ABCMdb

ABCC7 p.Gln98Arg

ClinVar:	c.293A>G , p.Gln98Arg ? , not provided c.292C>T , p.Gln98* D , Pathogenic c.293A>C , p.Gln98Pro ? , not provided
CF databases:	c.293A>C , p.Gln98Pro (CFTR1) D , This mutation was found by DHPLC and confirmed by sequencing. The adult male patient, from Southern Sweden, carries deltaF508 on the other chromosome. The patient has high sweat chloride (116 mmol/L), bronchiectasis and CBAVD. c.292C>T , p.Gln98* D , CF-causing c.293A>G , p.Gln98Arg (CFTR1) D , This mutation was found in one CF patient from Southern France, who carries [delta]F508 on the other gene. It creates a HaeIII restriction site (N : 290 +78 +70 bp), (m: 153 + 137 + 78 + 70 bp) when using the primers 4i5/4i3 from Zielinski. Also reported by Yoshimura & Azuma on 4/01/1000: This mutation was detected in one of the CFTR alleles of a 15-year old Japanese male patient with cystic fibrosis. He is pancreatic insufficient, has CBAVD, and his sweat chloride was high (74 mmol/L). Another mutation was not found despite the thorough evaluation for his entire 27 exons of the CFTR gene. Interestingly, he was heterozygous at the cDNA 125 in 5'UTR (i.e., 125G/125C), and this is the only difference from his healthy sister who is also heterozygous for Q98R mutation, but 125G/125G, suggesting that 125C may be disease-causing.
Predicted by SNAP2:	A: D (95%), C: D (95%), D: D (95%), E: D (95%), F: D (95%), G: D (95%), H: D (95%), I: D (95%), K: D (95%), L: D (95%), M: D (95%), N: D (95%), P: D (95%), R: N (78%), S: D (95%), T: D (95%), V: D (95%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: N, F: D, G: D, H: D, I: D, K: N, L: D, M: D, N: N, P: D, R: N, S: N, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Improved detection of CFTR mutations in Southern C... Hum Mutat. 2001 Oct;18(4):296-307. Wong LJ, Wang J, Zhang YH, Hsu E, Heim RA, Bowman CM, Woo MS
Improved detection of CFTR mutations in Southern California Hispanic CF patients.
Hum Mutat. 2001 Oct;18(4):296-307., [PMID:11668613]

Abstract [show]
Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene cause cystic fibrosis (CF), a common autosomal recessive disease in Caucasians. The broad mutation spectrum varies among different patient groups. Current molecular diagnoses are designed to detect 80-97% of CF chromosomes in Caucasians and Ashkenazi Jews but have a much lower detection rate in Hispanic CF patients. Grebe et al. [1994] reported a 58% detection rate in Hispanic patients. Since then, there has been no large-scale, complete mutational analysis of Hispanic CF patients. In this study, the mutations in 62 Hispanic patients from southern California were investigated. The entire coding and flanking intronic regions of the CFTR gene were analyzed by temporal temperature gradient gel electrophoresis (TTGE) followed by sequencing to identify the mutations. Eleven novel mutations were discovered in this patient group: 3876delA, 406-1G>A, 935delA, 663delT, 3271delGG, 2105-2117del13insAGAAA, 3199del6, Q179K, 2108delA, 3171delC, and 3500-2A>T. Among the mutations, seven were out-of-frame insertions and deletions that result in truncated proteins, two were splice-site mutations, one was an in-frame 6 bp deletion, and one was a missense mutation that involved the non-conservative change of glutamine-179 to lysine. All patients presented severe classical clinical course with pancreatic insufficiency and poor growth, consistent with the nature of truncation mutation. The results indicate that TTGE screening following the analysis of recurrent mutations will substantially improve the mutation detection rate for Hispanic CF patients from southern California.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
86 In addition, rare mutations including1949del84, Q98R, R75X, and G1244E, were also detected. Login to comment
117 Summary of Mutations Found in This Group of Hispanic Patients Exon or Number of Mutation intron chromosomes Frequency % Mutations detected before full gene analysis 91 73.38% 1 F508 10 64 51.6 2 G542X 11 5 4 3 3849+10kb C>T Intron 19 5 4 4 S549N 11 3 2.4 5 I148T 4 2 1.6 6 3120+1G>A 16 2 1.6 7 R334W 7 2 1.6 8 G551D 11 1 0.8 9 N1303K 21 1 0.8 10 W1282X 20 1 0.8 11 R1162X 19 1 0.8 12 G85E 3 1 0.8 13 W1089X 17b 1 0.8 14 Y1092X 17b 1 0.8 15 P205S 6a 1 0.8 Mutations detected by full gene screening 26 20.97% 16 R1066Ca 17b 2 1.6 17 1949del84 13 1 0.8 18 2184delA 13 1 0.8 19 Q98R 4 1 0.8 20 R75X 3 1 0.8 21 G1244E 20 1 0.8 22 3876delA 20 7 5.65 23 935delA 6b 2 1.6 24 406-1G>A Intron 2 2 1.6 25 3271delGG 17a 1 0.8 26 2105-2117del13insAGAAA 13 1 0.8 27 663delT 5 1 0.8 28 3171delC 17a 1 0.8 29 2108delA 13 1 0.8 30 Q179K 5 1 0.8 31 3199del6 17a 1 0.8 32 3500-2 A->T Intron 17b 1 0.8 Total identified 117 (177)b 94.35 (97.5)b Unidentified 7 (3)b 5.65 (2.5)b Total 124 (120)b 100 (100)b a This mutation was also detected by SSCP. Login to comment

[hide] A finger sweat chloride test for the detection of ... Pancreas. 2004 Apr;28(3):e80-5. Naruse S, Ishiguro H, Suzuki Y, Fujiki K, Ko SB, Mizuno N, Takemura T, Yamamoto A, Yoshikawa T, Jin C, Suzuki R, Kitagawa M, Tsuda T, Kondo T, Hayakawa T
A finger sweat chloride test for the detection of a high-risk group of chronic pancreatitis.
Pancreas. 2004 Apr;28(3):e80-5., [PMID:15084988]

Abstract [show]
OBJECTIVES: Mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene are associated with chronic pancreatitis in Caucasians. We developed a simple method for measuring finger sweat chloride concentration to test whether CFTR dysfunction underlies chronic pancreatitis in Japan where cystic fibrosis (CF) is rare. METHODS: We studied 25 patients with chronic (21 alcoholic and 4 idiopathic) pancreatitis and 25 healthy volunteers. Sweat chloride concentrations were measured by a finger sweat chloride test. We analyzed DNA for 20 common CFTR mutations in Europeans, 9 CF-causing mutations in Japanese, and 2 polymorphic loci, a poly-T tract and (TG) repeats, at intron 8. RESULTS: Thirteen patients (52%) had sweat chloride levels >60 mmol/L, a level consistent with CF, while only 4 (16%) healthy subjects exceeded this level. The 29 CF mutations and the 5T allele were detected in neither the patients nor controls. The (TG) 12 allele was common in both the patients (58%) and controls (48%). The (TG) 12/12 genotype was common in alcoholic pancreatitis (29%) compared with the (TG) 11/11 (10%). Patients with the (TG) 12/12 genotype had significantly higher sweat chloride concentrations than the controls. CONCLUSION: CFTR dysfunction as evidenced by a finger sweat chloride test is present in about half of Japanese patients with chronic pancreatitis, suggesting that this test may be useful for detecting the high-risk group. A higher proportion of the (TG) 12 allele may be a genetic background for elevated sweat chloride concentrations in Japanese patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 The 9 CF-causing mutations (R75X, Q98R, M152R, R347H, L441P, L571S, D979A, H1085R, and T1086I) in Japa- nese20,25-28 were screened by SNP typing with Masscode System (Shimadzu, Kyoto, Japan). Login to comment

[hide] Genetic evidence for CFTR dysfunction in Japanese:... J Med Genet. 2004 May;41(5):e55. Fujiki K, Ishiguro H, Ko SB, Mizuno N, Suzuki Y, Takemura T, Yamamoto A, Yoshikawa T, Kitagawa M, Hayakawa T, Sakai Y, Takayama T, Saito M, Kondo T, Naruse S
Genetic evidence for CFTR dysfunction in Japanese: background for chronic pancreatitis.
J Med Genet. 2004 May;41(5):e55., [PMID:15121783]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
219 The nine CF causing (R75X, Q98R, M152R, R347H, L441P, L571S, D979A, H1085R, and T1086I) and two non-CF causing (Q1352H and R1453W) mutations in Japanese6 22-24 were screened by SNP typing with a Masscode system (Shimadzu, Kyoto, Japan) and confirmed by sequence analysis in positive and equivocal cases. Login to comment

[hide] Preconception and prenatal cystic fibrosis carrier... Genet Med. 2004 May-Jun;6(3):141-4. Monaghan KG, Bluhm D, Phillips M, Feldman GL
Preconception and prenatal cystic fibrosis carrier screening of African Americans reveals unanticipated frequencies for specific mutations.
Genet Med. 2004 May-Jun;6(3):141-4., [PMID:15354332]

Abstract [show]
PURPOSE: It is recommended that cystic fibrosis (CF) carrier screening be made available to African Americans who are either pregnant or planning a pregnancy. We analyzed the carrier and mutant allele frequencies for African Americans undergoing CF carrier screening in our laboratories. METHODS: Between December 2001 and September 2003, we performed carrier screening for 2189 African Americans, testing for at least the 25 recommended mutations. RESULTS: A total of 33 CF carriers were identified. The most common mutations detected were deltaF508, G622D, R117H/7T, and G551D. The G622D allele frequency among African Americans was 0.18%. We did not detect any 3120 + 1G --> A carriers, although 4 were expected (P < 0.05). CONCLUSIONS: When considering only the 25 recommended CF mutations, 1 in 75 African Americans screened in our laboratories were carriers (within the expected range, given a 69% mutation detection rate). The addition of 2 mutations, G622D and Q98R (incidentally identified while screening for ACOG/ACMG mutations), increased the observed carrier frequency to 1 in 66, which is not significantly different from the known African American carrier frequency of 1 in 65. The frequencies of several specific mutations detected were unanticipated, as was the absence of 3120 + 1G --> A carriers. Further studies on African American patients with classic CF are needed to examine the incidence of CF mutations that are not part of the current panel, such as G622D.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 Three additional sequence changes, F693L (TTG), Q98R, and P140S(C3T), were incidentally detected by heteroduplex analysis while screening for ACOG/ ACMG CF mutations not included in the test kit used during the time of screening. Login to comment
45 Q98R has been reported to the CF Consortium as a disease causing mutation. Login to comment
51 R117H has been previously reported at an increased frequency among individuals undergoing carrier screening compared to those with a diagnosis of cystic fibrosis.8 An unexpected result was the lack of 3120ϩ1G3A carriers, although 4 were expected given that this mutation accounts for Ϸ12% of the CF muta- Table 1 Summary of carrier screening results using various methods employed between December 2001 and September 2003 OLA v2.0, heteroduplex analysis (exons 4 and 13) and RFLP analysis (3120ϩ1G3A) OLA v3.0 INNO-LiPA Total screened 818 1274 97 No. of carriers identified 16 14 3 Observed carrier frequency 1/51 1/81 Mutations identified ⌬F508 (6), G622D (3), R117H/7T (3), I148T (3199del6 negative), Q98R, 1898ϩ1G3A, and G551Da ⌬F508 (14), R117H/7T, R553X, and G551D a In addition, 2 persons were positive for F693L (TTG) and 1 was positive for P140S (C3T at 550); both are variants of unknown clinical significance. Login to comment
57 Two mutations, G622D and Q98R, and two variants of unknown clinical significance, F693L (TTG) and P140S (C3T), which are not part of the recommended CF screening panel, were incidentally detected while using heteroduplex analysis to screen for ACOG/ACMG recommended mutations (Table 2). Login to comment
65 P140S (C3T) has been reported in a patient with disseminated bronchiectasis, although it is not known if this mutation is associated with classic CF.9 Q98R has been reported previously as a CF mutation,12 although we are not aware of any reports of this mutation in African Americans. Login to comment

[hide] Identification of novel and rare mutations in Cali... Hum Mutat. 2004 Oct;24(4):353. Alper OM, Wong LJ, Young S, Pearl M, Graham S, Sherwin J, Nussbaum E, Nielson D, Platzker A, Davies Z, Lieberthal A, Chin T, Shay G, Hardy K, Kharrazi M
Identification of novel and rare mutations in California Hispanic and African American cystic fibrosis patients.
Hum Mutat. 2004 Oct;24(4):353., [PMID:15365999]

Abstract [show]
In ethnic heterogeneous California, complete genetic information is currently lacking to build solid population-based cystic fibrosis (CF) screening programs because a large proportion of mutations in the cystic fibrosis transmembrane conductance regulator gene (CFTR/ABCC7) are still unknown, especially in non-Caucasian patients. A total of 402 [46 African American+356 Hispanic] Hispanic and African American patients from California CF patient registry were included in this study. Patients with at least one unidentified mutant allele were asked to donate blood samples for further analysis, first by Genzyme Genetics for a panel of 87 known mutations, followed by temporal temperature gradient gel electrophoresis (TTGE) scanning of the entire coding exons of CFTR gene. A total of eight novel mutations; one missense mutation, one splice-site mutation and six frame-shift mutations were identified. In addition to the eight novel mutations, 20 [corrected] distinct rare mutations that are not in the current available commercial mutation panels were identified by TTGE. The overall detection rate was raised to 95.7% for African American and 94.5% for Hispanic. The discovery of recurrent rare and novel mutations improves the diagnosis and care of persons with CF and improves our ability to adequately and equitably provide screening and genetic counseling services to non-Caucasians.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
73 Mutations Not Included in 87-Mutation Panel Nucleotide change-position Traditional nomenclature Approved nomenclature Protein Mutation/Effect Exon/ Intron Number of chromosomes 136 C>T c.4C>T p.Gln2Ter nonsense mutation 1 1 355 C>T c.223C>T p.Arg75Ter nonsense mutation 3 1 406-1G>A c.274-1G>A splice mutation/ truncation int 3 9 (1 sib) 424 C>T c.292C>T p.Gln98Ter nonsense mutation 4 1 425 A>G c.293A>G p.Gln98Arg missense mutation 4 2 663 del T c.531delT p.Ile177fs frameshift/ truncation 5 2 (sib) 727 C>T c.595C>T p.His199Tyr missense mutation 6a 5 (1 sib) Nucleotide change-position Traditional nomenclature Approved nomenclature Protein Mutation/Effect Exon/ Intron Number of chromosomes 745 C>T c.613C>T p.Pro205Ser missense mutation 6a 4 1248+1G>A c.1116+1G>A splice mutation/ truncation 7 2 (sib) 1461 ins AGAT c.1326_1327ins4 p.Asp443fs frameshift/ truncation 9 1 1529 C>G c.1397C>G p.Ser466Ter nonsense mutation 10 1 1607 C>T c.1475C>T p.Ser492Phe missense mutation 10 3 1924 del 7bp c.1792_1798del7 p.Lys598fs frameshift/ truncation 13 2 (sib) 2055 del 9bp to A c.1923_1931del9 insA p.Ser641fs frameshift/ truncation 13 2 (homo) 2105_2117 del 13bp insAGAAA c.1973_1985del 13insAGAAA p.Arg658fs frameshift/ truncation 13 3 2184 ins A c.2052dupA p.Gln685fs frameshift/ truncation 13 2 (twin) 3272-26A>G c.3140-26A>G splice mutation/ truncation int 17a 4 (3 rel) 3313 G>C c.3181G>C p.Gly1061Arg missense mutation 17b 1 3431 A>C c.3299A>C p.Gln1100Pro missense mutation 17b 1 3743 G>A c.3611G>A p.Trp1204Ter nonsense mutation 19 5 (1 sib, 1 homo) 4382 del A c.4250delA p.E1417fs frameshift/ truncation 24 1 Sib:1 sibling pair; homo:homozygote; 3 rel: 3 relatives. Login to comment

[hide] Pharmacological induction of CFTR function in pati... Pediatr Pulmonol. 2005 Sep;40(3):183-96. Kerem E
Pharmacological induction of CFTR function in patients with cystic fibrosis: mutation-specific therapy.
Pediatr Pulmonol. 2005 Sep;40(3):183-96., [PMID:15880796]

Abstract [show]
CFTR mutations cause defects of CFTR protein production and function by different molecular mechanisms. Mutations can be classified according to the mechanisms by which they disrupt CFTR function. This understanding of the different molecular mechanisms of CFTR dysfunction provides the scientific basis for the development of targeted drugs for mutation-specific therapy of cystic fibrosis (CF). Class I mutations are nonsense mutations that result in the presence of a premature stop codon that leads to the production of unstable mRNA, or the release from the ribosome of a short, truncated protein that is not functional. Aminoglycoside antibiotics can suppress premature termination codons by disrupting translational fidelity and allowing the incorporation of an amino acid, thus permitting translation to continue to the normal termination of the transcript. Class II mutations cause impairment of CFTR processing and folding in the Golgi. As a result, the mutant CFTR is retained in the endoplasmic reticulum (ER) and eventually targeted for degradation by the quality control mechanisms. Chemical and molecular chaperones such as sodium-4-phenylbutyrate can stabilize protein structure, and allow it to escape from degradation in the ER and be transported to the cell membrane. Class III mutations disrupt the function of the regulatory domain. CFTR is resistant to phosphorylation or adenosine tri-phosphate (ATP) binding. CFTR activators such as alkylxanthines (CPX) and the flavonoid genistein can overcome affected ATP binding through direct binding to a nucleotide binding fold. In patients carrying class IV mutations, phosphorylation of CFTR results in reduced chloride transport. Increases in the overall cell surface content of these mutants might overcome the relative reduction in conductance. Alternatively, restoring native chloride pore characteristics pharmacologically might be effective. Activators of CFTR at the plasma membrane may function by promoting CFTR phosphorylation, by blocking CFTR dephosphorylation, by interacting directly with CFTR, and/or by modulation of CFTR protein-protein interactions. Class V mutations affect the splicing machinery and generate both aberrantly and correctly spliced transcripts, the levels of which vary among different patients and among different organs of the same patient. Splicing factors that promote exon inclusion or factors that promote exon skipping can promote increases of correctly spliced transcripts, depending on the molecular defect. Inconsistent results were reported regarding the required level of corrected or mutated CFTR that had to be reached in order to achieve normal function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 C-D565G II DF508 D1507 S549R S549I S549N S549R S945D S945L H1054D G1061R L1065P R1066C R1066M L1077P H1085R N1303K G85E III G551D S492F V520F R553G R560T R560S Y569D IV R117H, R117C, R117P, R117L D1152H, L88S, G91R, E92K, Q98R, P205S, L206W, L227R, F311L, G314E, R334W, R334Q, I336K, T338I, L346P, R347C, R347H, R347L, R347P, L927P, R1070W, R1070Q V 3849 þ 10 kb C ! Login to comment

[hide] Report of a Korean patient with cystic fibrosis, c... J Korean Med Sci. 2006 Jun;21(3):563-6. Koh WJ, Ki CS, Kim JW, Kim JH, Lim SY
Report of a Korean patient with cystic fibrosis, carrying Q98R and Q220X mutations in the CFTR gene.
J Korean Med Sci. 2006 Jun;21(3):563-6., [PMID:16778407]

Abstract [show]
Although cystic fibrosis (CF) is one of the most frequently seen autosomal-recessive disorders in Caucasians, it is extremely rare in the Korean population. Recently, a 15-yr-old Korean boy was admitted to our hospital complaining of coughing, sputum, and exertional dyspnea. Chest radiographs and computed tomographic chest and paranasal sinus scans revealed diffuse bronchiectasis and pansinusitis. Pulmonary function tests revealed severe obstructive impairment. The average sweat chloride concentrations on both of the patients' forearms were 63.0 mM/L (reference limit: < 40 mM/L). Upon mutation analysis, two different mutations (Q98R and Q220X) were identified in the cystic fibrosis transmembrane conductance regulator gene, both of which had been previously detected in CF patients, one from France and the other from England. As CF is quite rare in Korea, the diagnosis of CF in this patient might be delayed. Therefore, we recommend that a diagnosis of CF should be suspected in patients exhibiting unexplained chronic respiratory symptoms.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
15 Chest radiographs and computed tomographic (CT) scans of the chest, performed without intravenous contrast mate- Won-Jung Koh, Chang-Seok Ki*, Jong-Won Kim*, Jeong-Ho Kim� , Seong Yong Lim� Division of Pulmonary and Critical Care Medicine, Department of Medicine and Department of Laboratory Medicine*, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul; Department of Laboratory Medicine � , Yongdong Severance Hospital, Yonsei University College of Medicine, Seoul; Division of Pulmonary and Critical Care Medicine � , Department of Medicine, Kangbuk Samsung Hospital, Sungkyunkwan University School of Medicine, Seoul, Korea Address for correspondence Chang-Seok Ki, M.D. Department of Laboratory Medicine, Samsung Medical Center, Sungkyunkwan University School of Medicine, 50 Irwon-dong, Gangnam-gu, Seoul 135-710, Korea Tel : +82.2-3410-2710, Fax : +82.2-3410-2719 E-mail : changski@skku.edu 563 J Korean Med Sci 2006; 21: 563-6 ISSN 1011-8934 Copyright � The Korean Academy of Medical Sciences Report of a Korean Patient with Cystic Fibrosis, Carrying Q98R and Q220X Mutations in the CFTR Gene Although cystic fibrosis (CF) is one of the most frequently seen autosomal-recessive disorders in Caucasians, it is extremely rare in the Korean population. Login to comment
20 Upon mutation analysis, two different mutations (Q98R and Q220X) were identified in the cystic fibrosis transmembrane conductance regulator gene, both of which had been previously detected in CF patients, one from France and the other from England. Login to comment
34 Direct sequencing analysis of all coding exons and their flanking intronic sequences demonstrated that the patient possessed two mutations in his CFTR gene (Fig. 2): a heterozygous A to G transition in exon 4 (c.293A>G; Q98R) and a heterozygous C to T transition in exon 6a (c.658C>T; Q220X). Login to comment
35 A family study demonstrated that the patient`s father and elder brother both also possessed the Q98R mutation, whereas his mother harbored the Q220X mutation. Login to comment
37 Based on our search of the Cystic Fibrosis Mutation Database (http://www.genet.sickkids.on.ca/cftr/), Q98R and Q220X mutations have been reported in CF patients from Southern France and Southern England (8, 9). Login to comment
43 A B Q98R/- Q98R/- -/- Q98R/Q220X -/Q220X Fig. 2. Login to comment
45 A heterozygous Q98R mutation is found in the father, brother, and the proband, and another heterozygous Q220X mutation is found in the mother and the proband. Login to comment
56 In the present study, we report two additional mutations in the list of CFTR gene mutations (Q98R and Q220X), which have been identified in Koreans. Login to comment

[hide] Negative genetic neonatal screening for cystic fib... Clin Genet. 2007 Oct;72(4):374-7. Girardet A, Guittard C, Altieri JP, Templin C, Stremler N, Beroud C, des Georges M, Claustres M
Negative genetic neonatal screening for cystic fibrosis caused by compound heterozygosity for two large CFTR rearrangements.
Clin Genet. 2007 Oct;72(4):374-7., [PMID:17850636]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
77 Report of a Korean patient with cystic fibrosis, carrying Q98R and Q220X mutations in the CFTR gene. Login to comment

[hide] [Standardized sweat chloride analysis for the diag... Korean J Lab Med. 2008 Aug;28(4):274-81. Kim SJ, Lee M, Cha SI, Park HY, Ahn KM, Ki CS, Kim JH
[Standardized sweat chloride analysis for the diagnosis of cystic fibrosis in Korea].
Korean J Lab Med. 2008 Aug;28(4):274-81., [PMID:18728376]

Abstract [show]
BACKGROUND: Cystic fibrosis is a chronic progressive autosomal recessive disorder caused by the CFTR gene mutations. It is quite common in Caucasians, but very rare in Asians. Sweat chloride test is known to be a screening test for the cystic fibrosis due to the fact that electrolyte levels in sweat are elevated in patients. In this study, sweat chloride levels in Korean population were measured and analyzed by using standardized pilocarpine iontophoresis sweat chloride test. METHODS: The sweat chloride test was performed in 47 patients referred to Yondong Severance Hospital from August, 2001 to April, 2007 and 41 healthy volunteers. The sweat chloride tests were conducted according to the CLSI C34-A2 guideline using pilocarpine iontophoresis method, and the chloride concentrations in sweat were measured by mercurimetric titration. RESULTS: Four patients showed sweat chloride concentrations higher than 60 mmol/L. Reference interval was calculated as 1.4-44.5 mmol/L by analysis of the results of healthy volunteers (n=41). Four patients who exhibited high sweat chloride levels, had characteristic clinical features of cystic fibrosis and their diagnoses were confirmed either by repeated sweat chloride test or genetic analysis. CONCLUSIONS: Standardized sweat chloride test can be utilized as a useful diagnostic tool for cystic fibrosis in Koreans. In cases of sweat chloride levels higher than 40 mmol/L, the test should be repeated for the possible diagnosis of cystic fibrosis. All the confirmed Korean cases of cystic fibrosis showed sweat chloride level above 60 mmol/L.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Healthy volunteer No. case Sex Age (yr) Sweat chloride concentration (mmol/L) Right (repeated result)/Left (repeated result) Respiratory symptoms* Gastro-intestinal symptoms � Genetic analysis 1 � F 13 108.1 (105.9)/169.1 (87.5) + + Compound heterozygote (X1291/5T-V470) 2 � F 5 97.5 (75.4)/92.4 (79.5) + - Polymorphism (2694T/G) 3 � M 15 73.7 (66.2)/29.5 (59.9) + - Compound heterozygote (Q98R/Q220X) 4 F 17 99.3/105.6 + - Compound heterozygote (delEx14A/IVS17a-26A>G) Table 2. The clinical features of patients with high sweat chloride concentrations *Cough, sputum, etc; � , diarrhea, steatorrhea, etc. Login to comment
167 Koh WJ, Ki CS, Kim JW, Kim JH, Lim SY. Report of a Korean patient with cystic fibrosis, carrying Q98R and Q220X mutations in the CFTR gene. Login to comment

[hide] Unique mutations of the cystic fibrosis transmembr... Intern Med. 2009;48(15):1327-31. Epub 2009 Aug 3. Izumikawa K, Tomiyama Y, Ishimoto H, Sakamoto N, Imamura Y, Seki M, Sawai T, Kakeya H, Yamamoto Y, Yanagihara K, Mukae H, Yoshimura K, Kohno S
Unique mutations of the cystic fibrosis transmembrane conductance regulator gene of three cases of cystic fibrosis in Nagasaki, Japan.
Intern Med. 2009;48(15):1327-31. Epub 2009 Aug 3., [PMID:19652440]

Abstract [show]
Cystic fibrosis (CF), the most common lethal hereditary disorder in Caucasians, is quite rare in Southeast Asia including Japan. Here, we report three CF cases encountered in Nagasaki, Japan. Case 1; a 24-year-old man with dyspnea and cough was diagnosed as CF with a missense mutation Q98R in exon 4 and a polymorphic 125C in exon 1 in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Case 2; a 13-year-old woman born of consanguineous parents was diagnosed as CF with homozygous Q98R mutations in exon 4. Case 3; a 29-year-old woman complaining of cough and sputum was diagnosed as CF with a heterozygous R347H mutation in exon 7 and a polymorphic 125C in exon 1. These mutations have been previously reported in Caucasian patients, but are considered very rare. Although the numbers of individuals with CF are very limited, the profiles of CFTR mutations in those patients are likely diverse in Japan.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 Case 1; a 24-year-old man with dyspnea and cough was diagnosed as CF with a missense mutation Q98R in exon 4 and a polymorphic 125C in exon 1 in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Login to comment
3 Case 2; a 13-year-old woman born of consanguineous parents was diagnosed as CF with homozygous Q98R mutations in exon 4. Login to comment
37 Missense mutation Q98R was detected in exon 4 and polymorphic 125C was present in exon 1 by CFTR mutation screening. Login to comment
38 Further analysis revealed that Q98R was derived from his father and 125C from his mother. Login to comment
39 Heterozygous Q98R was also recognized in his otherwise healthy elder sister. Login to comment
47 The presence of missense mutation Q98R was detected in a homozygous fashion in exon 4 of Figure2. Login to comment
52 Her father possessed heterozygous Q98R mutation (test was not performed to mother). Login to comment
66 Locus of CFTR mutationCase Age Sex CP sinusitis CBAVD PFD test (%) sweat chloride concentration (mmol/L) Mutation (variant) Exon Mutation (variant) Exon 1 24 M - + + 17.0 94.0 125C 1 Q98R 4 2 13 F + - - 67.0 54.8 Q98R 4 Q98R 4 3 29 F - + - 69.8 60.0 125C 1 R347H 7 CP, consanguineous parents; CBAVD, congenital bilateral absence of the vas deferens; PFD, pancreatic functional diagnostant. Login to comment
69 SummaryofThreeCysticFibrosisCases The CFTR Q98R mutation was first reported by Romey et al (13), and the patient possessed F508del mutation on the other allele. Login to comment
71 Although father and elder sister of the patient carried the same Q98R mutation heterozygously, they were phenotypically healthy. Login to comment
75 In Case 2, the Q98R mutation was detected homozygously and it was likely due to the consanguineous marriage of her parents. Login to comment
78 No cases with Q98R homozygous mutation in CFTR gene was reported among Japanese CF patients in the JIDRF surveillance (unpublished data). Login to comment
81 The common findings observed in these two cases with Q98R were the distribution of lung lesions and the pattern of onset. Login to comment

[hide] The L441P mutation of cystic fibrosis transmembran... J Korean Med Sci. 2010 Jan;25(1):166-71. Epub 2009 Dec 26. Gee HY, Kim CK, Kim SW, Lee JH, Kim JH, Kim KH, Lee MG
The L441P mutation of cystic fibrosis transmembrane conductance regulator and its molecular pathogenic mechanisms in a Korean patient with cystic fibrosis.
J Korean Med Sci. 2010 Jan;25(1):166-71. Epub 2009 Dec 26., [PMID:20052366]

Abstract [show]
Cystic fibrosis (CF) is an autosomal recessive disorder usually found in populations of white Caucasian descent. CF is caused by mutations in the Cystic Fibrosis Transmembrane conductance Regulator (CFTR) gene. A 5-yr-old Korean girl was admitted complaining of coughing and greenish sputum. Chest radiographs and computed tomographic (CT) scan revealed diffuse bronchiectasis in both lungs. The patient had chronic diarrhea and poor weight gain, and the abdominal pancreaticobiliary CT scan revealed atrophy of the pancreas. Finally, CF was confirmed by the repeated analysis of the quantitative pilocarpine iontophoresis test. The chloride concentration of sweat samples taken from both forearms of the pateint was an average of 88.7 mM/L (normal value <40 mM/L). After a comprehensive search for mutations in the CFTR gene, the patient was found to carry the non-synonymous L441P mutation in one allele. Molecular physiologic analysis of the L441P mutation of CFTR revealed that the L441P mutation completely abolished the CFTR Cl(-) channel activity by disrupting proper protein folding and membrane trafficking of CFTR protein. These results confirmed the pathogenicity of the L441P mutation of CFTR circulating in the Korean population. The possibility of CF should be suspected in patients with chronic bronchiectasis, although the frequency of CF is relatively rare in East Asia.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
164 Report of a Korean patient with cystic fibrosis, carrying Q98R and Q220X mutations in the CFTR gene. Login to comment

[hide] An update on cystic fibrosis screening. Clin Lab Med. 2010 Sep;30(3):533-43. Goetzinger KR, Cahill AG
An update on cystic fibrosis screening.
Clin Lab Med. 2010 Sep;30(3):533-43., [PMID:20638569]

Abstract [show]
Cystic fibrosis (CF) is a monogenic, autosomal recessive disorder, which ultimately leads to multisystem organ dysfunction and a subsequent decrease in life expectancy. Because of the sizeable number of disease causing mutations (>1000) and expansive ethnic and racial distribution, CF has presented a challenge for prenatal diagnosis. This article aims to review the genetics of CF, its spectrum of genotypic-phenotypic variations, current prenatal carrier screening and diagnostic recommendations, ultrasonographic markers of CF, and available reproductive options for carrier couples.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
32 Two additional mutations also not included in the current carrier screening panel, G622D and Q98R, were incidentally identified. Login to comment

[hide] Association between cystic fibrosis transmembrane ... Yonsei Med J. 2010 Nov;51(6):912-7. Kim KW, Lee JH, Lee MG, Kim KH, Sohn MH, Kim KE
Association between cystic fibrosis transmembrane conductance regulator gene mutations and susceptibility for childhood asthma in Korea.
Yonsei Med J. 2010 Nov;51(6):912-7., [PMID:20879059]

Abstract [show]
PURPOSE: Classic cystic fibrosis is now known part of cystic fibrosis transmembrane conductance regulator (CFTR)-related disorders. These include a wide spectrum, from multi-system disorders, such as cystic fibrosis, to mono-symptomatic conditions, such as chronic pancreatitis or congenital bilateral absence of the vas deferens. However, respiratory disease is considered typical for the multi system disorder, cystic fibrosis, and is the major cause of morbidity and mortality. The purpose of this study was to evaluate the potential effects of CFTR gene mutations in Korean children with asthma. MATERIALS AND METHODS: We selected 14 mutations identified in Korea and each of the 48 children with and without asthma were genotyped for the case-control study. RESULTS: No significant differences were found in genotype and allele frequencies of the 9 polymorphisms observed between the non-asthma and asthma groups. In a haplotype determination based on a Bayesian algorithm, 8 haplotypes were assembled in the 98 individuals tested. However, we also did not find any significant differences in haplotype frequencies between the non-asthma and asthma groups. CONCLUSION: We have concluded that this study did not show any evidence in support of providing that CFTR genetic variations significantly contribute to the susceptibility of asthma in Korean children.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
48 Among the 14 mutations, there are no mutant variants in Q98R, I125T, A309, Q220X, and Q1291X loci in our sample and the genotype frequencies of the remaining variants are listed in Table 3. Login to comment
53 CFTR Genetic Variations Analyzed in This Study Name Nucleotide change Exon Consequence Reference - 8G / C G to C at 125 5` UTR sequence variation 9 Q98R A to G at 425 Exon 4 Gln to Arg at 98 8 I125T T to C at 506 Exon 4 Ile to Thr at 125 9 E217G A to G at 782 Exon 6a Glu to Gly at 217 9 Q220X C to T at 790 Exon 6a Gln to Stop at 220 7, 8 A309A C or G at 1059 Exon 7 Sequence variation 9 TG repeat TG10-13 IVS 8 Splicing 9 T repeat T5-9 IVS 8 Splicing 9 M470V A or G at 1540 Exon 10 Met to Val at 470 9 I556V A to G at 1798 Exon 11 Ile to Val at 556 9 T854T T to G at 2694 Exon 14a Sequence variation 9 Q1291X C to T at 4003 Exon 20 Gln to Stop at 1291 9 Q1352H G to C at 4188 Exon 22 Gln to His at 1352 9 R1453W C to T at 4489 Exon 24 Arg to Trp at 1453 9 CFTR,cysticfibrosistransmembraneconductanceregulator. Login to comment

[hide] Heterogeneous spectrum of CFTR gene mutations in K... Korean J Lab Med. 2011 Jul;31(3):219-24. Epub 2011 Jun 28. Jung H, Ki CS, Koh WJ, Ahn KM, Lee SI, Kim JH, Ko JS, Seo JK, Cha SI, Lee ES, Kim JW
Heterogeneous spectrum of CFTR gene mutations in Korean patients with cystic fibrosis.
Korean J Lab Med. 2011 Jul;31(3):219-24. Epub 2011 Jun 28., [PMID:21779199]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is one of the most common hereditary disorders among Caucasians. The most common mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene have been well established among Caucasian populations. In Koreans, however, there are very few cases of genetically confirmed CF thus far, and the spectrum of mutations seems quite different from that observed in Caucasians. METHODS: In the present study, we describe the cases of 2 Korean CF patients, present sequencing results identifying mutations in their CFTR gene, and summarize the results of CFTR mutational spectrum from previously reported Korean CF patients. The mutations described were identified by performing direct sequencing analysis of the complete coding regions and flanking intronic sequences of the CFTR gene, followed by multiplex ligation-dependent probe amplification (MLPA) analysis in order to detect gene deletions or duplications that could not be identified by a direct sequencing method. RESULTS: Three CFTR mutations were identified in the 2 patients, including p.Q98R, c.2052delA, and c.579+5G>A. In an analysis of 9 Korean CF patients that included the 2 patients presented in this study, p.Q98R mutation was the only recurrently observed mutation with a frequency of 18.8% (3/16 alleles). Furthermore, only one of the mutations (c.3272-26A>G) was found among the 32 common mutations in the screening panel for Caucasians from the Cystic Fibrosis Mutation Database. CONCLUSIONS: Sequencing of the entire CFTR gene followed by MLPA analysis, rather than using the targeted sequencing-based screening panel for mutations commonly found in Caucasian populations, is recommended for genetic analysis of Korean CF patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
54 RESULTS 1.Geneticanalysisofthe2Koreanpatients Two mutations in the CFTR gene were found in Patient 1: a heterozygous A to G transition in exon 4 [c.293A>G (p. Q98R)] and a heterozygous deletion of an A in exon 13 [c.2052delA (p.L728NfsX38)]. Login to comment
89 Aminoacid change Exon Nucleotide number Nucleotide change Typeof mutation Method ofdetection Familialtargetedmutationstudy Ref Father Mother Brother Sister 1 Q98R Exon4 293 A>G Missense Sequencing ND - - NA Thisstudy L728NfsX38 Exon13 2,052 delA Frameshift Sequencing ND + + NA 2 IVS4 579+5 G>A Splicing Sequencing ND ND NA NA Thisstudy 3 Q98R Exon4 293 A>G Missense Sequencing + - + - [15] Q220X Exon6a 658 C>T Nonsense Sequencing - + - - 4 Q98R Exon4 293 A>G Missense Sequencing + - NA NA [16] Q1352H Exon24 4,056 G>C Missense Sequencing - + NA NA 5 IVS12 1,766+2 T>C Splicing Sequencing + - NA NA [18] N1303KfsX6 Exon21 3,908 dupA Frameshift Sequencing - + NA NA 6 IVS17a 3,272-26 A>G Splicing Sequencing MLPA ND ND NA NA [17] Exon14a 2,623-2,751+? Login to comment
4 Results:ThreeCFTRmutationswereidentifiedinthe2patients,includingp.Q98R,c.2052delA,andc.579+5G>A.Inananalysisof9 Korean CF patients that included the 2 patients presented in this study, p.Q98R mutation was the only recurrently observed mutation with a frequency of 18.8% (3/16 alleles). Login to comment
58 Our search of the Cystic Fibrosis Mutation Database [20] showed that the p.Q98R and c.2052delA mutations have also been reported in CF patients from France. Login to comment
81 The identified mutations included 3 missense mutations (p.Q98R, p.Q1352H, and p.L441P), 3 nonsense mutations (p.Q220X, p.Q1291X, and p.L88X), 1 duplication with frameshift (c.3908dupA), 1 insertion with frameshift (c.2089-2090insA), 4 splice site mutations (c.1766+2T>C, c.3272-26A>G, c.579+5G>A, and IVS8-T5) and 2 deletion mutations (c.2052delA and c.2623-?_2751+?del). Login to comment
82 The p.Q98R mutation was the only recurrently observed mutation, with a frequency of 18.8% (3/16 alleles). Login to comment
96 No mutation, except p.Q98R, has repeatedly been observed in Korean CF patients in this study. Login to comment
123 In summary, we report the cases of 2 Korean CF patients with 3 known CFTR mutations (p.Q98R, c.2052delA, and c.579+5G>A), and these mutations have been submitted to the Cystic Fibrosis Mutation Database [20]. Login to comment

[hide] Detection of CFTR mutations using temporal tempera... Electrophoresis. 2004 Aug;25(15):2593-601. Wong LJ, Alper OM
Detection of CFTR mutations using temporal temperature gradient gel electrophoresis.
Electrophoresis. 2004 Aug;25(15):2593-601., [PMID:15300780]

Abstract [show]
Cystic fibrosis (CF), caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, is one of the most common autosomal recessive diseases with variable incidences and mutation spectra among different ethnic groups. Current commercially available mutation panels designed for the analysis of known recurrent mutations have a detection rate between 38 to 95%, depending upon the ethnic background of the patient. We describe the application of a novel mutation detection method, temporal temperature gradient gel electrophoresis (TTGE), to the study of the molecular genetics of Hispanic CF patients. TTGE effectively identified numerous rare and novel mutations and polymorphisms. One interesting observation is that the majority of the novel mutations are splice site, frame shift, or nonsense mutations that cause severe clinical phenotypes. Our data demonstrate that screening of the 27 exons and intron/exon junctions of the CFTR gene by TTGE greatly improves the molecular diagnosis of Hispanic CF patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
89 For example, the p.Q98X and p.Q98R mutations in exon 4; and p.S466X and p.S492F mutations in exon 10, were detected in the temperature range of 52-607C and 51- 577C, respectively. The p.G542X, p.R553X, p.S549N, and p.A559T in exon 11; p.A561E, c.189811G.A, and c.189813A.G in exon 12; and p.W1204X in exon 19; were detected in the temperature range of 51 to 567C. Login to comment
133 Identification of rare and novel mutations and polymorphisms Base substitution Mutation Exon or intron Homozygote or heterozygote Polymorphism or mutation # Alleles identified 1 c.124_146del23bp Frameshift 1 Heterozygote Mutation 1 2 c.296+2T>A Splice Int 2 Heterozygote Mutation 1 3 c.296+28A/G Int 2 Homozygote Polymorphism 2 4 c.355CT p.R75X 3 Heterozygote Mutation 2 5 c.360_365insT Frameshift 3 Heterozygote Mutation 1 6 c.379_381insT Frameshift 3 Heterozygote Mutation 1 7 c.406-1G>A Splice Int 4 Heterozygote Mutation 2 8 c.424C.T p.Q98X 4 Heterozygote Mutation 1 9 c.425A.G p.Q98R 4 Heterozygote Mutation 3 10 c.586A.G p.M152V 4 Homozygote Mutation 2 11 c.663delT Frameshift 5 Heterozygote Mutation 3 12 c.667C>A p.Q179K 5 Heterozygote Mutation, 1 13 c.745C.T p.P205S 6a Heterozygote Mutation 5 14 c.875140A/G 6a Heterozygote Polymorphism 11 15 c.935delA Frameshift 6b Heterozygote Mutation 2 16 c.124811G.A Splice Int 7 Heterozygote Mutation 2 17 c.1285ins TA Frameshift 8 Heterozygote Mutation 4 Homozygote Mutation 2 18 c.1342+196C/T Int 8 Heterozygote Polymorphism 4 Homozygote 2 19 c.1461insAGAT Frameshift 9 Heterozygote Mutation 1 20 c.1525-61A/G 10 Heterozygote Polymorphism 22 21 c.1529C.A/G p.S466X 10 Heterozygote Mutation 1 22 c.1607C.T p.S492F 10 Heterozygote Mutation 3 23 c.1814C.T p.A561E 12 Heterozygote Mutation 1 24 c.189813A.G Splice Int 12 Heterozygote Mutation 1 25 c.18981152T/A Int 12 Heterozygote Polymorphism 5 26 c.1924del 7bp Frameshift 13 Heterozygote Mutation 1 27 c.1949del84 Frameshift 13 Heterozygote Mutation 1 28 c.2055del9toA Frameshift 13 Homozygote Mutation 2 29 c.2105_2117 Frameshift 13 Heterozygote Mutation 4 del13insAGAAA 30 c.2108delA Frameshift 13 Heterozygote Mutation 1 31 c.2184insA Frameshift 13 Heterozygote Mutation 2 32 c.2184delA Frameshift 13 Heterozygote Mutation 1 33 c.2289_2295 Frameshift 13 Heterozygote Mutation 1 del7insGT 34 c.2694T.G p.T854T 14a Heterozygote Polymorphism 10 35 c.2752+12G/C Int 14a Heterozygote Polymorphism 2 36 c.2800C.T p.Q890X 15 Homozygote Mutation 2 37 c.3171delC Frameshift 17a Heterozygote Mutation 1 38 c.3179T>C p.F1016S 17a Heterozygote Mutation 1 39 c.3199del 6bp Frameshift 17a Heterozygote Mutation 1 40 c.3212T.C p.I1027T 17a Heterozygote Mutation 1 41 c.3272-26A.G Splice Int17a Heterozygote Mutation 4 42 c.3271delGG Frameshift 17a Heterozygote Mutation 1 43 c.3313G.C p.G1061R 17b Heterozygote Mutation 1 44 c.3328C.T p.R1066C 17b Heterozygote Mutation 2 45 c.3362T.C p.L1077P 17b Heterozygote Mutation 1 46 c.3431A.C p.Q1100P 17b Heterozygote Mutation 1 47 c.3500-2A>T Splice Int 17b Heterozygote Mutation 1 48 c.3743G.A p.W1204X 19 Heterozygote Mutation 1 Homozygote Mutation 2 49 c.3601-65C/A Int 19 Heterozygote Polymorphism 14 50 c.3863G.A p.G1244E 20 Heterozygote Mutation 3 Table 3. Login to comment

[hide] Spectrum of mutations in the CFTR gene in cystic f... Ann Hum Genet. 2007 Mar;71(Pt 2):194-201. Alonso MJ, Heine-Suner D, Calvo M, Rosell J, Gimenez J, Ramos MD, Telleria JJ, Palacio A, Estivill X, Casals T
Spectrum of mutations in the CFTR gene in cystic fibrosis patients of Spanish ancestry.
Ann Hum Genet. 2007 Mar;71(Pt 2):194-201., [PMID:17331079]

Abstract [show]
We analyzed 1,954 Spanish cystic fibrosis (CF) alleles in order to define the molecular spectrum of mutations in the CFTR gene in Spanish CF patients. Commercial panels showed a limited detection power, leading to the identification of only 76% of alleles. Two scanning techniques, denaturing gradient gel electrophoresis (DGGE) and single strand conformation polymorphism/hetroduplex (SSCP/HD), were carried out to detect CFTR sequence changes. In addition, intragenic markers IVS8CA, IVS8-6(T)n and IVS17bTA were also analyzed. Twelve mutations showed frequencies above 1%, p.F508del being the most frequent mutation (51%). We found that eighteen mutations need to be studied to achieve a detection level of 80%. Fifty-one mutations (42%) were observed once. In total, 121 disease-causing mutations were identified, accounting for 96% (1,877 out of 1,954) of CF alleles. Specific geographic distributions for the most common mutations, p.F508del, p.G542X, c.1811 + 1.6kbA > G and c.1609delCA, were confirmed. Furthermore, two other relatively common mutations (p.V232D and c.2789 + 5G > A) showed uneven geographic distributions. This updated information on the spectrum of CF mutations in Spain will be useful for improving genetic testing, as well as to facilitate counselling in people of Spanish ancestry. In addition, this study contributes to defining the molecular spectrum of CF in Europe, and corroborates the high molecular mutation heterogeneity of Mediterranean populations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
52 Mutation 0.46-0.35 9 c.1078delT #, p.R347P # 8 p.G85V, c.621 + 1G > T #, p.S549R (T > G) #, p.R553X #, c.3849 + 10kbC > T # 7 p.R347H #, c.1812-1G > A, p.R709X 0.30-0.10 6 p.H199Y, p.P205S, 5 p.R117H #, p.G551D #, p.W1089X, p.Y1092X, CFTR50kbdel 4 c.296 + 3insT, c.1717-1G > A #, c.1949del84, c.3849 + 1G > A 3 p.E92K, c.936delTA, c.1717-8G > A, c.1341G > A, p.A561E, c.2603delT, p.G1244E, [p.D1270N; p.R74W] 2 p.Q2X, p.P5L, CFTRdele2,3, p.S50P, p.E60K, c.405 + 1G > A, c.1677delTA, p.L558S, p.G673X, p.R851X, p.Y1014C, p.Q1100P, p.M1101K, p.D1152H, CFTRdele19, p.G1244V, p.Q1281X, p.Y1381X <0,1 1 c.124del23bp, p.Q30X, p.W57X, c.406-1G > A, p.Q98R, p.E115del, c.519delT, p.L159S, c.711 + 3A > T, p.W202X, c.875 + 1G > A, p.E278del, p.W361R, c.1215delG, p.L365P, p.A399D, c.1548delG, p.K536X, p.R560G, c.1782delA, p.L571S, [p.G576A; p.R668C], p.T582R, p.E585X, c.1898 + 1G > A, c.1898 + 3A > G, c.2051delTT, p.E692X, p.R851L, c.2711delT, c.2751 + 3A > G, c.2752-26A > G, p.D924N, p.S945L, c.3121-1G > A, p.V1008D, p.L1065R, [p.R1070W; p.R668C], [p.F1074L; 5T], p.H1085R, p.R1158X, c.3659delC #, c.3667del4, c.3737delA, c.3860ins31, c.3905insT #, c.4005 + 1G > A, p.T1299I, p.E1308X, p.Q1313X, c.4095 + 2T > A, rearrangements study (n = 4) Mutations identified in CF families with mixed European origin: c.182delT, p.L1254X, c.4010del4. Login to comment

[hide] Genotyping microarray for the detection of more th... J Mol Diagn. 2005 Aug;7(3):375-87. Schrijver I, Oitmaa E, Metspalu A, Gardner P
Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations.
J Mol Diagn. 2005 Aug;7(3):375-87., [PMID:16049310]

Abstract [show]
Cystic fibrosis (CF), which is due to mutations in the cystic fibrosis transmembrane conductance regulator gene, is a common life-shortening disease. Although CF occurs with the highest incidence in Caucasians, it also occurs in other ethnicities with variable frequency. Recent national guidelines suggest that all couples contemplating pregnancy should be informed of molecular screening for CF carrier status for purposes of genetic counseling. Commercially available CF carrier screening panels offer a limited panel of mutations, however, making them insufficiently sensitive for certain groups within an ethnically diverse population. This discrepancy is even more pronounced when such carrier screening panels are used for diagnostic purposes. By means of arrayed primer extension technology, we have designed a genotyping microarray with 204 probe sites for CF transmembrane conductance regulator gene mutation detection. The arrayed primer extension array, based on a platform technology for disease detection with multiple applications, is a robust, cost-effective, and easily modifiable assay suitable for CF carrier screening and disease detection.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS. Login to comment

[hide] Diagnostic testing by CFTR gene mutation analysis ... J Mol Diagn. 2005 May;7(2):289-99. Schrijver I, Ramalingam S, Sankaran R, Swanson S, Dunlop CL, Keiles S, Moss RB, Oehlert J, Gardner P, Wassman ER, Kammesheidt A
Diagnostic testing by CFTR gene mutation analysis in a large group of Hispanics: novel mutations and assessment of a population-specific mutation spectrum.
J Mol Diagn. 2005 May;7(2):289-99., [PMID:15858154]

Abstract [show]
Characterization of CFTR mutations in the U.S. Hispanic population is vital to early diagnosis, genetic counseling, patient-specific treatment, and the understanding of cystic fibrosis (CF) pathogenesis. The mutation spectrum in Hispanics, however, remains poorly defined. A group of 257 self-identified Hispanics with clinical manifestations consistent with CF were studied by temporal temperature gradient electrophoresis and/or DNA sequencing. A total of 183 mutations were identified, including 14 different amino acid-changing novel variants. A significant proportion (78/85) of the different mutations identified would not have been detected by the ACMG/ACOG-recommended 25-mutation screening panel. Over one third of the mutations (27/85) occurred with a relative frequency >1%, which illustrates that the identified mutations are not all rare. This is supported by a comparison with other large CFTR studies. These results underscore the disparity in mutation identification between Caucasians and Hispanics and show utility for comprehensive diagnostic CFTR mutation analysis in this population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
98 Spectrum of CFTR Sequence Variants in 257 Hispanic Patients Who Underwent Diagnostic DNA Testing for CF Mutations in 257 patients Allele counts of each mutation % of variant alleles (183) % of all alleles tested (514) ACMG/ACOG recommended 25 mutation panel* DeltaF508 53 28.96 10.31 G542X 7 3.83 1.36 R334W 2 1.09 0.39 R553X 2 1.09 0.39 DeltaI507 1 0.55 0.19 1717 - 1 GϾA 1 0.55 0.19 3120 ϩ 1 GϾA 1 0.55 0.19 7 different mutations 67 36.61 13.04 All mutations included ACMG/ACOG 1248 ϩ 1 GϾA 1 0.55 0.19 1249 - 29delAT 1 0.55 0.19 1288insTA1288insTA 1 0.55 0.19 1341 ϩ 80 GϾA1341 ϩ 80 GϾA 1 0.55 0.19 1429del71429del7 1 0.55 0.19 1525 - 42 GϾA1525 - 42 GϾA 1 0.55 0.19 1717 - 1 GϾA 1 0.55 0.19 1717 - 8 GϾA 2 1.09 0.39 1811 ϩ 1 GϾA1811 ϩ 1 GϾA 1 0.55 0.19 2055del9-ϾA 3 1.64 0.58 2105-2117del13insAGAAA 1 0.55 0.19 2215insG 1 0.55 0.19 2585delT2585delT 1 0.55 0.19 2752 - 6 TϾC 1 0.55 0.19 296 ϩ 28 AϾG 1 0.55 0.19 3120 ϩ 1 GϾ A 1 0.55 0.19 3271 ϩ 8 AϾG3271 ϩ 8 AϾG 1 0.55 0.19 3271delGG 1 0.55 0.19 3272 - 26 AϾG 2 1.09 0.39 3876delA 2 1.09 0.39 4016insT 1 0.55 0.19 406 - 1 GϾA 6 3.28 1.17 406 - 6 TϾC 1 0.55 0.19 4374 ϩ 13 A ϾG 1 0.55 0.19 663delT 1 0.55 0.19 874insTACA874insTACA 1 0.55 0.19 A1009T 2 1.09 0.39 A559T 1 0.55 0.19 D1152H 1 0.55 0.19 D1270N 3 1.64 0.58 D1445N 2 1.09 0.39 D836Y 1 0.55 0.19 DeltaF311 1 0.55 0.19 DeltaF508 53 28.96 10.31 DeltaI507 1 0.55 0.19 E116K 2 1.09 0.39 E585X 1 0.55 0.19 E588VE588V 2 1.09 0.39 E831X 1 0.55 0.19 F311L 1 0.55 0.19 F693L 1 0.55 0.19 G1244E 1 0.55 0.19 G542X 7 3.83 1.36 G576A 1 0.55 0.19 H199Y 3 1.64 0.58 I1027T 3 1.64 0.58 I285FI285F 1 0.55 0.19 L206W 3 1.64 0.58 L320V 1 0.55 0.19 L967S 1 0.55 0.19 L997F 3 1.64 0.58 P1372LP1372L 1 0.55 0.19 P205S 1 0.55 0.19 P439SP439S 1 0.55 0.19 Q1313X 1 0.55 0.19 Q890X 2 1.09 0.39 Q98R 1 0.55 0.19 R1066C 1 0.55 0.19 R1066H 1 0.55 0.19 (Table continues) missense variant, I1027T (3212TϾC), in exon 17a.25 Family studies have not been performed to identify which allele carries two mutations. Login to comment
187 CFTR Sequence Variants Identified in Five Comprehensive CFTR Studies in US Hispanics CFTR mutations Alleles Relative mutation frequency (%) (of 317) deltaF508 123 38.80 3876delA 15 4.70 G542X 12 3.80 406 - 1GϾA 8 2.50 3849 ϩ 10kbCϾT 5 1.60 R75X 4 1.30 935delA 4 1.30 S549N 4 1.30 W1204X 4 1.30 R334W 4 1.30 2055del9ϾA 3 1 R74W 3 1 H199Y 3 1 L206W 3 1 663delT 3 1 3120 ϩ 1GϾA 3 1 L997F 3 1 I1027T 3 1 R1066C 3 1 W1089X 3 1 D1270N 3 1 2105del13insAGAAA 3 1 Q98R 2 Ͻ1 E116K 2 Ͻ1 I148T 2 Ͻ1 R668C 2 Ͻ1 P205S 2 Ͻ1 V232D 2 Ͻ1 S492F 2 Ͻ1 T501A 2 Ͻ1 1949del84 2 Ͻ1 Q890X 2 Ͻ1 3271delGG 2 Ͻ1 3272 - 26AϾG 2 Ͻ1 G1244E 2 Ͻ1 D1445N 2 Ͻ1 R553X 2 Ͻ1 E588V 2 Ͻ1 1717 - 8GϾA 2 Ͻ1 A1009T 2 Ͻ1 S1235R 2 Ͻ1 G85E 1 Ͻ1 296 ϩ 28AϾG 1 Ͻ1 406 - 6TϾC 1 Ͻ1 V11I 1 Ͻ1 Q179K 1 Ͻ1 V201 mol/L 1 Ͻ1 874insTACA 1 Ͻ1 I285F 1 Ͻ1 deltaF311 1 Ͻ1 F311L 1 Ͻ1 L320V 1 Ͻ1 T351S 1 Ͻ1 R352W 1 Ͻ1 1248 ϩ 1GϾA 1 Ͻ1 1249 - 29delAT 1 Ͻ1 1288insTA 1 Ͻ1 1341 ϩ 80GϾA 1 Ͻ1 1429del7 1 Ͻ1 1525 - 42GϾA 1 Ͻ1 P439S 1 Ͻ1 1717 - 1GϾA 1 Ͻ1 1811 ϩ 1GϾA 1 Ͻ1 deltaI507 1 Ͻ1 G551D 1 Ͻ1 A559T 1 Ͻ1 Y563N 1 Ͻ1 (Table continues) In this study, we used temporal temperature gradient gel electrophoresis (TTGE) and direct DNA sequencing to increase the sensitivity of mutation detection in U.S. Hispanics, and to determine whether additional mutations are recurrent. Login to comment

[hide] High heterogeneity of CFTR mutations and unexpecte... J Cyst Fibros. 2004 Dec;3(4):265-72. des Georges M, Guittard C, Altieri JP, Templin C, Sarles J, Sarda P, Claustres M
High heterogeneity of CFTR mutations and unexpected low incidence of cystic fibrosis in the Mediterranean France.
J Cyst Fibros. 2004 Dec;3(4):265-72., [PMID:15698946]

Abstract [show]
In this report, we present updated spectrum and frequency of mutations of the CFTR gene that are responsible for cystic fibrosis (CF) in Languedoc-Roussillon (L-R), the southwestern part of France. A total of 75 different mutations were identified by DGGE in 215 families, accounting for 97.6% of CF genes and generating 88 different mutational genotypes. The frequency of p.F508del was 60.23% in L-R versus 67.18% in the whole country and only five other mutations (p.G542X, p.N1303K, p.R334W, c.1717-1G>A, c.711+1G>T) had a frequency higher than 1%. The mutations were scattered over 20 exons or their border. This sample representing only 5.7% of French CF patients contributed to 24% of CFTR mutations reported in France. This is one of the highest molecular allelic heterogeneity reported so far in CF. We also present the result of a neonatal screening program based on a two-tiered approach "IRT/20 mutations/IRT" analysis on blood spots, implemented in France with the aim to improve survival and quality of life of patients diagnosed before clinical onset. This 18-month pilot project showed an unexpected low incidence of CF (1/8885) in South of France, with only six CF children detected among 43,489 neonates born in L-R, and 13 among 125,339 neonates born in Provence-Alpes-Cote-d'Azur (PACA).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
68 of chromosomes (frequency %) p.M1V 1 1 (0.23) p.M1K 1 1 (0.23) c.300delA 3 1 (0.23) p.P67L 3 1 (0.23) c.359insT 3 1 (0.23) p.G85E 3 3 (0.70) c.394delTT 3 1 (0.23) p.Q98R 4 1 (0.23) p.R117H 4 2 (0.47) p.Y122X 4 2 (0.47) p.Y161N 4 1 (0.23) c.621+1GNT intron 4 1 (0.23) c.621+2TNG intron 4 1 (0.23) p.I175V 5 2 (0.47) c.711+1GNT intron 5 5 (1.16) p.L206W 6 3 (0.70) p.Q220X 6 1 (0.23) p.L227R 6 1 (0.23) c.1078delT 7 2 (0.47) p.R334W 7 7 (1.63) p.R347P 7 2 (0.47) c.1215delG 7 1 (0.23) c.T5 intron 8 1 (0.23) p.D443Y 9 1 (0.23) p.I506T 10 1 (0.23) p.I507del 10 4 (0.93) p.F508del 10 259 (60.23) p.F508C 10 1 (0.23) c.1677delTA 10 1 (0.23) c.1717-8GNA intron 10 1 (0.23) c.1717-1GNA intron 10 6 (1.40) p.G542X 11 23 (5.35) p.S549R 11 1 (0.23) p.G551D 11 2 (0.47) p.R553X 11 1 (0.23) c1811+1.6kbANG intron 11 4 (0.93) c.1812-1GNA intron 11 1 (0.23) p.T582I 12 1 (0.23) p.E585X 12 2 (0,47) c.1898+1GNA intron 12 1 (0.23) [c.1898+5GNA ;p.E725K] intron 12 1 (0.23) c.1898+73TNG intron 12 1 (0.23) c.2183AANG 13 4 (0.93) c.2184insA 13 1 (0.23) p.K710X 13 4 (0.93) c.2423delG 13 1 (0.23) p.S776X 13 1 (0.23) c.2493ins8 13 1 (0.23) p.R792X 13 1 (0.23) p.K830X 13 1 (0.23) p.D836Y 14a 1 (0.23) p.W846X1 14a 1 (0.23) c.2711delT 14a 1 (0.23) c.2789+5GNA intron 14b 3 (0.70) p.S945L 15 3 (0.70) p.D993Y 16 1 (0.23) c.3129del4 17a 1 (0.23) c.3195del6 17a 1 (0.23) c.3272-26ANG intron 17a 1 (0.23) [c.3395insA ;pI148T] 17b/4 1 (0,23) p.Y1092X 17b 3 (0.70) Table 1 (continued) Mutation Location exon/intron No. Login to comment

[hide] Spectrum of CFTR mutations in cystic fibrosis and ... Hum Mutat. 2000;16(2):143-56. Claustres M, Guittard C, Bozon D, Chevalier F, Verlingue C, Ferec C, Girodon E, Cazeneuve C, Bienvenu T, Lalau G, Dumur V, Feldmann D, Bieth E, Blayau M, Clavel C, Creveaux I, Malinge MC, Monnier N, Malzac P, Mittre H, Chomel JC, Bonnefont JP, Iron A, Chery M, Georges MD
Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France.
Hum Mutat. 2000;16(2):143-56., [PMID:10923036]

Abstract [show]
We have collated the results of cystic fibrosis (CF) mutation analysis conducted in 19 laboratories in France. We have analyzed 7, 420 CF alleles, demonstrating a total of 310 different mutations including 24 not reported previously, accounting for 93.56% of CF genes. The most common were F508del (67.18%; range 61-80), G542X (2.86%; range 1-6.7%), N1303K (2.10%; range 0.75-4.6%), and 1717-1G>A (1.31%; range 0-2.8%). Only 11 mutations had relative frequencies >0. 4%, 140 mutations were found on a small number of CF alleles (from 29 to two), and 154 were unique. These data show a clear geographical and/or ethnic variation in the distribution of the most common CF mutations. This spectrum of CF mutations, the largest ever reported in one country, has generated 481 different genotypes. We also investigated a cohort of 800 French men with congenital bilateral absence of the vas deferens (CBAVD) and identified a total of 137 different CFTR mutations. Screening for the most common CF defects in addition to assessment for IVS8-5T allowed us to detect two mutations in 47.63% and one in 24.63% of CBAVD patients. In a subset of 327 CBAVD men who were more extensively investigated through the scanning of coding/flanking sequences, 516 of 654 (78. 90%) alleles were identified, with 15.90% and 70.95% of patients carrying one or two mutations, respectively, and only 13.15% without any detectable CFTR abnormality. The distribution of genotypes, classified according to the expected effect of their mutations on CFTR protein, clearly differed between both populations. CF patients had two severe mutations (87.77%) or one severe and one mild/variable mutation (11.33%), whereas CBAVD men had either a severe and a mild/variable (87.89%) or two mild/variable (11.57%) mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
109 h M1K, K14X, W19X, 211delG, G27E, R31C, 237insA, 241delAT, Q39X, 244delTA, 296+2T>C, 297-3C>T, W57X+F87L, 306delTAGA, P67L, A72D, 347delC, R75Q, 359insT, 394delT, 405+4A>G, Q98R, 457TAT>G, R117H+5T, R117H+I1027T, R117L, R117P, H139R, A141D, M152V, N186K, D192N, D192del, E193X, 711+1G>A, 711+3A>G, 712-1G>T, L206F, W216X, C225R, Q237E, G241R, 852del22, 876-14del12, 905delG, 993del5, E292K, Y304X, F311del, 1161delC, R347L, R352Q, W361R, 1215delG, S364P, S434X, D443Y, S466X, C491R, T501A, I506T, F508C, I507del+F508C, F508del+L467F, 1774delCT, R553G, 1802delC, 1806delA, A559E, Y563N, 1833delT, Y569C, Y569H, Y569X, G576X, G576A, T582I, 1898+3A>G+186-13C>G, 1918delGC, R600G, L610S, G628R, 2043delG, 2118del4, E664X, 2174insA, Q689X, K698R, K716X, L732X, 2347delG, 2372del8, R764X, 2423delG, S776X, 2634insT, 2640delT, C866Y, 2752-1G>T, W882X, Y913C, V920M, 2896insAG, H939D, H939R, D979V, D985H, D993Y, 3120G>A, I1005R, 3195del6, 3293delA, 3320ins5, W1063X, A1067T, 3359delCT, T1086I, W1089X, Y1092X+S1235R, W1098X, E1104X, R1128X, 3532AC>GTA, 3548TCAT>G, M1140del, 3600G>A, R1162L, 3667ins4, 3732delA+K1200E, S1206X, 3791delC, S1235R+5T, Q1238R, Q1238X, 3849+4A>G, T1246I, 3869insG, S1255P, R1283K, F1286S, 4005+1G>T, 4006-8T>A, 4015delA, N1303H, N1303I, 4172delGC, 4218insT, 4326delTC, Q1382X, 4375-1C>T, 4382delA, D1445N, CF40kbdel4-10, Cfdel17b. Login to comment

[hide] Identification of common cystic fibrosis mutations... Am J Hum Genet. 1997 May;60(5):1122-7. Macek M Jr, Mackova A, Hamosh A, Hilman BC, Selden RF, Lucotte G, Friedman KJ, Knowles MR, Rosenstein BJ, Cutting GR
Identification of common cystic fibrosis mutations in African-Americans with cystic fibrosis increases the detection rate to 75%.
Am J Hum Genet. 1997 May;60(5):1122-7., [PMID:9150159]

Abstract [show]
Cystic fibrosis (CF)--an autosomal recessive disorder caused by mutations in CF transmembrane conductance regulator (CFTR) and characterized by abnormal chloride conduction across epithelial membranes, leading to chronic lung and exocrine pancreatic disease--is less common in African-Americans than in Caucasians. No large-scale studies of mutation identification and screening in African-American CF patients have been reported, to date. In this study, the entire coding and flanking intronic sequence of the CFTR gene was analyzed by denaturing gradient-gel electrophoresis and sequencing in an index group of 82 African-American CF chromosomes to identify mutations. One novel mutation, 3120+1G-->A, occurred with a frequency of 12.3% and was also detected in a native African patient. To establish frequencies, an additional group of 66 African-American CF chromosomes were screened for mutations identified in two or more African-American patients. Screening for 16 "common Caucasian" mutations identified 52% of CF alleles in African-Americans, while screening for 8 "common African" mutations accounted for an additional 23%. The combined detection rate of 75% was comparable to the sensitivity of mutation analysis in Caucasian CF patients. These results indicate that African-Americans have their own set of "common" CF mutations that originate from the native African population. Inclusion of these "common" mutations substantially improves CF mutation detection rates in African-Americans.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
70 Finally, 13 mutations found in one patient each had been previously reported in Caucasian patients (Q98R, R352Q, V520F, 1812-1G--A, G542X, S549N, and Y913C) (Romey et al. 1995; Welsh et al. 1995) or in African-American patients (444delA, G480C, 1342-2delAG [originally reported as 1342-1G--+C], 2307insA, 3662delA, and W1316X) (Cutting et al. 1990b; White et al. 1991; Zielenski et al. Login to comment
71 Finally, 13 mutations found in one patient each had been previously reported in Caucasian patients (Q98R, R352Q, V520F, 1812-1G--A, G542X, S549N, and Y913C) (Romey et al. 1995; Welsh et al. 1995) or in African-American patients (444delA, G480C, 1342-2delAG [originally reported as 1342-1G--+C], 2307insA, 3662delA, and W1316X) (Cutting et al. 1990b; White et al. 1991; Zielenski et al. Login to comment

[hide] SSCP analysis: a blind sensitivity trial. Hum Mutat. 1997;10(1):65-70. Jordanova A, Kalaydjieva L, Savov A, Claustres M, Schwarz M, Estivill X, Angelicheva D, Haworth A, Casals T, Kremensky I
SSCP analysis: a blind sensitivity trial.
Hum Mutat. 1997;10(1):65-70., [PMID:9222762]

Abstract [show]
Studies of the sensitivity of SSCP analysis usually have been performed under conditions contrary to the rules of quality control trials and have produced widely different results. We have performed a blind trial of the sensitivity of SSCP analysis for the detection of mutations in fragments up to 500 bp in length under a fixed single set of electrophoretic conditions. The mutation detection rate was 84%. In addition, we have identified a second mutation in nine samples. All these mutations are polymorphisms, including a novel polymorphism 1248 + 52T/C first reported in the present work.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
22 List of Mutations Included in the Experiment and Original Method of Detection Used by the Referring Laboratory Referring Probe Original method laboratory no.a Mutation Exon of detection Original SSCP conditions Institut de 1 1677delTA 10 Heteroduplexes Recerca 1 1859G/C 12 DDGE Oncologica, 3 W1282X 20 SSCPb 6% 19:1 (AA:bisAA) 4°C 5h 30W Department 4 delF508 10 Heteroduplexes de Genetica 4 Q1313X 20 SSCPb 6% 19:1 (AA:bisAA) 4°C 5h 30W Molecular, 5 1609delCA 10 SSCPb 6% 19:1 (AA:bisAA) RT 28h 10W10% glycerol Barcelona, 7 T582R 12 DGGE Spain 8 1898+3G→A ivs 12 DGGE Molecular 910085 1161delC 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Genetics 860176 1138insG 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Laboratory, 930215 1154insTC 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Royal 930838 delF508 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Manchester 930127 delI507 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Children`s 931205 Q493X 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Hospital, 900592 V520F 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm UK G12984 S489X 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 910143 G551D 11 ARMS 930274 S549N 11 SSCP/Heteroduplexes 10% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 920132 1811+1G→C ivs 11 SSCP/Heteroduplexes 10% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 930140 1898+1G→A ivs 12 SSCP/Heteroduplexes 930334 W1282X 20 SSCP/Heteroduplexes 7.25% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 140735 3850-1G→A 20 SSCP/Heteroduplexes 7.25% 49:1 (AA:bisAA) 4°C 20 h 10 V/cm Laboratoire 293 G551D 11 SSCPb 5% 19:1 (AA:bisAA) 4°C 5 h 50W and de Biochimie 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol Genetique, 324 S549R 11 ASO Hybridization Centre 649 1898+1G→A ivs 12 DGGE Hospitalier 583 E585X 12 DGGE Universitaire 710 L967S 15 DGGE Montpellier, 325 S945L 15 SSCPb 5% 19:1 (AA:bisAA) 4° 5h 50W and France 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 473 N1303H 21 SSCPb 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 216 300delA 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 287 394delTT 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 559 R74W 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 237 P67L 3 DGGE 1023 R75X 3 DGGE 885 1215delG 7 DGGE 113 Y122X 4 DGGE, SSCP 356 621+1G→T ivs 4 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 709 621+2T→G ivs 4 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 802 I148T 4 DGGE 1016 Q98R 4 DGGE V75 R117H 4 SSCP 5% 19:1 (AA:bisAA) 4°C 5 h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol a Identification numbers given by referring laboratories. Login to comment
57 Type of Mutations Detected by SSCP Analysis in This Study Type of mutation Mutation Mutation characteristics Detected by SSCP analysis Deletions 1677delTA deletion of TA from 1677 Yes delF508 deletion of 3 bp from 1655 Yes delI507 deletion of 3 bp from 1648 Yes 1609delCA deletion of CA from 1609 Yes 1161delC deletion of C at 1161 Yes 300delA deletion of A at 300 Yes 394delTT deletion of TT from 394 Yes 1215delG deletion of G at 1215 No Insertions 1138insG insertion of G after 1138 Yes 1154insTC insertion of TC after 1154 Yes Base 1859G/C Yes substitutions W1282X G→A at 3978 Yes Q1313X C→T at 4069 Yes T582R C→G at 1877 Yes 1898+3G→A A→G at 1898+3 Yes Q493X C→T at 1609 Yes V520F G→T at 1690 Yes S489X C→A at 1598 Yes G551D G→A at 1784 No S549N G→A at 1778 Yes 1811+1G→C G→C at 1811+1 Yese 1898+1G→A G→A at 1898 Yes 3850-1G→A G→A at 3850-1 Yes S549R T→G at 1779 Yes E585X G→T at 1885 Yes L967S C→T at 2966 Yes S945L C→T at 2966 No N1303H A→C at 4039 Yes R74W C→T at 352 Yes P67L C→T at 332 Yes R75X C→T at 355 Yes Y122X T→A at 498 No 621+1G→T G→T at 621+1 No 621+2T→G T→G at 621+2 No I148T T→C at 575 Yes Q98R A→G at 425 Yes R117H G→A at 482 Yes FIGURE 1. Login to comment

[hide] Novel CFTR variants identified during the first 3 ... J Mol Diagn. 2013 Sep;15(5):710-22. doi: 10.1016/j.jmoldx.2013.05.006. Epub 2013 Jun 28. Prach L, Koepke R, Kharrazi M, Keiles S, Salinas DB, Reyes MC, Pian M, Opsimos H, Otsuka KN, Hardy KA, Milla CE, Zirbes JM, Chipps B, O'Bra S, Saeed MM, Sudhakar R, Lehto S, Nielson D, Shay GF, Seastrand M, Jhawar S, Nickerson B, Landon C, Thompson A, Nussbaum E, Chin T, Wojtczak H
Novel CFTR variants identified during the first 3 years of cystic fibrosis newborn screening in California.
J Mol Diagn. 2013 Sep;15(5):710-22. doi: 10.1016/j.jmoldx.2013.05.006. Epub 2013 Jun 28., [PMID:23810505]

Abstract [show]
California uses a unique method to screen newborns for cystic fibrosis (CF) that includes gene scanning and DNA sequencing after only one California-40 cystic fibrosis transmembrane conductance regulator (CFTR) panel mutation has been identified in hypertrypsinogenemic specimens. Newborns found by sequencing to have one or more additional mutations or variants (including novel variants) in the CFTR gene are systematically followed, allowing for prospective assessment of the pathogenic potential of these variants. During the first 3 years of screening, 55 novel variants were identified. Six of these novel variants were discovered in five screen-negative participants and three were identified in multiple unrelated participants. Ten novel variants (c.2554_2555insT, p.F1107L, c.-152G>C, p.L323P, p.L32M, c.2883_2886dupGTCA, c.2349_2350insT, p.K114del, c.-602A>T, and c.2822delT) were associated with a CF phenotype (42% of participants were diagnosed at 4 to 25 months of age), whereas 26 were associated with CFTR-related metabolic syndrome to date. Associations with the remaining novel variants were confounded by the presence of other diseases or other mutations in cis or by inadequate follow-up. These findings have implications for how CF newborn screening and follow-up is conducted and will help guide which genotypes should, and which should not, be considered screen positive for CF in California and elsewhere.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 Newborns were screened using the California method, which includes i) analysis of serum immunoreactive trypsinogen (IRT) levels using the AutoDELFIA neonatal IRT L kit (PerkinElmer, Waltham, MA) in all newborn blood spot specimens, ii) CFTR mutation panel [29-40 mutations (the mutations on the California panel were selected for the most part according to allelic frequencies found in a comprehensively genotyped group of California CF cases to achieve a 95% race/ethnicity-specific rate of CF case detection in black, white, and Hispanic individuals in California and include c.1585-1G>A, c.1680-1G>A, c.1973-1985del13insAGAAA, c.2175_2176insA, c.164 &#fe; 2T>A (removed on August 12, 2008), c.2988 &#fe; 1G>A, c.3717 &#fe; 12191C>T, c.3744delA, c.274-1G>A, c.489 &#fe; 1G>T, c.579 &#fe; 1G>T, p.A559T, p.F311del, p.F508del, p.I507del, p.G542X, p.G551D, p.G85E, p.H199Y, p.N1303K, p.R1066C, p.R1162X, p.R334W, p.R553X, p.S549N, p.W1089X, p.W1204X (c.3611G>A), p.W1282X, c.1153_1154insAT [added October 4, 2007], c.1923_1931del9insA, c.3140-26A>G, c.531delT, c.803delA, c.54-5940_273 &#fe; 10250del21kb, p.P205S, p.Q98R, p.R75X, p.S492F [added December 12, 2007], c.3659delC, p.G330X, p.W1204X [c.3612G>A] [added August 12, 2008] [Signature CF 2.0 ASR; Asuragen Inc., Austin, TX])] testing of specimens with IRT 62 ng/mL (highest 1.5%), iii) CFTR gene scanning and sequence analysis (Ambry Test: CF; Ambry Genetics, Aliso Viejo, CA) for specimens found to have only one mutation after CFTR mutation panel testing, and iv) referral to 1 of 15 pediatric CF care centers (CFCs) for sweat chloride (SC) testing and follow-up of all newborns with either two CFTR mutations detected during panel testing or one CFTR mutation detected during panel testing and one (or more) additional CFTR mutation and/or variant detected during sequencing. Login to comment

[hide] Impact of heterozygote CFTR mutations in COPD pati... Respir Res. 2014 Feb 11;15:18. doi: 10.1186/1465-9921-15-18. Raju SV, Tate JH, Peacock SK, Fang P, Oster RA, Dransfield MT, Rowe SM
Impact of heterozygote CFTR mutations in COPD patients with chronic bronchitis.
Respir Res. 2014 Feb 11;15:18. doi: 10.1186/1465-9921-15-18., [PMID:24517344]

Abstract [show]
BACKGROUND: Cigarette smoking causes Chronic Obstructive Pulmonary Disease (COPD), the 3rd leading cause of death in the U.S. CFTR ion transport dysfunction has been implicated in COPD pathogenesis, and is associated with chronic bronchitis. However, susceptibility to smoke induced lung injury is variable and the underlying genetic contributors remain unclear. We hypothesized that presence of CFTR mutation heterozygosity may alter susceptibility to cigarette smoke induced CFTR dysfunction. Consequently, COPD patients with chronic bronchitis may have a higher rate of CFTR mutations compared to the general population. METHODS: Primary human bronchial epithelial cells derived from F508del CFTR heterozygotes and mice with (CFTR+/-) and without (CFTR+/+) CFTR heterozygosity were exposed to whole cigarette smoke (WCS); CFTR-dependent ion transport was assessed by Ussing chamber electrophysiology and nasal potential difference measurements, respectively. Caucasians with COPD and chronic bronchitis, age 40 to 80 with FEV1/FVC < 0.70 and FEV1 < 60% predicted, were selected for genetic analysis from participants in the NIH COPD Clinical Research Network's Azithromycin for Prevention of Exacerbations of COPD in comparison to 32,900 Caucasian women who underwent prenatal genetic testing. Genetic analysis involved an allele-specific genotyping of 89 CFTR mutations. RESULTS: Exposure to WCS caused a pronounced reduction in CFTR activity in both CFTR (+/+) cells and F508del CFTR (+/-) cells; however, neither the degree of decrement (44.7% wild-type vs. 53.5% F508del heterozygous, P = NS) nor the residual CFTR activity were altered by CFTR heterozygosity. Similarly, WCS caused a marked reduction in CFTR activity measured by NPD in both wild type and CFTR heterozygous mice, but the severity of decrement (91.1% wild type vs. 47.7% CF heterozygous, P = NS) and the residual activity were not significantly affected by CFTR genetic status. Five of 127 (3.9%) COPD patients with chronic bronchitis were heterozygous for CFTR mutations which was not significantly different from controls (4.5%) (P = NS). CONCLUSIONS: The magnitude of WCS induced reductions in CFTR activity was not affected by the presence of CFTR mutation heterozygosity. CFTR mutations do not increase the risk of COPD with chronic bronchitis. CFTR dysfunction due to smoking is primarily an acquired phenomenon and is not affected by the presence of congenital CFTR mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 As expected based on genotype-phenotype correlations in the disease [33], HBE cells derived from a F508del CFTR heterozygote had slightly lower CFTR activity at baseline than wild type monolayers as measured by Table 1 List of CFTR mutations analyzed F508del R117H 1717-1G > A R117C G85E R334W 1898 + 1G > A Y122X A455E R347P 2184delA G178R I507del R553X 2789 + 5G > A G314E G542X R560T 3120 + 1G > A G330X G551D W1282X 3659delC R347H N1303K 621 + 1G > T K710X 406-1G > A R1162X 711 + 1G > T E60X G480C R1066C W1089X V520F A559T S1196X Q1238X S1251N S1255X 663delT 935delA 1161delC 1288insTA 2184insA 2307insA 2711delT 2869insG R709X R764X R1158X 574delA Q493X 1898 + 5G > T 3905insT I506T 3849 + 10kbC > T 712-1G > T Q98R Q552X S549N 1078delT H199Y 444delA S549R (T > G) 2143delT P205S 2043delG 1811 + 1.6kbA > G 3272-26A > G L206W 3791delC Y1092X (C > G) 3199del6 F508C 2108delA Y1092X (C > A) D1152H V520I 3667del4 394delTT 3876delA M1101K 1677delTA W1098X (TGA) 1812-1G > A 4016insT 1609delCA 3171delC response to forskolin stimulation (49.3 &#b1; 11.5 bc;A/cm2 in CFTR (+/+) vs. 40.5 &#b1; 5.3 bc;A/cm2 in CFTR (+/-), although this was not statistically significant (Figure 1A,B). Login to comment

[hide] Erratum: Heterogeneous spectrum of CFTR gene mutat... Ann Lab Med. 2015 Jan;35(1):185-6. doi: 10.3343/alm.2015.35.1.185.
Erratum: Heterogeneous spectrum of CFTR gene mutations in Korean patients with cystic fibrosis.
Ann Lab Med. 2015 Jan;35(1):185-6. doi: 10.3343/alm.2015.35.1.185., [PMID:25553309]

Abstract [show]
[This corrects the article on p. 219 in vol. 31.].

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 Frequency of CFTR mutations in Korean CF patients Case No. Amino acid change Exon Nucleotide number Nucleotide change Type of mutation Method of detection Familial targeted mutation study Ref Father Mother Brother Sister 1 Q98R Exon 4 293 A>G Missense Sequencing ND - - NA This study L728NfsX38 Exon 13 2,052 delA Frameshift Sequencing ND + + NA 2 IVS 4 579+5 G>A Splicing Sequencing ND ND NA NA This study 3 Q98R Exon 4 293 A>G Missense Sequencing + - + - [15] Q220X Exon 6a 658 C>T Nonsense Sequencing - + - - 4 Q98R Exon 4 293 A>G Missense Sequencing + - NA NA [16] Q1352H Exon 24 4,056 G>C Missense Sequencing - + NA NA 5 IVS 12 1,766+2 T>C Splicing Sequencing + - NA NA [18] N1303KfsX6 Exon 21 3,908 dupA Frameshift Sequencing - + NA NA 6 IVS 17a 3,272-26 A>G Splicing Sequencing MLPA ND ND NA NA [17] Exon14a 2,623-2,751+? Login to comment
9 Frequency of CFTR mutations in Korean CF patients Case No. Amino acidchange Exon Nucleotide number* Nucleotide change Type of mutation Method of detection Familial targeted mutation study Ref Father Mother Brother Sister 1 Q98R Exon 4 293 A>G Missense Sequencing ND - - NA This study K684NfsX38 Exon 13 2,052 delA Frameshift Sequencing ND + + NA 2 IVS 4 579+5 G>A Splicing Sequencing ND ND NA NA This study 3 Q98R Exon 4 293 A>G Missense Sequencing + - + - [15] Q220X Exon 6a 658 C>T Nonsense Sequencing - + - - 4 Q98R Exon 4 293 A>G Missense Sequencing + - NA NA [16] Q1352H Exon 24 4,056 G>C Missense Sequencing - + NA NA 5 IVS 12 1,766+2 T>C Splicing Sequencing + - NA NA [18] N1303KfsX6 Exon 21 3,908 dupA Frameshift Sequencing - + NA NA 6 IVS 17a 3,272-26 A>G Splicing Sequencing ND ND NA NA [17] Exon14a 2,623-2,751+? Login to comment

[hide] Benign outcome among positive cystic fibrosis newb... J Cyst Fibros. 2015 Nov;14(6):714-9. doi: 10.1016/j.jcf.2015.03.006. Epub 2015 Mar 29. Salinas DB, Sosnay PR, Azen C, Young S, Raraigh KS, Keens TG, Kharrazi M
Benign outcome among positive cystic fibrosis newborn screen children with non-CF-causing variants.
J Cyst Fibros. 2015 Nov;14(6):714-9. doi: 10.1016/j.jcf.2015.03.006. Epub 2015 Mar 29., [PMID:25824995]

Abstract [show]
BACKGROUND: The Clinical and Functional Translation of CFTR project (CFTR2) classified some cystic fibrosis transmembrane conductance regulator (CFTR) gene variants as non-cystic fibrosis (CF)-causing. To evaluate this, the clinical status of children carrying these mutations was examined. METHODS: We analyzed CF disease-defining variables over 2-6 years in two groups of California CF screen- positive neonates born from 2007 to 2011: (1) children with two CF-causing variants and (2) children with one CF-causing and one non-CF-causing variant, as defined by CFTR2. RESULTS: Children carrying non-CF-causing variants had significantly higher birth weight, lower immunoreactive trypsinogen and sweat chloride values, higher first year growth curves, and a lower rate of persistent Pseudomonas aeruginosa colonization compared to children with two CF-causing variants. CONCLUSIONS: The outcomes in children 2-6 years of age with the L997F, G576A, R1162L, V754M, R668C, R31C, and S1235R variants are consistent with the CFTR2 non-CF-causing classification.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
32 All but three of the variants on the panel (F311del, 935delA, and Q98R) have been evaluated by CFTR2 and determined to be CF-causing. Login to comment

[hide] Newborn Screening for Cystic Fibrosis in Californi... Pediatrics. 2015 Dec;136(6):1062-72. doi: 10.1542/peds.2015-0811. Epub 2015 Nov 16. Kharrazi M, Yang J, Bishop T, Lessing S, Young S, Graham S, Pearl M, Chow H, Ho T, Currier R, Gaffney L, Feuchtbaum L
Newborn Screening for Cystic Fibrosis in California.
Pediatrics. 2015 Dec;136(6):1062-72. doi: 10.1542/peds.2015-0811. Epub 2015 Nov 16., [PMID:26574590]

Abstract [show]
OBJECTIVES: This article describes the methods used and the program performance results for the first 5 years of newborn screening for cystic fibrosis (CF) in California. METHODS: From July 16, 2007, to June 30, 2012, a total of 2 573 293 newborns were screened for CF by using a 3-step model: (1) measuring immunoreactive trypsinogen in all dried blood spot specimens; (2) testing 28 to 40 selected cystic fibrosis transmembrane conductance regulator (CFTR) mutations in specimens with immunoreactive trypsinogen values >/=62 ng/mL (top 1.6%); and (3) performing DNA sequencing on specimens found to have only 1 mutation in step 2. Infants with >/=2 mutations/variants were referred to CF care centers for diagnostic evaluation and follow-up. Infants with 1 mutation were considered carriers and their parents offered telephone genetic counseling. RESULTS: Overall, 345 CF cases, 533 CFTR-related metabolic syndrome cases, and 1617 carriers were detected; 28 cases of CF were missed. Of the 345 CF cases, 20 (5.8%) infants were initially assessed as having CFTR-related metabolic syndrome, and their CF diagnosis occurred after age 6 months (median follow-up: 4.5 years). Program sensitivity was 92%, and the positive predictive value was 34%. CF prevalence was 1 in 6899 births. A total of 303 CFTR mutations were identified, including 78 novel variants. The median age at referral to a CF care center was 34 days (18 and 37 days for step 2 and 3 screening test-positive infants, respectively). CONCLUSIONS: The 3-step model had high detection and low false-positive levels in this diverse population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
77 July 16, 2007 c.164+2T.A (296+2T.A) 28 c.254G.A (G85E) c.274-1G.A (406-1G.A) c.489+1G.T (621+1G.T) c.579+1G.T (711+1G.T) c.595C.T (H199Y) c.933_935delCTT (F311del) c.1000C.T (R334W) c.1519_1521delATC (I507del) c.1521_1523delCTT (F508del) c.1585-1G.A (1717-1G.A) c.1624G.T (G5423) c.1646G.A (S549N) c.1652G.A (G551D) c.1657C.T (R5533) c.1675G.A (A559T) c.1680-1G.A (1812-1G.A) c.1973-1985del13insAGAAA (2105-2117del13insAGAAA) c.2175_2176insA (2307insA) c.2988+1G.A (3120+1G.A) c.3196C.T (R1066C) c.3266G.A (W10893) c.3485G.T (R11623) c.3611G.A (W12043 [3743G.A]) c.3717+12191C.T (3849+10kbC.T) c.3744delA (3876delA) c.3846G.A (W12823) c.3909C.G (N1303K) October 4, 2007 c.1153_1154insAT (1288insTA) 29 December 12, 2007 c.54-5940_273+10250del21kb (CFTRdele2,3(21kb)) 38 c.531delT (663delT) c.613C.T (P205S) c.803delA (935delA) c.1475C.T (S492F) c.1923_1931del9insA (2055del9.A) c.223C.T (R753) c.293A.G (Q98R) c.3140-26A.G (3272-26A.G) August 12, 2008 c.988G.T (G3303) 40 c.3612G.A (W12043 [3744G.A]) c.3659delC (3791delC) c.164+2T.A (296+2T.A), removed cDNA, complementary DNA. Login to comment