGATCTTCCCAGAACCTTCTAGTTCTTTC 33 45.4 79.6 A893T 2677G > A F GAAAGAACTAGAAGGTACTGGGAAGATCGCTAC 33 45.4 79.6 R GTAGCGATCTTCCCAGTACCTTCTAGTTCTTTC 33 45.4 79.6 M986V 2956A > G F GTCTTTGGTGCCGTGGCCGTGGGGC 25 73.8 84.7 R GCCCCACGGCCACGGCACCAAAGAC 25 73.8 84.7 A999T 2995G > A F GTTCATTTGCTCCTGACTATACCAAAGCCAAAATATCAGCAG 42 40.5 82.0 R CTGCTGATATTTTGGCTTTGGTATAGTCAGGAGCAAATGAAC 42 40.5 82.0 P1051A 3151C > G F CGACCGGACATCGCAGTGCTTCAGGG 26 60.0 80.1 R CCCTGAAGCACTGCGATGTCCGGTCG 26 60.0 80.1 G1063A 3188G > C F GAGGTGAAGAAGGCCCAGACGCTGGCTC 28 64.3 83.7 R GAGCCAGCGTCTGGGCCTTCTTCACCTC 28 64.3 83.7 a F, forward; R, reverse.

X

ABCB1 p.Ala999Thr 17559192:80:1176

status: NEW

Login to comment
142 On the basis of the ABCB1 (WT) cDNA cloned from a human liver cDNA library, those variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) were generated by site-directed mutagenesis as described in Experimental Procedures.

X

ABCB1 p.Ala999Thr 17559192:142:159

status: NEW

Login to comment
180 Figure 3 depicts the verapamil-stimulated ATPase activity of ABCB1 WT, S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A, where the verapamil-stimulated ATPase activities are normalized by considering the ABCB1 protein amounts.

X

ABCB1 p.Ala999Thr 17559192:180:127

status: NEW

Login to comment
186 Sf9 plasma membranes (2 µg of protein) expressing ABCB1 WT and variants (S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) were incubated with ATP (2 mM) and verapamil at different concentrations (0, 1, 2, 5, 10, 20, 50, and 100 µM) at 37 °C for 30 min. After the incubation, the amount of liberated phosphate was measured as described in Experimental Procedures. All activities are expressed as mean values ( SD (n ) 6).

X

ABCB1 p.Ala999Thr 17559192:186:134

status: NEW

Login to comment
187 Table 2: Km and Vmax Values for ATPase Activity of ABCB1 WT and Variants toward Verapamila SNP Km (µM) Vmax [nmol min-1 (mg of protein)-1 ] Vmax/Km WT 5.8 ( 2.3 62.4 ( 7.8 10.8 S400N 5.8 ( 2.8 46.7 ( 5.3** 8.0 R492C 5.6 ( 1.9 49.6 ( 10.0* 8.9 R669C 3.2 ( 1.6* 64.7 ( 6.9 20.1 I849M 1.5 ( 0.7** 80.3 ( 9.5** 51.8 A893P 1.5 ( 0.5** 405.2 ( 16.5** 274.6 A893S 11.1 ( 5.4 43.1 ( 7.1** 3.9 A893T 4.3 ( 1.4 98.9 ( 9.5** 22.9 M986V 5.1 ( 1.1 114.9 ( 13.6** 22.5 A999T 2.0 ( 0.8** 143.1 ( 21.2** 70.9 P1051A 6.2 ( 3.0 52.1 ( 13.6 8.4 G1063A 6.2 ( 3.7 117.9 ( 16.4** 19.0 a Data are expressed as mean ( SD, n ) 6.

X

ABCB1 p.Ala999Thr 17559192:187:460

status: NEW

Login to comment
189 Table 3: Km and Vmax Values for ATPase Activity of ABCB1 WT and Variants toward Nicardipinea SNP Km (µM) Vmax [nmol min-1 (mg of protein)-1 Vmax/Km WT 1.1 ( 0.6 45.2 ( 8.7 41.0 S400N 1.7 ( 0.8 39.1 ( 9.1 23.4 R492C 1.1 ( 0.5 46.6 ( 6.4 43.5 R669C 0.3 ( 0.3** 53.5 ( 13.1 164.6 I849M 0.8 ( 0.9 80.2 ( 9.6** 102.9 A893P 0.1 ( 0.0** 341.2 ( 36.6** 4858.4 A893S 2.0 ( 0.6 39.2 ( 6.0 19.5 A893T 0.4 ( 0.2** 77.0 ( 16.9** 207.8 M986V 0.7 ( 0.4 89.7 ( 17.7** 129.9 A999T 0.3 ( 0.3** 115.4 ( 21.2** 393.6 P1051A 0.9 ( 0.3 33.1 ( 8.8* 36.3 G1063A 0.8 ( 0.4 93.2 ( 27.6** 121.4 a Data are expressed as mean ( SD, n ) 6.

X

ABCB1 p.Ala999Thr 17559192:189:463

status: NEW

Login to comment
240 On the other hand, the benzene structure linked to the other ring by a single or double bond (CFC ) M113) negatively contributed to the drug-stimulated ATPase activity of M986V, G1063A, A999T, S400N, and A893S variants and WT, whereas the activity of the other variants was not affected by this structural component.

X

ABCB1 p.Ala999Thr 17559192:240:186

status: NEW

Login to comment
269 The present study addresses the impact of nonsynonymous polymorphisms of ABCB1 (i.e., S400N, R492C, R669C, I849M, A893S, A893T, A893P, M986V, A999T, P1051A, and G1063A) on its function.

X

ABCB1 p.Ala999Thr 17559192:269:142

status: NEW

Login to comment
273 Table 5: ABCB1 WT and Variant-Specific Descriptors and Corresponding Coefficients Deduced from QSAR Analysisa coefficients (95% reliability) for ABCB1 WT and vatiants descriptor WT S400N R492C R669C I849M A893P A893S A893T M986V A999T P1051A G1063A M532 24.3 21.2 18.5 35.9 52.7 169.8 14.0 61.2 39.4 63.0 13.9 52.1 (3.76) (5.81) (5.87) (7.68) (11.30) (18.84) (4.03) (7.75) (8.76) (9.39) (4.78) (10.94) M132 21.5 14.1 13.6 32.8 61.4 135.6 11.2 52.8 38.2 65.9 7.6 24.3 (3.89) (5.34) (5.78) (6.89) (12.66) (22.95) (4.06) (7.16) (8.62) (8.44) (5.71) (10.46) C-CHN-BT 3.3 3.8 1.7 3.5 5.7 11.6 1.2 6.1 7.1 7.3 2.0 2.8 (0.72) (0.95) (0.87) (1.08) (1.55) (2.48) (0.65) (1.29) (1.43) (1.44) (0.66) (1.86) ESTR -10.1 -12.5 (4.93) (5.00) OH-Ar -6.4 (4.03) R-CC 16.1 -4.4 (7.86) (1.73) RT -8.9 -17.7 (4.21) (8.22) -O-Ar 5.7 (3.67) D012 5.5 (4.10) G010 -15.4 (9.59) H100 4.9 (3.59) H181 -7.3 (5.04) H421 14.6 (6.84) H521 14.1 (10.42) M113 -5.8 -11.7 -7.7 -22.8 -16.4 -16.5 (3.69) (5.30) (3.70) (8.75) (8.19) (10.58) M232 -14.5 (9.38) M280 4.8 (2.65) M313 -5.2 (3.18) M332 -5.0 (3.11) M370 4.2 (3.14) M372 10.0 14.4 (5.46) (7.91) M392 73.3 10.3 (25.03) (6.38) M531 -5.1 (3.05) M540 15.8 (11.27) H7 7.3 24.0 (4.01) (10.91) H8 10.7 (4.74) L1 -6.7 (2.52) L9 13.8 (6.93) constant -12.2 -5.5 -0.2 -2.3 -24.0 -7.1 1.3 -4.3 0.9 9.0 0.6 -11.2 R2 0.934 0.847 0.853 0.906 0.893 0.981 0.782 0.954 0.915 0.956 0.836 0.831 FO(6, 29) 68.9 26.8 28.1 46.4 40.5 254.5 17.3 100.3 51.8 106.2 24.6 23.7 Q2 0.883 0.710 0.767 0.729 0.826 0.968 0.572 0.923 0.828 0.909 0.617 0.760 a R2 , correlation coefficient; FO, Fisher value (level of statistical significance).

X

ABCB1 p.Ala999Thr 17559192:273:229

status: NEW

Login to comment
293 The values of those coefficients for WT and SNP variants (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) are the same as those shown in Table 5.

X

ABCB1 p.Ala999Thr 17559192:293:120

status: NEW

Login to comment
316 Other nonsynonymous polymorphisms, such as S400N, R492C, R669C, P1051A, and G1063A occurring in intracellular loops as well as I849M, M986V, and A999T alterations in transmembrane domains, exhibited moderate changes in the kinetic properties of ABCB1.

X

ABCB1 p.Ala999Thr 17559192:316:145

status: NEW

Login to comment
340 of samples allele frequency (%) allele frequency (%) ref S400N 1199 G > A African 111 G 100.0 A 0.0 23 African-American 100 G 99.0 A 1.0 16 German 461 G 94.5 A 5.5 29 Caucasian 85 G 87.1 A 12.9 6 Caucasian 50 G 98.0 A 2.0 31 Caucasian 100 G 97.5 A 2.5 16 Mexican-American 10 G 100.0 A 0.0 16 Asian-American 30 G 100.0 A 0.0 16 Pacific Islander 7 G 100.0 A 0.0 16 R492C 1474 C > T African-American 23 C 100.0 T 0.0 7 Caucasian 37 C 98.6 T 1.4 7 R669C 2005 C > T African-American 100 C 99.0 T 1.0 16 Caucasian 100 C 100.0 T 0.0 16 Mexican-American 10 C 100.0 T 0.0 16 Asian-American 30 C 100.0 T 0.0 16 Pacific Islander 7 C 100.0 T 0.0 16 I849M 2547 A > G African-American 100 C 100.0 T 0.0 16 Caucasian 100 C 99.5 T 0.5 16 Mexican-American 10 C 100.0 T 0.0 16 Asian-American 30 C 100.0 T 0.0 16 Pacific Islander 7 C 100.0 T 0.0 16 A893P/S/T 2677 G > T/A/C African (Beninese) 111 G 99.1 T 0.9 23 A 0.0 African-American 100 G 89.5 T 10.0 16 A 0.5 Caucasian 100 G 50.0 T 46.5 16 A 3.5 Caucasian 50 G 52.0 T 38.0 31 A 10.0 German 461 G 56.5 T 41.6 29 A 1.9 Mexican-American 10 G 60.0 T 40.0 16 A 0.0 Asian-American 30 G 33.3 T 45.0 16 A 21.7 Japanese 117 G 44.0 T 35.5 8 A 20.5 Japanese (placenta) 100 G 43.0 T 39.0 30 A 18.0 Japanese 48 G 36.5 T 41.7 30 A 21.8 Pacific Islander 7 G 28.6 T 35.7 16 A 35.7 ND ND G ND C ND NCBI dbSNP (rs2032582) M986V 2956 A > G Japanese (placenta) 100 A 99.5 G 0.5 30 Japanese 48 A 100.0 G 0.0 30 A999T 2995 G > A cell lines 36 G 94.4 A 5.6 28 P1051A 3151 C > G African-American 100 C 99.5 G 0.5 16 Caucasian 100 C 100.0 G 0.0 16 Mexican-American 10 C 100.0 G 0.0 16 Asian-American 30 C 100.0 G 0.0 16 Pacific Islander 7 C 100.0 G 0.0 16 G1063A 3188 G > A ND ND G ND A ND NCBI dbSNP (rs2707944) a ND, not determined.

X

ABCB1 p.Ala999Thr 17559192:340:1425

status: NEW

Login to comment

60 These SNPs caused an Ala893Ser and Ala999Thr exchange, respectively.

X

ABCB1 p.Ala999Thr 21103972:60:35

status: NEW

Login to comment

91 Gene name Transporter SNP Protein Population size (n) Invitro function Ref. Intestinal uptake transporters SLC15A1 PEPT1 p.P586L 44 Reduced Vmax [81] p.F28Y 247 Increased Km [82] Intestinal efflux transporters ABCB1 MDR1 c.571G>A p.G191R N/A Reduced drug resistance [201] c.1199G>A p.S440N N/A Reduced activity (substrate dependent) [202] c.11199G>A c.1199G>t p.S440N p.S440I N/A N/A Increased drug resistance Reduced drug resistance [203] c.1292-3GT>TG p.C431L N/A Reduced drug resistance [204] c.2005C>T p.R669C N/A Reduced substrate affinity [202] c.2547A>G p.I849M N/A Increased transport activity [202] c.2677G>T p.A893S 60 Lower intracellular digoxin accumulation [205] c.2677G>T c.2677G>A p.A893S p.A893T N/A N/A Unchanged Unchanged [206] c.2677G>T p.A893S 46 No change in rhodamine 123 efflux from peripheral blood lymphocytes [207] c.2667G>T p.A893S N/A Reduced transport function [208] c.2667G>T c.2677G>A p.A893S p.A893T N/A N/A Increased transport function Increased transport function [209] c.2667G>T c.2677G>A p.A893S p.A893T N/A N/A Increased activity (substrate dependent) Increased substrate affinity and transportactivity [202] c.2667G>T p.A893S 48 No change in rhodamine 123 efflux activity in peripheral blood mononuclear cells [210] c.2956A>G p.M986V N/A Increased transport activity [202] c.2995G>A p.A999T N/A Increased substrate affinity and transportactivity [202] c.3151C>G p.P1051A N/A Increased transport activity (substratedependent) [202] c.3188G>C p.G1063A N/A Increased transport activity [202] ABCG2 ABCG2 c.34G>A p.V12M N/A Low transport protein expression invitro [211] c.34G>A p.V12M N/A Unchanged [212] c.34G>A p.V12M N/A No change in HEK-293, lowered transport activity in Sf9 cells invitro [213] c.34G>A p.V12M N/A Unchanged [214] c.421C>A p.Q141K N/A Lower transport protein expression, normal transport activity [212] c.421C>A p.Q141K N/A Reduced drug resistance and lower ATPaseactivity [213] c.421C>A p.Q141K N/A Reduced drug extrusion [215] c.421C>A p.Q141K N/A Reduced drug resistance [216] c.421C>A p.Q141K N/A Unchanged [217] c.421C>A p.Q141K N/A No change of intracellular porphyrin accumulation [218] c.421C>A p.Q141K N/A Reduced transport activity [219] c.421C>A p.Q141K N/A Reduced transport activity [55] c.421C>A p.Q141K N/A Increased Km [220] For more information on members of the SLC superfamily of transporters please consult [301] and for more information of ABC transporters please consult [302].

X

ABCB1 p.Ala999Thr 21619426:91:1323

status: NEW

Login to comment
94 Gene name Transporter SNP Protein Population size (n) In vitro function Ref. Intestinal uptake transporters SLC15A1 PEPT1 p.P586L 44 Reduced Vmax [81] p.F28Y 247 Increased Km [82] Intestinal efflux transporters ABCB1 MDR1 c.571G>A p.G191R N/A Reduced drug resistance [201] c.1199G>A p.S440N N/A Reduced activity (substrate dependent) [202] c.11199G>A c.1199G>t p.S440N p.S440I N/A N/A Increased drug resistance Reduced drug resistance [203] c.1292-3GT>TG p.C431L N/A Reduced drug resistance [204] c.2005C>T p.R669C N/A Reduced substrate affinity [202] c.2547A>G p.I849M N/A Increased transport activity [202] c.2677G>T p.A893S 60 Lower intracellular digoxin accumulation [205] c.2677G>T c.2677G>A p.A893S p.A893T N/A N/A Unchanged Unchanged [206] c.2677G>T p.A893S 46 No change in rhodamine 123 efflux from peripheral blood lymphocytes [207] c.2667G>T p.A893S N/A Reduced transport function [208] c.2667G>T c.2677G>A p.A893S p.A893T N/A N/A Increased transport function Increased transport function [209] c.2667G>T c.2677G>A p.A893S p.A893T N/A N/A Increased activity (substrate dependent) Increased substrate affinity and transport activity [202] c.2667G>T p.A893S 48 No change in rhodamine 123 efflux activity in peripheral blood mononuclear cells [210] c.2956A>G p.M986V N/A Increased transport activity [202] c.2995G>A p.A999T N/A Increased substrate affinity and transport activity [202] c.3151C>G p.P1051A N/A Increased transport activity (substrate dependent) [202] c.3188G>C p.G1063A N/A Increased transport activity [202] ABCG2 ABCG2 c.34G>A p.V12M N/A Low transport protein expression in vitro [211] c.34G>A p.V12M N/A Unchanged [212] c.34G>A p.V12M N/A No change in HEK-293, lowered transport activity in Sf9 cells in vitro [213] c.34G>A p.V12M N/A Unchanged [214] c.421C>A p.Q141K N/A Lower transport protein expression, normal transport activity [212] c.421C>A p.Q141K N/A Reduced drug resistance and lower ATPase activity [213] c.421C>A p.Q141K N/A Reduced drug extrusion [215] c.421C>A p.Q141K N/A Reduced drug resistance [216] c.421C>A p.Q141K N/A Unchanged [217] c.421C>A p.Q141K N/A No change of intracellular porphyrin accumulation [218] c.421C>A p.Q141K N/A Reduced transport activity [219] c.421C>A p.Q141K N/A Reduced transport activity [55] c.421C>A p.Q141K N/A Increased Km [220] For more information on members of the SLC superfamily of transporters please consult [301] and for more information of ABC transporters please consult [302].

X

ABCB1 p.Ala999Thr 21619426:94:1325

status: NEW

Login to comment

478 To functionally validate the non-synonymous polymorphisms of ABCB1 (P-glycoprotein/MDR1) in vitro, we generated SNP variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A; refer to Fig. 6) and expressed them in Sf9 cells.

X

ABCB1 p.Ala999Thr 20138191:478:193

status: NEW

Login to comment
500 SNP Km Vmax Vmax / Km (µM) (nmol/min/mg protein) WT 5.8±2.3 62.4±7.8 10.8 S400N 5.8±2.8 46.7±5.3⁎⁎ 8.0 R492C 5.6±1.9 49.6±10.0⁎ 8.9 R669C 3.2±1.6⁎ 64.7±6.9 20.1 I849M 1.5±0.7⁎⁎ 80.3±9.5⁎⁎ 51.8 A893P 1.5±0.5⁎⁎ 405.2±16.5⁎⁎ 274.6 A893S 11.1±5.4 43.1±7.1⁎⁎ 3.9 A893T 4.3±1.4 98.9±9.5⁎⁎ 22.9 M986V 5.1±1.1 114.9±13.6⁎⁎ 22.5 A999T 2.0±0.8⁎⁎ 143.1±21.2⁎⁎ 70.9 P1051A 6.2±3.0 52.1±13.6 8.4 G1063A 6.2±3.7 117.9±16.4⁎⁎ 19.0 Data are expressed as mean±S.D., n=6.

X

ABCB1 p.Ala999Thr 20138191:500:541

status: NEW

Login to comment
533 The values of those coefficients for WT and SNP variants (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) are shown in Sakurai et al. (2007).

X

ABCB1 p.Ala999Thr 20138191:533:120

status: NEW

Login to comment
476 To functionally validate the non-synonymous polymorphisms of ABCB1 (P-glycoprotein/MDR1) in vitro, we generated SNP variant forms (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A; refer to Fig. 6) and expressed them in Sf9 cells.

X

ABCB1 p.Ala999Thr 20138191:476:193

status: NEW

Login to comment
498 SNP Km Vmax Vmax / Km (&#b5;M) (nmol/min/mg protein) WT 5.8&#b1;2.3 62.4&#b1;7.8 10.8 S400N 5.8&#b1;2.8 46.7&#b1;5.3Ìe;Ìe; 8.0 R492C 5.6&#b1;1.9 49.6&#b1;10.0Ìe; 8.9 R669C 3.2&#b1;1.6Ìe; 64.7&#b1;6.9 20.1 I849M 1.5&#b1;0.7Ìe;Ìe; 80.3&#b1;9.5Ìe;Ìe; 51.8 A893P 1.5&#b1;0.5Ìe;Ìe; 405.2&#b1;16.5Ìe;Ìe; 274.6 A893S 11.1&#b1;5.4 43.1&#b1;7.1Ìe;Ìe; 3.9 A893T 4.3&#b1;1.4 98.9&#b1;9.5Ìe;Ìe; 22.9 M986V 5.1&#b1;1.1 114.9&#b1;13.6Ìe;Ìe; 22.5 A999T 2.0&#b1;0.8Ìe;Ìe; 143.1&#b1;21.2Ìe;Ìe; 70.9 P1051A 6.2&#b1;3.0 52.1&#b1;13.6 8.4 G1063A 6.2&#b1;3.7 117.9&#b1;16.4Ìe;Ìe; 19.0 Data are expressed as mean&#b1;S.D., n=6.

X

ABCB1 p.Ala999Thr 20138191:498:504

status: NEW

Login to comment
502 Descriptor Coefficients (95% reliability) for ABCB1 WT and vatiants WT S400N R492C R669C I849M A893P A893S A893T M986V A999T P1051A G1063A M532 24.3 (3.76) 21.2 (5.81) 18.5 (5.87) 35.9 (7.68) 52.7 (11.30) 169.8 (18.84) 14.0 (4.03) 61.2 (7.75) 39.4 (8.76) 63.0 (9.39) 13.9 (4.78) 52.1 (10.94) M132 21.5 (3.89) 14.1 (5.34) 13.6 (5.78) 32.8 (6.89) 61.4 (12.66) 135.6 (22.95) 11.2 (4.06) 52.8 (7.16) 38.2 (8.62) 65.9 (8.44) 7.6 (5.71) 24.3 (10.46) C-CHN-BT 3.3 (0.72) 3.8 (0.95) 1.7 (0.87) 3.5 (1.08) 5.7 (1.55) 11.6 (2.48) 1.2 (0.65) 6.1 (1.29) 7.1 (1.43) 7.3 (1.44) 2.0 (0.66) 2.8 (1.86) ESTR -10.1 (4.93) -12.5 (5.00) OH-Ar -6.4 (4.03) R-CC 16.1 (7.86) -4.4 (1.73) RT -8.9 (4.21) -17.7 (8.22) -O-Ar 5.7 (3.67) D012 5.5 (4.10) G010 -15.4 (9.59) H100 4.9 (3.59) H181 -7.3 (5.04) H421 14.6 (6.84) H521 14.1 (10.42) M113 -5.8 (3.69) -11.7 (5.30) -7.7 (3.70) -22.8 (8.75) -16.4 (8.19) -16.5 (10.58) M232 -14.5 (9.38) M280 4.8 (2.65) M313 -5.2 (3.18) M332 -5.0 (3.11) M370 4.2 (3.14) M372 10.0 (5.46) 14.4 (7.91) M392 73.3 (25.03) 10.3 (6.38) M531 -5.1 (3.05) M540 15.8 (11.27) H7 7.3 (4.01) 24.0 (10.91) H8 10.7 (4.74) L1 -6.7 (2.52) L9 13.8 (6.93) Const.

X

ABCB1 p.Ala999Thr 20138191:502:119

status: NEW

Login to comment
534 The values of those coefficients for WT and SNP variants (i.e., S400N, R492C, R669C, I849M, A893P, A893S, A893T, M986V, A999T, P1051A, and G1063A) are shown in Sakurai et al. (2007).

X

ABCB1 p.Ala999Thr 20138191:534:120

status: NEW

Login to comment

152 A study in our lab showed that common polymorphisms of MDR1 at 61ANG (N21D), 307TNC (F103L), 1199GNA (S400N), 2677GNT (A893S) and 2995GNA (A999T) do not change the transport of four MDR1 substrates when expressed at high levels in human cells [66].

X

ABCB1 p.Ala999Thr 19285158:152:139

status: NEW

Login to comment
151 A study in our lab showed that common polymorphisms of MDR1 at 61ANG (N21D), 307TNC (F103L), 1199GNA (S400N), 2677GNT (A893S) and 2995GNA (A999T) do not change the transport of four MDR1 substrates when expressed at high levels in human cells [66].

X

ABCB1 p.Ala999Thr 19285158:151:139

status: NEW

Login to comment

42 Table 1 Geneticpolymorphismsin MDRl ~~~~~~~~~~ Position Location Effect C-l4SG T-l29C(T12C) C-4T G-IA A61C G.51-2ST G.51-3SC T307C C6/+139C A548G G119YA C1236T c12li44T C1474T TIlJ-76A A 17/+137G C26SOT G2677T A2956G G2995A A3320C C3396T T342l A C343ST T3421A C343ST G4030C A4036G Intron Exon la Exon 1b Exon 2 Exon 2 Exon 2 lntron Intron Exon 5 Intron Exon 7 Exon 11 Exon 12 lntron Exon 13 Intron Intron Exon 21 Exon 21 Exon 21 Exon 24 Exon 24 Exon 26 Exon 26 Exon 26 Exon 26 Exon 28 Exon 26 Non-coding Non-coding Non-coding Non-coding Non-coding Am21Asp Phe103Leu Asnl83Ser Ser400Asn Wobble(Gly412Gly) Arg492Cys Wobble(Leu884Leu) Ala893Thr Ala893Ser Met986Val Ala999Thr Gln1I 07Pro Wobble Serll41Thr Wobble(1le114SIIe) Silent Silent In recent years, most of the MDR1 SNPs were identified, with some resulting in changes in P-gp .

X

ABCB1 p.Ala999Thr 16529292:42:662

status: NEW

Login to comment
47 This SNP is located on the cytoplasmic side just ahead of the first ATP-binding domain'291.C1236T in exon 12, the synonymous polymorphism, is one of the SNPs with the highest freq~encies[~".G2677T/A, a missense mutation in exon 21 that results in an amino acid change from Ala 893 to Ser or Thr, has also been associated with altered P-gp expre~sion"~,~~'.Another polymorphism, G2995A in exon 24 changes Ala 999 to Thr in the second transmembrance domain closer to the ATP-binding domain[361.Finally, MDR is another wobble mutation that doesn't alter the amino acid Ile at the position 1145.The potential functional significance of these polymorphisms can be deduced by pinpointingthem on the domain structureof P-gp.

X

ABCB1 p.Ala999Thr 16529292:47:404

status: NEW

Login to comment
52 Furthermore, Kimchi-Sarfaty and his colleagues carried out a study to characterize the functional consequences of five coding SNPs (Asn21Asp,Phel03Leu, Ser400Asn, Ala893Ser, Ala999Thr) using a vaccinia virus-based transient expression system, but it was found that the distribution and function of P-gp in the cells were similar to wild-type P-gp in the human body'431.The mechanism of these contradictory results regarding the C2677T/A and C3435T polymorphisms function is unclear until now.

X

ABCB1 p.Ala999Thr 16529292:52:174

status: NEW

Login to comment
49 Table 1 Geneticpolymorphismsin MDRl ~~~~~~~~~~ Position Location Effect C-l4SG T-l29C(T12C) C-4T G-IA A61C G.51-2ST G.51-3SC T307C C6/+139C A548G G119YA C1236T c12li44T C1474T TIlJ-76A A 17/+137G C26SOT G2677T A2956G G2995A A3320C C3396T T342l A C343ST T3421A C343ST G4030C A4036G Intron Exon la Exon 1b Exon 2 Exon 2 Exon 2 lntron Intron Exon 5 Intron Exon 7 Exon 11 Exon 12 lntron Exon 13 Intron Intron Exon 21 Exon 21 Exon 21 Exon 24 Exon 24 Exon 26 Exon 26 Exon 26 Exon 26 Exon 28 Exon 26 Non-coding Non-coding Non-coding Non-coding Non-coding Am21Asp Phe103Leu Asnl83Ser Ser400Asn Wobble(Gly412Gly) Arg492Cys Wobble(Leu884Leu) Ala893Thr Ala893Ser Met986Val Ala999Thr Gln1I 07Pro Wobble Serll41Thr Wobble(1le114SIIe) Silent Silent In recent years, most of the MDR1 SNPs were identified, with some resulting in changes in P-gp .

X

ABCB1 p.Ala999Thr 16529292:49:662

status: NEW

Login to comment
58 Another polymorphism, G2995A in exon 24 changes Ala 999 to Thr in the second transmembrance domain closer to the ATP-binding domain[361.

X

ABCB1 p.Ala999Thr 16529292:58:48

status: NEW

Login to comment
64 Furthermore, Kimchi-Sarfaty and his colleagues carried out a study to characterize the functional consequences of five coding SNPs (Asn21Asp,Phel03Leu, Ser400Asn, Ala893Ser, Ala999Thr) using a vaccinia virus-based transient expression system, but it was found that the distribution and function of P-gp in the cells were similar to wild-type P-gp in the human body'431.The mechanism of these contradictory results regarding the C2677T/A and C3435T polymorphisms function is unclear until now.

X

ABCB1 p.Ala999Thr 16529292:64:174

status: NEW

Login to comment

68 Single nucleotide polymorphisms (SNPs) in the MDR1 gene SNP Region Number Frequency of SNPsa [%] Effect Heterozygous Homozygous Observed Estimated T-12C E1 85 11.8 0 0.4 Non-coding G-1A E2 188 11.2 0 0.4 Translation initiation A61G E2 188 17.6 0.5 0.81 Asn21Asp G-25T I4 85 26.0 3.5 2.3 G-35C I4 85 1.2 0 0.01 T307C E5 85 1.2 0 0.01 Phe103Leu C+139T I5 85 48.2 16.5 16.8 C+145T I5 85 2.4 0 0.01 G1199A E11 85 12.9 0 0.4 Ser400Asn C1236T E12 188 48.9 13.3 14.4 Gly412Gly C+44T I12 188 11.7 0 0.4 T-76A I16 85 45.9 22.4 20.3 A+137G I17 85 1.2 0 0.01 G2677T E21 83b 43.4 42.2 38.4 Ala893Ser G2995A E24 36b 11.1 0 Ala999Thr C3435T E26 537 47.7 26.4 24.1 Ile1145Ile C3396T E26 188 0.53 0 0.01 Wobble aMDR1 sequences Genbank (gb) accession numbers AC002457 and AC005068 are defined as wildtype.

X

ABCB1 p.Ala999Thr 11495756:68:610

status: NEW

Login to comment