ABCMdb

ABCB1 p.Lys536Arg

Predicted by SNAP2:	A: D (85%), C: D (80%), D: D (95%), E: D (91%), F: D (91%), G: D (91%), H: D (85%), I: D (85%), L: D (91%), M: D (85%), N: D (91%), P: D (95%), Q: D (85%), R: D (63%), S: D (80%), T: D (85%), V: D (85%), W: D (91%), Y: D (91%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, L: D, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Biochemical, cellular, and pharmacological aspects... Annu Rev Pharmacol Toxicol. 1999;39:361-98. Ambudkar SV, Dey S, Hrycyna CA, Ramachandra M, Pastan I, Gottesman MM
Biochemical, cellular, and pharmacological aspects of the multidrug transporter.
Annu Rev Pharmacol Toxicol. 1999;39:361-98., [PMID:10331089]

Abstract [show]
Considerable evidence has accumulated indicating that the multidrug transporter or P-glycoprotein plays a role in the development of simultaneous resistance to multiple cytotoxic drugs in cancer cells. In recent years, various approaches such as mutational analyses and biochemical and pharmacological characterization have yielded significant information about the relationship of structure and function of P-glycoprotein. However, there is still considerable controversy about the mechanism of action of this efflux pump and its function in normal cells. This review summarizes current research on the structure-function analysis of P-glycoprotein, its mechanism of action, and facts and speculations about its normal physiological role.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 Table 1 List of mutations in human, mouse, and hamster P-glycoproteins that affect substrate specificitya aa mutation Region Sourceb Reference H61R, F, K, M, W, Y TM 1 Human MDR1 149, 150 ABC20c G64R TM 1 Human MDR1 150 L65R TM 1 Human MDR1 150 aa78-97 EC 1 Human MDR1 151 Q128Hd TM 2 Mouse mdr3 152 R138H IC 1 Mouse mdr3 152 Q139H, R IC 1 Mouse mdr3 152 Q141V IC 1 Human MDR1 15319, Q145H IC 1 Mouse mdr3 152 E155G, K IC 1 Mouse mdr3 152 F159I IC 1 Mouse mdr3 152 D174G IC 1 Mouse mdr3 152 S176G, P IC 1 Mouse mdr3 152 K177I IC 1 Mouse mdr3 152 N179S IC 1 Mouse mdr3 152 N183S/G185V IC 1 Human MDR1 154 G183D IC 1 Mouse mdr3 152 G185V IC 1 Human MDR1 155-157 G187V IC 1 Human MDR1 153 A192T TM 3 Mouse mdr3 152 F204S EC 2 Mouse mdr3 152 W208G EC 2 Mouse mdr3 152 K209E EC 2 Mouse mdr3 152 L210I TM 4 Mouse mdr3 152 T211P TM 4 Mouse mdr3 152 I214T TM 4 Mouse mdr3 152 P223A TM 4 Human MDR1 158 G288V IC 2 Human MDR1 153 I299M, T319S, L322I, TM 5, EC3, Human MDR1 159 G324K, S351N IC 3 F335A TM 6 Human MDR1 19 F335 TM 6 Human MDR1 160 V338A TM 6 Human MDR1 161 G338A, A339P TM 6 Hamster PGY1 162, 163 A339P TM 6 Hamster PGY1 163 G341V TM 6 Human MDR1 161 K536R, Q N-NBD Human MDR1 164 ERGA → DKGT N-NBD Mouse mdr3 165 aa 522-525 T578C N-NBD Mouse mdr3 165 (Continued) G830V IC 4 Human MDR1 P866A TM 10 Human MDR1 158 F934A TM 11 Mouse mdr3 166 G935A TM 11 Mouse mdr3 166 I936A TM 11 Mouse mdr3 166 F938A TM 11 Mouse mdr3 166 S939A TM 11 Mouse mdr3 166 S939F TM 11 Mouse mdr3 167, 168 S941F TM 11 Mouse mdr1 167, 168 T941A TM 11 Mouse mdr3 166 Q942A TM 11 Mouse mdr3 166 A943G TM 11 Mouse mdr3 166 Y946A TM 11 Mouse mdr3 166 S948A TM 11 Mouse mdr3 166 Y949A TM 11 Mouse mdr3 166 C952A TM 11 Mouse mdr3 166 F953A TM 11 Mouse mdr3 166 F983A TM 12 Human MDR1 169 L975A, V981A, F983A TM 12 Human MDR1 169 M986A, V988A, Q990A, TM 12 Human MDR1 169 V991A V981A, F983A TM 12 Human MDR1 169 L975A, F983A TM 12 Human MDR1 169 L975A, V981A TM 12 Human MDR1 169 F978A TM 12 Human MDR1 19 a aa,amino acid; EC, extracellular loop; IC, intracellular loop; TM,transmembrane domain; NBD, nucleotide binding/utilization domain. Login to comment

[hide] Functional implications of genetic polymorphisms i... Pharm Res. 2004 Jun;21(6):904-13. Pauli-Magnus C, Kroetz DL
Functional implications of genetic polymorphisms in the multidrug resistance gene MDR1 (ABCB1).
Pharm Res. 2004 Jun;21(6):904-13., [PMID:15212152]

Abstract [show]
The multidrug resistance (MDR1) gene product P-glycoprotein is a membrane protein that functions as an ATP-dependent efflux pump, transporting exogenous and endogenous substrates from the inside of cells to the outside. Physiological expression of P-glycoprotein in tissues with excretory or protective function is a major determinant of drug disposition and provides a cellular defense mechanism against potentially harmful compounds. Therefore, P-glycoprotein has significant impact on therapeutic efficacy and toxicity as it plays a key role in absorption of oral medications from the intestinal tract, excretion into bile and urine, and distribution into protected tissues such as the brain and testes. There is increasing interest in the possible role of genetic variation in MDR1 in drug therapy. Numerous genetic polymorphisms in MDR1 have been described, some of which have been shown to determine P-glycoprotein expression levels and substrate transport. Furthermore, some of these polymorphisms have an impact on pharmacokinetic and pharmacodynamic profiles of drug substrates and directly influence outcome and prognosis of certain diseases. This review will focus on the impact of genetic variation in MDR1 on expression and function of P-glycoprotein and the implications of this variation for drug therapy and disease risk.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
118 Functional Impact in vitro of MDR1 Variants Amino acid change Functional effect of the variant allele Reference Val185Ser Increased colchicine resistance [30] ⌬Phe335 Decreased resistance to vinca alkaloids; no resistance to dactinomycin [31] Lys536Gln, Gly534Asp, Lys536Arg, Ser532Arg, ⌬Tyr490 Defective RNA processing [33] Ala893Ser Acquired overexpression of one allele in drug-resistant cells [20] Ala893Ser Decreased digoxin efflux [19] Asn21Asp, Phe103Leu, Ser400Ala, Ala893Ser, Ala893Thr No effect on P-glycoprotein cell surface expression and substrate specificity [69] Ala893Ser No difference in calcein-AM transport [27] Ala893Ser/Thr No difference in transport of verapamil, digoxin, viblastine and cyclosporine A [35] 3435 polymorphisms were analyzed separately, with AUC values being highest for individuals carrying the reference alleles. Login to comment

[hide] Cystic fibrosis-type mutational analysis in the AT... J Biol Chem. 1994 Aug 12;269(32):20575-83. Hoof T, Demmer A, Hadam MR, Riordan JR, Tummler B
Cystic fibrosis-type mutational analysis in the ATP-binding cassette transporter signature of human P-glycoprotein MDR1.
J Biol Chem. 1994 Aug 12;269(32):20575-83., 1994-08-12 [PMID:7914197]

Abstract [show]
Members of the ATP-binding cassette transporter superfamily such as the P-glycoproteins (MDR) and the cystic fibrosis transmembrane conductance regulator (CFTR) share conserved sequence motifs in their nucleotide binding fold that are the major targets for CFTR mutations in patients with cystic fibrosis. Cystic fibrosis-type mutations were introduced at analogous positions into the human MDR1 gene. Heterologous expression of wild-type or mutated MDR1 revealed similar mRNA transcript levels in Chinese hamster ovary K1 recipients, but the subsequent processing was defective for all mutations that give rise to severe cystic fibrosis in the case of CFTR. Functional multidrug transporter MDR1, however, was obtained when amino acid substitutions were introduced into a less conserved position of the ATP-binding cassette transporter signature (codon 536 in MDR1). The profile of cross-resistance and chemosensitization was modulated in these codon 536 variants, which suggests that this region is involved in the drug transport function of P-glycoprotein.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
112 Homogeneous populations of human P-glycoprotein-expressing cells were observed in thecelllines thatwere carryingwild-type MDRl, K536R MDR1, or K536Q MDRl cDNA (Fig. 4A). Login to comment
116 1 , ', k. ,-I wt S532R K536R AY490 I K536Q transcripts in recombinant CHO K1 cells by RTPCR kinetics. Login to comment
122 dered the CHO K1 cells more resistant toadriamycin and colchicine when either wild-type sequence or the codon 536 variants, K536R or K536Q, had beenintroduced(Fig.2).This finding on the G418-preselected cell pool was confirmed by growth inhibitionexperiments withclonal cell lines. Login to comment
130 Cell line Fluorescence Signalnormalized to CHO K1 control CHO K1 8.6 x 10' CHO K1 (MDR1) 1.0 CHO K1 (AY490 MDR1) 6.3 x 10' 0.7 CHO K1 (S532R MDR1)" 4.4 x 104 51 CHO K1 (G534D MDR1)" 2.1 x 105 240 CHO K1 (K536R MDR1) 5.6 x 105 650 CHO K1 (K536Q MDR1) 9.4 x 105 CHO K1 (AY490-K536QMDR1) 2.1 x lo3 1,100 6.5 x 105 750 2.4 a The datarefer to the MRK16-positive subpopulation. Login to comment
141 The strongly photoreactive band of P-glycoprotein was exclusively seeninplasmamembranes from cells exhibiting the multidrug resistance phenotype, i.e. transfectants MDRls K1, K536Q MDRls K1, K536R MDRls K1(Fig. 6, left lane in eachpanel), and theB30 positive control. Login to comment
147 Opentriangles, wild-type MDRls CHO K1; closed cycles, K536R MDRls K1; closed triangles, K536Q MDRls K1; stars, S532R MDRls K1; opencircles, AY490 MDRls K1; closed squares, G534D MDRls K1; bars, AY490-K536QMDRls K1; open squares,CHO K1. Login to comment
148 TABLE111 Multidrug resistance and chemosensitizationof P-glycoprotein-expressingCHO cell clones Cell line ID,, values 0 prt' 1 p!.t" 3PMc" 10PMO nglml Colchicine CHO K1 54 6/13 3/13 5'18 CHO K1 (MDR1) 530 1901320 121110 2'/40 ' CHO K1 (K536Q MDR1) 18015/56 6/26 5'113' CHO K1 (K536R MDR1) 840 4801680 471140 7'1546 Vinblastine CHO K1 12 213 112 1'11 CHO K1 (MDR1) 240 1001180 10170 2'I8 ' CHO K1 (K536Q MDR1) 150 10148 3/14 2'I3 ' CHO K1 (K536R MDR1) 220180/210 15190 2'17 ' CHO K1 18 314 314 3'I3 CHO K1 (MDR1) 280100/230 8170 4'114 CHO K1 (K536Q MDR1) 60 6116 317 3'13' CHO K1 (K536R MDR1) 350 190/270 17/70 3'Ill ' a Concentration of cyclosporin (lefi)/FK506 (right). Login to comment
176 K536R Deglycosylated form(blot) + ND (+) ND ND & + Mature glycosylated membrane protein (blot) + ND * ND ND + + Membrane protein on cell surface (FACS) + - * (+) ND + + Multidrug resistance and collateral sensitivity + - - - - + + CFTRb Wild-tvpe AF508 S549RG551DAF508-R553Q R553Q Partially glycosylated form + + + + + + Mature fully glycosylatedmembrane protein + ND ND + (+) + Chloride current: SPQ assay + - - - + + Chloride current: electrophysiological recordings + -b. +d,e,f +e.f + + Transfectionin CHO cells (this work). Login to comment

[hide] Characterization of the human multidrug resistance... Biochem J. 1997 May 1;323 ( Pt 3):777-83. Bakos E, Klein I, Welker E, Szabo K, Muller M, Sarkadi B, Varadi A
Characterization of the human multidrug resistance protein containing mutations in the ATP-binding cassette signature region.
Biochem J. 1997 May 1;323 ( Pt 3):777-83., 1997-05-01 [PMID:9169612]

Abstract [show]
A number of mutants with single amino acid replacements were generated in the highly conserved ATP-binding cassette (ABC)-signature region (amino acids 531-543) of the N-terminal half of the human multidrug resistance (MDR1) protein. The cDNA variants were inserted into recombinant baculoviruses and the MDR1 proteins were expressed in Spodoptera frugiperda (Sf9) insect cells. The level of expression and membrane insertion of the MDR1 variants was examined by immunostaining, and MDR1 function was followed by measuring drug-stimulated ATPase activity. We found that two mutations, L531R and G534V, practically eliminated MDR1 expression; thus these amino acid replacements seem to inhibit the formation of a stable MDR1 protein structure. The MDR1 variants G534D and I541R were expressed at normal levels with normal membrane insertion, but showed a complete loss of drug-stimulated ATPase activity, while mutant R538M yielded full protein expression but with greatly decreased ATPase activity. Increasing the ATP concentration did not restore MDR1 ATPase activity in these variants. Some amino acid replacements in the ABC-signature region (K536I, K536R, I541T and R543S) affected neither the expression and membrane insertion nor the ATPase function of MDR1. We found no alteration in the drug-sensitivity of ATP cleavage in any of the MDR1 variants that had measurable ATPase activity. These observations suggest that the ABC-signature region is essential for MDR1 protein stability and function, but alterations in this region do not seem to modulate MDR1-drug interactions directly.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 Some amino acid replacements in the ABC-signature region (K536I, K536R, I541T and R543S) affected neither the expression and membrane insertion nor the ATPase function of MDR1. Login to comment
26 The mutant K536Q (Lys to Gln) was expressed in comparable amounts to the wild-type protein, but conferred decreased drug resistance, while the K536R (Lys to Arg) replacement increased multidrug resistance, with a preferential resistance to colchicine. Login to comment
38 Mutations were engineered by the site-directed mutagenesis technique of Kunkel [18] utilizing the following mutagenic oligonucleotides: L531R, 5h CCACCACTCCGCTGGGCCC- CT; G534D, 5h TGCTTCTGAACACCACTCAAT; G534V, 5h TGCTTCTGATCACCACTCAAT; K536R, 5h GATCCTCTG- TCTCTGCCCACCAC; K536I, 5h GATCCTCTGTATCTGC- CCACCAC; R538M, 5h GCACGTGCAATGGCGATCATCT- GCTTG; I541R, 5h GCACGTGCTCTGGCGATCCTCTGCT- TG; I541T, 5h GCACGTGCTGTGGCGATCCTCTGCTTG; R543S, 5h AACCAGGGCACTTGCAATGGCGAT. Login to comment
64 Mutant Relative expression level Relative ATPase activity L531R 0.1 0.05 G534V 0.1 0.05 G534D 1.0 0.05 K536I 0.9 1.0 K536R 1.1 0.9 R538M 1.1 0.4 I541R 1.2 0.05 I541T 1.0 1.1 R543S 1.1 1.1 the mutants G534D, K536I, K536R, R538M, I541R, I541T and R543S the MDR1-immunoreactive proteins appeared with the expected size of underglycosylated wild-type MDR1 (about 130 kDa), characteristic of MDR1 expression in Sf9 cells [14,19]. Login to comment
74 We found similar full recognition for the mutants K536I, K536R, I541T and R543S, whereas the mutant proteins showing low expression levels on the immunoblots (L531R and G534V) were not detectable by immunoflow cytometry either (results not shown). Login to comment
84 For the MDR1 variants K536I, K536R, I541T and R543S, all four drugs concentration-dependently induced ATPase activities that were not significantly different from those seen in the wild-type MDR1 (Figure 4). Login to comment
85 The K536R mutant MDR1 had been described previously to result in altered cross-resistance towards different drugs, i.e. it caused a preferential resistance to colchicine [13]. Login to comment
94 We found similar KATP m values for the ABC-signature mutants showing normal drug-stimulated ATPase activity (K536I, K536R, I541T and R543S; results not shown). Login to comment
112 In the case of the human MDR1 protein expressed in mammalian cells, replacement of the lysine residue in the N-terminal ABC signature with arginine (K536R) resulted in a P-glycoprotein variant that was found to be more effective in conferring multidrug resistance than the wild-type protein, with a preferential resistance to colchicine [13]. Login to comment
140 In our experiments, full MDR1 protein expression and full MDR1 ATPase activity were observed when Lys&$' was replaced either by arginine (K536R), causing no net charge difference, or even by isoleucine (K536I), which removes this positive charge. Login to comment
141 Hoof and co-workers [13] found that the K536R mutation in mammalian cells generated a transporter which was more active than the wild type, and this greater multidrug resistance was manifested in a preferential resistance to colchicine. Login to comment
142 In our experiments, when expressing the mutant K536R in insect cells, we found no major alteration in its drug-stimulated ATPase activity (Figure 4), including its stimulation by colchicine. Login to comment

[hide] Mutations in the nucleotide-binding sites of P-gly... Biochemistry. 1998 Jun 23;37(25):9073-82. Beaudet L, Urbatsch IL, Gros P
Mutations in the nucleotide-binding sites of P-glycoprotein that affect substrate specificity modulate substrate-induced adenosine triphosphatase activity.
Biochemistry. 1998 Jun 23;37(25):9073-82., 1998-06-23 [PMID:9636053]

Abstract [show]
The amino- and carboxy-terminal nucleotide-binding domains (NBD1 and NBD2) of P-glycoprotein (P-gp) share over 80% sequence identity. Almost all of NBD1 can be exchanged by corresponding NBD2 segments with no significant loss of function, except for a small segment around the Walker B motif. Within this segment, we identified two sets of residues [ERGA --> DKGT (522-525) and T578C] that, when replaced by their NBD2 counterparts, cause dramatic alterations of the substrate specificity of the protein [Beaudet, L., and Gros, P. (1995) J. Biol. Chem. 270, 17159-17170]. We wished to gain insight into the molecular basis of this defect. For this, we overexpressed the wild-type mouse Mdr3 and variants bearing single or double mutations at these positions in the yeast Pichia pastoris. P-gp-specific ATPase activity was measured in yeast plasma membrane preparations after detergent solubilization and reconstitution in Escherichia coli proteoliposomes. P-gp proteoliposomes from P. pastoris showed a strong verapamil- and valinomycin-stimulated ATPase activity, with characteristics (KM, Vmax) similar to those measured in mammalian cells. Mutations did not appear to affect the KM for Mg2+ATP ( approximately 0.4 mM), but maximum velocity (Vmax) of the drug-stimulated ATPase activity was severely affected in a substrate/modulator-specific fashion. Indeed, all mutants showed complete loss of verapamil-induced ATPase, while all retained at least some degree of valinomycin-induced ATPase activity. Photolabeling studies with [125I]iodoarylazidoprazosin, including competition with MDR drugs and modulators, suggested that drug binding was not affected in the mutants. The altered drug resistance profiles of the ERGA --> DKGT(522-525) and T578C mutants in vivo, together with the observed alterations in substrate-induced ATPase activity of these proteins, suggest that the residues involved may form part of a signal pathway between the membrane regions (substrate binding) and the ATP binding sites.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
246 Another NBD mutation known to affect substrate specificity is the enhanced colchicine resistance noted in the K536R variant of human MDR1 (45). Login to comment
247 Remarkably, K536R maps within the highly conserved dodecapeptide segment immediately upstream from the Walker B motif and immediately downstream from the ERGA/DKGT substitution studied in this report. Login to comment
248 The biochemical basis of the altered drug resistance profile in the K536R mutation has not yet been clarified, although it did not seem to affect binding of the photoactive probe [125I]iodomycin (45). Login to comment

[hide] The power of the pump: mechanisms of action of P-g... Eur J Pharm Sci. 2006 Apr;27(5):392-400. Epub 2005 Dec 13. Ambudkar SV, Kim IW, Sauna ZE
The power of the pump: mechanisms of action of P-glycoprotein (ABCB1).
Eur J Pharm Sci. 2006 Apr;27(5):392-400. Epub 2005 Dec 13., [PMID:16352426]

Abstract [show]
Members of the superfamily of ATP-binding cassette (ABC) transporters mediate the movement of a variety of substrates including simple ions, complex lipids and xenobiotics. At least 18 ABC transport proteins are associated with disease conditions. P-glycoprotein (Pgp, ABCB1) is the archetypical mammalian ABC transport protein and its mechanism of action has received considerable attention. There is strong biochemical evidence that Pgp moves molecular cargo against a concentration gradient using the energy of ATP hydrolysis. However, the molecular details of how the energy of ATP hydrolysis is coupled to transport remain in dispute and it has not been possible to reconcile the data from various laboratories into a single model. The functional unit of Pgp consists of two nucleotide binding domains (NBDs) and two trans-membrane domains which are involved in the transport of drug substrates. Considerable progress has been made in recent years in characterizing these functionally and spatially distinct domains of Pgp. In addition, our understanding of the domains has been augmented by the resolution of structures of several non-mammalian ABC proteins. This review considers: (i) the role of specific conserved amino acids in ATP hydrolysis mediated by Pgp; (ii) emerging insights into the dimensions of the drug binding pocket and the interactions between Pgp and the transport substrates and (iii) our current understanding of the mechanisms of coupling between energy derived from ATP binding and/or hydrolysis and efflux of drug substrates.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
52 Between the Walker A and B sequences is found a linker peptide with the sequence LSGGQ, also known as the C-region or ABC signature sequence, as it is the hallmark of Table 1 - Summary of mutational analysis of conserved residues in nucleotide-binding domains of Pgp Domain Source Residue number Function Reference NBD1 NBD2 A-loop Human Y401A Y1044A No ATP binding/hydrolysis Kim et al. (submitted for publication) Walker A Mouse K429N K1072N Normal ATP binding but no hydrolysis Azzaria et al. (1989) G431A G1073A Human C431 C1074 ATP protects from modification by N-ethylmaleimide Loo and Clarke (1995) Disulfide bond formation between Walker A domains of both NBDs Urbatsch et al. (2001) Human K433M K1076M Decreased ATP-binding Muller et al. (1996) No ATP hydrolysis Szakacs et al. (2000) No vanadate-trapping, but aluminum and beryllium fluoride-induced trapping normal Q-loop Mouse Q471 Q1114 Not essential for ATP hydrolysis but may be involved in communication with drug-substrate sites Urbatsch et al. (2000a) LSGGQ or linker peptide or signature motif Mouse S528A S1173A Normal ATP binding but no hydrolysis Tombline et al. (2004a) Human S532R Decreased cell surface expression Hoof et al. (1994) Human G534C G1179C No ATP hydrolysis Loo et al. (2002) Human G534D Decreased cell surface expression Hoof et al. (1994) No drug resistance Normal cell surface expression Bakos et al. (1997) No ATP hydrolysis Human G534D/V G1179D Interdomain communication Szakacs et al. (2001) Human Q535C Q1180C No ATP hydrolysis Loo et al. (2002) Human K536Q Decreased drug resistance Hoof et al. (1994) LSGGQ or linker peptide or signature motif Human K536R Increased colchicine resistance (normal ATP hydrolysis?) Login to comment
53 Hoof et al. (1994) Human L531R Decreased cell surface expression Bakos et al. (1997) G534V K536I Normal cell surface expression K536R Normal ATP hydrolysis I541T R543S LSGGQ or linker peptide or signature motif Human R538M Normal cell surface expression Decreased ATP hydrolysis Bakos et al. (1997) I541R Normal cell surface expression No ATP hydrolysis Walker B Mouse D551N D1196N No ATP hydrolysis, required for Mg2+ binding Urbatsch et al. (1998) Human D555A D1200A Same as above Hrycyna et al. (1999) Walker B Mouse E552A E1197A Trapping of ATP, no steady-state hydrolysis Tombline et al. (2004b) Mouse E552Q E1197Q No steady-state ATP hydrolysis Vigano et al. (2002) Human E556A E1201A Trapping of ATP or ADP in the absence of vanadate, low levels of ATP hydrolysis Sauna et al. (2002) D-loop Mouse D558N D1203N Decreased ATP hydrolysis Urbatsch et al. (2000b) the ABC transporter superfamily. Login to comment

[hide] Molecular genetic analysis and biochemical charact... Semin Cell Dev Biol. 2001 Jun;12(3):247-56. Hrycyna CA
Molecular genetic analysis and biochemical characterization of mammalian P-glycoproteins involved in multidrug resistance.
Semin Cell Dev Biol. 2001 Jun;12(3):247-56., [PMID:11428917]

Abstract [show]
A variety of human cancers become resistant or are intrinsically resistant to treatment with conventional drug therapies. This phenomenon is due in large part to the overexpression of a 170 kDa plasma membrane ATP-dependent pump known as the multidrug resistance transporter or P-glycoprotein. P-glycoprotein is a member of the large ATP binding cassette (ABC) superfamily of membrane transporters. This review focuses on the use of structure-function analyses to elucidate further the mechanism of action of mammalian P-glycoproteins. Ultimately, a complete understanding of the mechanism is important for the development of novel strategies for the treatment of many human cancers.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
27 List of mutations in human, mouse and hamster P-gp`s that affect substrate specificity f aaa Mutation Regionb Sourcec Reference aa 78-97 EC 1 human MDR1 78 (ABC20)d Q128He TM 2 mouse mdr3 79 R138H IC 1 mouse mdr3 79 Q139H, R IC 1 mouse mdr3 79 G141V IC 1 human MDR1 25,80 Q145H IC 1 mouse mdr3 79 E155G, K IC 1 mouse mdr3 79 F159I IC 1 mouse mdr3 79 D174G IC 1 mouse mdr3 79 S176F, P IC 1 mouse mdr3 79 K177I IC 1 mouse mdr3 79 N179S IC1 mouse mdr3 79 N183S/G185V IC 1 human MDR1 81 G183D IC1 mouse mdr3 79 G185V IC 1 human MDR1 82-84 G187V IC 1 human MDR1 80 A192T TM 3 mouse mdr3 79 F204S EC 2 mouse mdr3 79 W208G EC 2 mouse mdr3 79 K209E EC 2 mouse mdr3 79 L210I TM 4 mouse mdr3 79 T211P TM 4 mouse mdr3 79 I214T TM 4 mouse mdr3 79 P223A TM 4 human MDR1 85 K285T IC 2 human MDR1 1 G288V IC 2 human MDR1 80 I299M, T319S, L322I, TM 5, EC3, IC 3 human MDR1 86 G324K, S351N V334 TM 6 human MDR1 1 F335A TM 6 human MDR1 25 F335 TM 6 human MDR1 87 V338A TM 6 human MDR1 88 G338A, A339P TM 6 hamster PGY 1 89,90 A339P TM 6 hamster PGY 1 90 G341V TM 6 human MDR1 88 K536R,Q N-NBD human MDR1 91 ERGA→DKGT N-NBD mouse mdr3 92 (aa 522-525) T578C N-NBD mouse mdr3 92 G812V IC 4 human MDR1 80 G830V IC 4 human MDR1 25,80 P866A TM 10 human MDR1 85 F934A TM 11 mouse mdr3 93 G935A TM 11 mouse mdr3 93 I936A TM 11 mouse mdr3 93 F938A TM 11 mouse mdr3 93 S939A TM 11 mouse mdr3 93 S939F TM 11 mouse mdr3 94,95 S941F TM 11 mouse mdr1 94,95 T941A TM 11 mouse mdr3 93 Q942A TM 11 mouse mdr3 93 Table 1-continued aaa Mutation Regionb Sourcec Reference A943G TM 11 mouse mdr3 93 Y946A TM 11 mouse mdr3 93 S948A TM 11 mouse mdr3 93 Y949A TM 11 mouse mdr3 93 C952A TM 11 mouse mdr3 93 F953A TM 11 mouse mdr3 93 F983A TM 12 human MDR1 96 L975A, V981A, F983A TM 12 human MDR1 96 M986A, V988A, TM 12 human MDR1 96 Q990A, V991A V981A, F983A TM 12 human MDR1 96 L975A, F983A TM 12 human MDR1 96 L975A, V981A TM 12 human MDR1 96 F978 TM 12 human MDR1 1 F978A TM 12 human MDR1 25 a aa, amino acid. Login to comment