ABCMdb

ABCC7 p.Gln98Arg

None has been submitted yet.

Publications

PMID: 11668613 [PubMed] Wong LJ et al: "Improved detection of CFTR mutations in Southern California Hispanic CF patients."

No. Sentence Comment

86 In addition, rare mutations including1949del84, Q98R, R75X, and G1244E, were also detected. Login to comment
117 Summary of Mutations Found in This Group of Hispanic Patients Exon or Number of Mutation intron chromosomes Frequency % Mutations detected before full gene analysis 91 73.38% 1 F508 10 64 51.6 2 G542X 11 5 4 3 3849+10kb C>T Intron 19 5 4 4 S549N 11 3 2.4 5 I148T 4 2 1.6 6 3120+1G>A 16 2 1.6 7 R334W 7 2 1.6 8 G551D 11 1 0.8 9 N1303K 21 1 0.8 10 W1282X 20 1 0.8 11 R1162X 19 1 0.8 12 G85E 3 1 0.8 13 W1089X 17b 1 0.8 14 Y1092X 17b 1 0.8 15 P205S 6a 1 0.8 Mutations detected by full gene screening 26 20.97% 16 R1066Ca 17b 2 1.6 17 1949del84 13 1 0.8 18 2184delA 13 1 0.8 19 Q98R 4 1 0.8 20 R75X 3 1 0.8 21 G1244E 20 1 0.8 22 3876delA 20 7 5.65 23 935delA 6b 2 1.6 24 406-1G>A Intron 2 2 1.6 25 3271delGG 17a 1 0.8 26 2105-2117del13insAGAAA 13 1 0.8 27 663delT 5 1 0.8 28 3171delC 17a 1 0.8 29 2108delA 13 1 0.8 30 Q179K 5 1 0.8 31 3199del6 17a 1 0.8 32 3500-2 A->T Intron 17b 1 0.8 Total identified 117 (177)b 94.35 (97.5)b Unidentified 7 (3)b 5.65 (2.5)b Total 124 (120)b 100 (100)b a This mutation was also detected by SSCP. Login to comment

PMID: 15084988 [PubMed] Naruse S et al: "A finger sweat chloride test for the detection of a high-risk group of chronic pancreatitis."

No. Sentence Comment

51 The 9 CF-causing mutations (R75X, Q98R, M152R, R347H, L441P, L571S, D979A, H1085R, and T1086I) in Japa- nese20,25-28 were screened by SNP typing with Masscode System (Shimadzu, Kyoto, Japan). Login to comment

PMID: 15121783 [PubMed] Fujiki K et al: "Genetic evidence for CFTR dysfunction in Japanese: background for chronic pancreatitis."

No. Sentence Comment

219 The nine CF causing (R75X, Q98R, M152R, R347H, L441P, L571S, D979A, H1085R, and T1086I) and two non-CF causing (Q1352H and R1453W) mutations in Japanese6 22-24 were screened by SNP typing with a Masscode system (Shimadzu, Kyoto, Japan) and confirmed by sequence analysis in positive and equivocal cases. Login to comment

PMID: 15354332 [PubMed] Monaghan KG et al: "Preconception and prenatal cystic fibrosis carrier screening of African Americans reveals unanticipated frequencies for specific mutations."

No. Sentence Comment

44 Three additional sequence changes, F693L (TTG), Q98R, and P140S(C3T), were incidentally detected by heteroduplex analysis while screening for ACOG/ ACMG CF mutations not included in the test kit used during the time of screening. Login to comment
45 Q98R has been reported to the CF Consortium as a disease causing mutation. Login to comment
51 R117H has been previously reported at an increased frequency among individuals undergoing carrier screening compared to those with a diagnosis of cystic fibrosis.8 An unexpected result was the lack of 3120ϩ1G3A carriers, although 4 were expected given that this mutation accounts for Ϸ12% of the CF muta- Table 1 Summary of carrier screening results using various methods employed between December 2001 and September 2003 OLA v2.0, heteroduplex analysis (exons 4 and 13) and RFLP analysis (3120ϩ1G3A) OLA v3.0 INNO-LiPA Total screened 818 1274 97 No. of carriers identified 16 14 3 Observed carrier frequency 1/51 1/81 Mutations identified ⌬F508 (6), G622D (3), R117H/7T (3), I148T (3199del6 negative), Q98R, 1898ϩ1G3A, and G551Da ⌬F508 (14), R117H/7T, R553X, and G551D a In addition, 2 persons were positive for F693L (TTG) and 1 was positive for P140S (C3T at 550); both are variants of unknown clinical significance. Login to comment
57 Two mutations, G622D and Q98R, and two variants of unknown clinical significance, F693L (TTG) and P140S (C3T), which are not part of the recommended CF screening panel, were incidentally detected while using heteroduplex analysis to screen for ACOG/ACMG recommended mutations (Table 2). Login to comment
65 P140S (C3T) has been reported in a patient with disseminated bronchiectasis, although it is not known if this mutation is associated with classic CF.9 Q98R has been reported previously as a CF mutation,12 although we are not aware of any reports of this mutation in African Americans. Login to comment

PMID: 15365999 [PubMed] Alper OM et al: "Identification of novel and rare mutations in California Hispanic and African American cystic fibrosis patients."

No. Sentence Comment

73 Mutations Not Included in 87-Mutation Panel Nucleotide change-position Traditional nomenclature Approved nomenclature Protein Mutation/Effect Exon/ Intron Number of chromosomes 136 C>T c.4C>T p.Gln2Ter nonsense mutation 1 1 355 C>T c.223C>T p.Arg75Ter nonsense mutation 3 1 406-1G>A c.274-1G>A splice mutation/ truncation int 3 9 (1 sib) 424 C>T c.292C>T p.Gln98Ter nonsense mutation 4 1 425 A>G c.293A>G p.Gln98Arg missense mutation 4 2 663 del T c.531delT p.Ile177fs frameshift/ truncation 5 2 (sib) 727 C>T c.595C>T p.His199Tyr missense mutation 6a 5 (1 sib) Nucleotide change-position Traditional nomenclature Approved nomenclature Protein Mutation/Effect Exon/ Intron Number of chromosomes 745 C>T c.613C>T p.Pro205Ser missense mutation 6a 4 1248+1G>A c.1116+1G>A splice mutation/ truncation 7 2 (sib) 1461 ins AGAT c.1326_1327ins4 p.Asp443fs frameshift/ truncation 9 1 1529 C>G c.1397C>G p.Ser466Ter nonsense mutation 10 1 1607 C>T c.1475C>T p.Ser492Phe missense mutation 10 3 1924 del 7bp c.1792_1798del7 p.Lys598fs frameshift/ truncation 13 2 (sib) 2055 del 9bp to A c.1923_1931del9 insA p.Ser641fs frameshift/ truncation 13 2 (homo) 2105_2117 del 13bp insAGAAA c.1973_1985del 13insAGAAA p.Arg658fs frameshift/ truncation 13 3 2184 ins A c.2052dupA p.Gln685fs frameshift/ truncation 13 2 (twin) 3272-26A>G c.3140-26A>G splice mutation/ truncation int 17a 4 (3 rel) 3313 G>C c.3181G>C p.Gly1061Arg missense mutation 17b 1 3431 A>C c.3299A>C p.Gln1100Pro missense mutation 17b 1 3743 G>A c.3611G>A p.Trp1204Ter nonsense mutation 19 5 (1 sib, 1 homo) 4382 del A c.4250delA p.E1417fs frameshift/ truncation 24 1 Sib:1 sibling pair; homo:homozygote; 3 rel: 3 relatives. Login to comment

PMID: 15880796 [PubMed] Kerem E et al: "Pharmacological induction of CFTR function in patients with cystic fibrosis: mutation-specific therapy."

No. Sentence Comment

58 C-D565G II DF508 D1507 S549R S549I S549N S549R S945D S945L H1054D G1061R L1065P R1066C R1066M L1077P H1085R N1303K G85E III G551D S492F V520F R553G R560T R560S Y569D IV R117H, R117C, R117P, R117L D1152H, L88S, G91R, E92K, Q98R, P205S, L206W, L227R, F311L, G314E, R334W, R334Q, I336K, T338I, L346P, R347C, R347H, R347L, R347P, L927P, R1070W, R1070Q V 3849 þ 10 kb C ! Login to comment

PMID: 16778407 [PubMed] Koh WJ et al: "Report of a Korean patient with cystic fibrosis, carrying Q98R and Q220X mutations in the CFTR gene."

No. Sentence Comment

15 Chest radiographs and computed tomographic (CT) scans of the chest, performed without intravenous contrast mate- Won-Jung Koh, Chang-Seok Ki*, Jong-Won Kim*, Jeong-Ho Kim� , Seong Yong Lim� Division of Pulmonary and Critical Care Medicine, Department of Medicine and Department of Laboratory Medicine*, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul; Department of Laboratory Medicine � , Yongdong Severance Hospital, Yonsei University College of Medicine, Seoul; Division of Pulmonary and Critical Care Medicine � , Department of Medicine, Kangbuk Samsung Hospital, Sungkyunkwan University School of Medicine, Seoul, Korea Address for correspondence Chang-Seok Ki, M.D. Department of Laboratory Medicine, Samsung Medical Center, Sungkyunkwan University School of Medicine, 50 Irwon-dong, Gangnam-gu, Seoul 135-710, Korea Tel : +82.2-3410-2710, Fax : +82.2-3410-2719 E-mail : changski@skku.edu 563 J Korean Med Sci 2006; 21: 563-6 ISSN 1011-8934 Copyright � The Korean Academy of Medical Sciences Report of a Korean Patient with Cystic Fibrosis, Carrying Q98R and Q220X Mutations in the CFTR Gene Although cystic fibrosis (CF) is one of the most frequently seen autosomal-recessive disorders in Caucasians, it is extremely rare in the Korean population. Login to comment
20 Upon mutation analysis, two different mutations (Q98R and Q220X) were identified in the cystic fibrosis transmembrane conductance regulator gene, both of which had been previously detected in CF patients, one from France and the other from England. Login to comment
34 Direct sequencing analysis of all coding exons and their flanking intronic sequences demonstrated that the patient possessed two mutations in his CFTR gene (Fig. 2): a heterozygous A to G transition in exon 4 (c.293A>G; Q98R) and a heterozygous C to T transition in exon 6a (c.658C>T; Q220X). Login to comment
35 A family study demonstrated that the patient`s father and elder brother both also possessed the Q98R mutation, whereas his mother harbored the Q220X mutation. Login to comment
37 Based on our search of the Cystic Fibrosis Mutation Database (http://www.genet.sickkids.on.ca/cftr/), Q98R and Q220X mutations have been reported in CF patients from Southern France and Southern England (8, 9). Login to comment
43 A B Q98R/- Q98R/- -/- Q98R/Q220X -/Q220X Fig. 2. Login to comment
45 A heterozygous Q98R mutation is found in the father, brother, and the proband, and another heterozygous Q220X mutation is found in the mother and the proband. Login to comment
56 In the present study, we report two additional mutations in the list of CFTR gene mutations (Q98R and Q220X), which have been identified in Koreans. Login to comment

PMID: 17850636 [PubMed] Girardet A et al: "Negative genetic neonatal screening for cystic fibrosis caused by compound heterozygosity for two large CFTR rearrangements."

No. Sentence Comment

77 Report of a Korean patient with cystic fibrosis, carrying Q98R and Q220X mutations in the CFTR gene. Login to comment

PMID: 18728376 [PubMed] Kim SJ et al: "[Standardized sweat chloride analysis for the diagnosis of cystic fibrosis in Korea]."

No. Sentence Comment

51 Healthy volunteer No. case Sex Age (yr) Sweat chloride concentration (mmol/L) Right (repeated result)/Left (repeated result) Respiratory symptoms* Gastro-intestinal symptoms � Genetic analysis 1 � F 13 108.1 (105.9)/169.1 (87.5) + + Compound heterozygote (X1291/5T-V470) 2 � F 5 97.5 (75.4)/92.4 (79.5) + - Polymorphism (2694T/G) 3 � M 15 73.7 (66.2)/29.5 (59.9) + - Compound heterozygote (Q98R/Q220X) 4 F 17 99.3/105.6 + - Compound heterozygote (delEx14A/IVS17a-26A>G) Table 2. The clinical features of patients with high sweat chloride concentrations *Cough, sputum, etc; � , diarrhea, steatorrhea, etc. Login to comment
167 Koh WJ, Ki CS, Kim JW, Kim JH, Lim SY. Report of a Korean patient with cystic fibrosis, carrying Q98R and Q220X mutations in the CFTR gene. Login to comment

PMID: 19652440 [PubMed] Izumikawa K et al: "Unique mutations of the cystic fibrosis transmembrane conductance regulator gene of three cases of cystic fibrosis in Nagasaki, Japan."

No. Sentence Comment

2 Case 1; a 24-year-old man with dyspnea and cough was diagnosed as CF with a missense mutation Q98R in exon 4 and a polymorphic 125C in exon 1 in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Login to comment
3 Case 2; a 13-year-old woman born of consanguineous parents was diagnosed as CF with homozygous Q98R mutations in exon 4. Login to comment
37 Missense mutation Q98R was detected in exon 4 and polymorphic 125C was present in exon 1 by CFTR mutation screening. Login to comment
38 Further analysis revealed that Q98R was derived from his father and 125C from his mother. Login to comment
39 Heterozygous Q98R was also recognized in his otherwise healthy elder sister. Login to comment
47 The presence of missense mutation Q98R was detected in a homozygous fashion in exon 4 of Figure2. Login to comment
52 Her father possessed heterozygous Q98R mutation (test was not performed to mother). Login to comment
66 Locus of CFTR mutationCase Age Sex CP sinusitis CBAVD PFD test (%) sweat chloride concentration (mmol/L) Mutation (variant) Exon Mutation (variant) Exon 1 24 M - + + 17.0 94.0 125C 1 Q98R 4 2 13 F + - - 67.0 54.8 Q98R 4 Q98R 4 3 29 F - + - 69.8 60.0 125C 1 R347H 7 CP, consanguineous parents; CBAVD, congenital bilateral absence of the vas deferens; PFD, pancreatic functional diagnostant. Login to comment
69 SummaryofThreeCysticFibrosisCases The CFTR Q98R mutation was first reported by Romey et al (13), and the patient possessed F508del mutation on the other allele. Login to comment
71 Although father and elder sister of the patient carried the same Q98R mutation heterozygously, they were phenotypically healthy. Login to comment
75 In Case 2, the Q98R mutation was detected homozygously and it was likely due to the consanguineous marriage of her parents. Login to comment
78 No cases with Q98R homozygous mutation in CFTR gene was reported among Japanese CF patients in the JIDRF surveillance (unpublished data). Login to comment
81 The common findings observed in these two cases with Q98R were the distribution of lung lesions and the pattern of onset. Login to comment

PMID: 20052366 [PubMed] Gee HY et al: "The L441P mutation of cystic fibrosis transmembrane conductance regulator and its molecular pathogenic mechanisms in a Korean patient with cystic fibrosis."

No. Sentence Comment

164 Report of a Korean patient with cystic fibrosis, carrying Q98R and Q220X mutations in the CFTR gene. Login to comment

PMID: 20638569 [PubMed] Goetzinger KR et al: "An update on cystic fibrosis screening."

No. Sentence Comment

32 Two additional mutations also not included in the current carrier screening panel, G622D and Q98R, were incidentally identified. Login to comment

PMID: 20879059 [PubMed] Kim KW et al: "Association between cystic fibrosis transmembrane conductance regulator gene mutations and susceptibility for childhood asthma in Korea."

No. Sentence Comment

48 Among the 14 mutations, there are no mutant variants in Q98R, I125T, A309, Q220X, and Q1291X loci in our sample and the genotype frequencies of the remaining variants are listed in Table 3. Login to comment
53 CFTR Genetic Variations Analyzed in This Study Name Nucleotide change Exon Consequence Reference - 8G / C G to C at 125 5` UTR sequence variation 9 Q98R A to G at 425 Exon 4 Gln to Arg at 98 8 I125T T to C at 506 Exon 4 Ile to Thr at 125 9 E217G A to G at 782 Exon 6a Glu to Gly at 217 9 Q220X C to T at 790 Exon 6a Gln to Stop at 220 7, 8 A309A C or G at 1059 Exon 7 Sequence variation 9 TG repeat TG10-13 IVS 8 Splicing 9 T repeat T5-9 IVS 8 Splicing 9 M470V A or G at 1540 Exon 10 Met to Val at 470 9 I556V A to G at 1798 Exon 11 Ile to Val at 556 9 T854T T to G at 2694 Exon 14a Sequence variation 9 Q1291X C to T at 4003 Exon 20 Gln to Stop at 1291 9 Q1352H G to C at 4188 Exon 22 Gln to His at 1352 9 R1453W C to T at 4489 Exon 24 Arg to Trp at 1453 9 CFTR,cysticfibrosistransmembraneconductanceregulator. Login to comment

PMID: 21779199 [PubMed] Jung H et al: "Heterogeneous spectrum of CFTR gene mutations in Korean patients with cystic fibrosis."

No. Sentence Comment

54 RESULTS 1.Geneticanalysisofthe2Koreanpatients Two mutations in the CFTR gene were found in Patient 1: a heterozygous A to G transition in exon 4 [c.293A>G (p. Q98R)] and a heterozygous deletion of an A in exon 13 [c.2052delA (p.L728NfsX38)]. Login to comment
89 Aminoacid change Exon Nucleotide number Nucleotide change Typeof mutation Method ofdetection Familialtargetedmutationstudy Ref Father Mother Brother Sister 1 Q98R Exon4 293 A>G Missense Sequencing ND - - NA Thisstudy L728NfsX38 Exon13 2,052 delA Frameshift Sequencing ND + + NA 2 IVS4 579+5 G>A Splicing Sequencing ND ND NA NA Thisstudy 3 Q98R Exon4 293 A>G Missense Sequencing + - + - [15] Q220X Exon6a 658 C>T Nonsense Sequencing - + - - 4 Q98R Exon4 293 A>G Missense Sequencing + - NA NA [16] Q1352H Exon24 4,056 G>C Missense Sequencing - + NA NA 5 IVS12 1,766+2 T>C Splicing Sequencing + - NA NA [18] N1303KfsX6 Exon21 3,908 dupA Frameshift Sequencing - + NA NA 6 IVS17a 3,272-26 A>G Splicing Sequencing MLPA ND ND NA NA [17] Exon14a 2,623-2,751+? Login to comment
4 Results:ThreeCFTRmutationswereidentifiedinthe2patients,includingp.Q98R,c.2052delA,andc.579+5G>A.Inananalysisof9 Korean CF patients that included the 2 patients presented in this study, p.Q98R mutation was the only recurrently observed mutation with a frequency of 18.8% (3/16 alleles). Login to comment
58 Our search of the Cystic Fibrosis Mutation Database [20] showed that the p.Q98R and c.2052delA mutations have also been reported in CF patients from France. Login to comment
81 The identified mutations included 3 missense mutations (p.Q98R, p.Q1352H, and p.L441P), 3 nonsense mutations (p.Q220X, p.Q1291X, and p.L88X), 1 duplication with frameshift (c.3908dupA), 1 insertion with frameshift (c.2089-2090insA), 4 splice site mutations (c.1766+2T>C, c.3272-26A>G, c.579+5G>A, and IVS8-T5) and 2 deletion mutations (c.2052delA and c.2623-?_2751+?del). Login to comment
82 The p.Q98R mutation was the only recurrently observed mutation, with a frequency of 18.8% (3/16 alleles). Login to comment
96 No mutation, except p.Q98R, has repeatedly been observed in Korean CF patients in this study. Login to comment
123 In summary, we report the cases of 2 Korean CF patients with 3 known CFTR mutations (p.Q98R, c.2052delA, and c.579+5G>A), and these mutations have been submitted to the Cystic Fibrosis Mutation Database [20]. Login to comment

PMID: 15300780 [PubMed] Wong LJ et al: "Detection of CFTR mutations using temporal temperature gradient gel electrophoresis."

No. Sentence Comment

89 For example, the p.Q98X and p.Q98R mutations in exon 4; and p.S466X and p.S492F mutations in exon 10, were detected in the temperature range of 52-607C and 51- 577C, respectively. The p.G542X, p.R553X, p.S549N, and p.A559T in exon 11; p.A561E, c.189811G.A, and c.189813A.G in exon 12; and p.W1204X in exon 19; were detected in the temperature range of 51 to 567C. Login to comment
133 Identification of rare and novel mutations and polymorphisms Base substitution Mutation Exon or intron Homozygote or heterozygote Polymorphism or mutation # Alleles identified 1 c.124_146del23bp Frameshift 1 Heterozygote Mutation 1 2 c.296+2T>A Splice Int 2 Heterozygote Mutation 1 3 c.296+28A/G Int 2 Homozygote Polymorphism 2 4 c.355CT p.R75X 3 Heterozygote Mutation 2 5 c.360_365insT Frameshift 3 Heterozygote Mutation 1 6 c.379_381insT Frameshift 3 Heterozygote Mutation 1 7 c.406-1G>A Splice Int 4 Heterozygote Mutation 2 8 c.424C.T p.Q98X 4 Heterozygote Mutation 1 9 c.425A.G p.Q98R 4 Heterozygote Mutation 3 10 c.586A.G p.M152V 4 Homozygote Mutation 2 11 c.663delT Frameshift 5 Heterozygote Mutation 3 12 c.667C>A p.Q179K 5 Heterozygote Mutation, 1 13 c.745C.T p.P205S 6a Heterozygote Mutation 5 14 c.875140A/G 6a Heterozygote Polymorphism 11 15 c.935delA Frameshift 6b Heterozygote Mutation 2 16 c.124811G.A Splice Int 7 Heterozygote Mutation 2 17 c.1285ins TA Frameshift 8 Heterozygote Mutation 4 Homozygote Mutation 2 18 c.1342+196C/T Int 8 Heterozygote Polymorphism 4 Homozygote 2 19 c.1461insAGAT Frameshift 9 Heterozygote Mutation 1 20 c.1525-61A/G 10 Heterozygote Polymorphism 22 21 c.1529C.A/G p.S466X 10 Heterozygote Mutation 1 22 c.1607C.T p.S492F 10 Heterozygote Mutation 3 23 c.1814C.T p.A561E 12 Heterozygote Mutation 1 24 c.189813A.G Splice Int 12 Heterozygote Mutation 1 25 c.18981152T/A Int 12 Heterozygote Polymorphism 5 26 c.1924del 7bp Frameshift 13 Heterozygote Mutation 1 27 c.1949del84 Frameshift 13 Heterozygote Mutation 1 28 c.2055del9toA Frameshift 13 Homozygote Mutation 2 29 c.2105_2117 Frameshift 13 Heterozygote Mutation 4 del13insAGAAA 30 c.2108delA Frameshift 13 Heterozygote Mutation 1 31 c.2184insA Frameshift 13 Heterozygote Mutation 2 32 c.2184delA Frameshift 13 Heterozygote Mutation 1 33 c.2289_2295 Frameshift 13 Heterozygote Mutation 1 del7insGT 34 c.2694T.G p.T854T 14a Heterozygote Polymorphism 10 35 c.2752+12G/C Int 14a Heterozygote Polymorphism 2 36 c.2800C.T p.Q890X 15 Homozygote Mutation 2 37 c.3171delC Frameshift 17a Heterozygote Mutation 1 38 c.3179T>C p.F1016S 17a Heterozygote Mutation 1 39 c.3199del 6bp Frameshift 17a Heterozygote Mutation 1 40 c.3212T.C p.I1027T 17a Heterozygote Mutation 1 41 c.3272-26A.G Splice Int17a Heterozygote Mutation 4 42 c.3271delGG Frameshift 17a Heterozygote Mutation 1 43 c.3313G.C p.G1061R 17b Heterozygote Mutation 1 44 c.3328C.T p.R1066C 17b Heterozygote Mutation 2 45 c.3362T.C p.L1077P 17b Heterozygote Mutation 1 46 c.3431A.C p.Q1100P 17b Heterozygote Mutation 1 47 c.3500-2A>T Splice Int 17b Heterozygote Mutation 1 48 c.3743G.A p.W1204X 19 Heterozygote Mutation 1 Homozygote Mutation 2 49 c.3601-65C/A Int 19 Heterozygote Polymorphism 14 50 c.3863G.A p.G1244E 20 Heterozygote Mutation 3 Table 3. Login to comment

PMID: 17331079 [PubMed] Alonso MJ et al: "Spectrum of mutations in the CFTR gene in cystic fibrosis patients of Spanish ancestry."

No. Sentence Comment

52 Mutation 0.46-0.35 9 c.1078delT #, p.R347P # 8 p.G85V, c.621 + 1G > T #, p.S549R (T > G) #, p.R553X #, c.3849 + 10kbC > T # 7 p.R347H #, c.1812-1G > A, p.R709X 0.30-0.10 6 p.H199Y, p.P205S, 5 p.R117H #, p.G551D #, p.W1089X, p.Y1092X, CFTR50kbdel 4 c.296 + 3insT, c.1717-1G > A #, c.1949del84, c.3849 + 1G > A 3 p.E92K, c.936delTA, c.1717-8G > A, c.1341G > A, p.A561E, c.2603delT, p.G1244E, [p.D1270N; p.R74W] 2 p.Q2X, p.P5L, CFTRdele2,3, p.S50P, p.E60K, c.405 + 1G > A, c.1677delTA, p.L558S, p.G673X, p.R851X, p.Y1014C, p.Q1100P, p.M1101K, p.D1152H, CFTRdele19, p.G1244V, p.Q1281X, p.Y1381X <0,1 1 c.124del23bp, p.Q30X, p.W57X, c.406-1G > A, p.Q98R, p.E115del, c.519delT, p.L159S, c.711 + 3A > T, p.W202X, c.875 + 1G > A, p.E278del, p.W361R, c.1215delG, p.L365P, p.A399D, c.1548delG, p.K536X, p.R560G, c.1782delA, p.L571S, [p.G576A; p.R668C], p.T582R, p.E585X, c.1898 + 1G > A, c.1898 + 3A > G, c.2051delTT, p.E692X, p.R851L, c.2711delT, c.2751 + 3A > G, c.2752-26A > G, p.D924N, p.S945L, c.3121-1G > A, p.V1008D, p.L1065R, [p.R1070W; p.R668C], [p.F1074L; 5T], p.H1085R, p.R1158X, c.3659delC #, c.3667del4, c.3737delA, c.3860ins31, c.3905insT #, c.4005 + 1G > A, p.T1299I, p.E1308X, p.Q1313X, c.4095 + 2T > A, rearrangements study (n = 4) Mutations identified in CF families with mixed European origin: c.182delT, p.L1254X, c.4010del4. Login to comment

PMID: 16049310 [PubMed] Schrijver I et al: "Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations."

No. Sentence Comment

51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS. Login to comment

PMID: 15858154 [PubMed] Schrijver I et al: "Diagnostic testing by CFTR gene mutation analysis in a large group of Hispanics: novel mutations and assessment of a population-specific mutation spectrum."

No. Sentence Comment

98 Spectrum of CFTR Sequence Variants in 257 Hispanic Patients Who Underwent Diagnostic DNA Testing for CF Mutations in 257 patients Allele counts of each mutation % of variant alleles (183) % of all alleles tested (514) ACMG/ACOG recommended 25 mutation panel* DeltaF508 53 28.96 10.31 G542X 7 3.83 1.36 R334W 2 1.09 0.39 R553X 2 1.09 0.39 DeltaI507 1 0.55 0.19 1717 - 1 GϾA 1 0.55 0.19 3120 ϩ 1 GϾA 1 0.55 0.19 7 different mutations 67 36.61 13.04 All mutations included ACMG/ACOG 1248 ϩ 1 GϾA 1 0.55 0.19 1249 - 29delAT 1 0.55 0.19 1288insTA1288insTA 1 0.55 0.19 1341 ϩ 80 GϾA1341 ϩ 80 GϾA 1 0.55 0.19 1429del71429del7 1 0.55 0.19 1525 - 42 GϾA1525 - 42 GϾA 1 0.55 0.19 1717 - 1 GϾA 1 0.55 0.19 1717 - 8 GϾA 2 1.09 0.39 1811 ϩ 1 GϾA1811 ϩ 1 GϾA 1 0.55 0.19 2055del9-ϾA 3 1.64 0.58 2105-2117del13insAGAAA 1 0.55 0.19 2215insG 1 0.55 0.19 2585delT2585delT 1 0.55 0.19 2752 - 6 TϾC 1 0.55 0.19 296 ϩ 28 AϾG 1 0.55 0.19 3120 ϩ 1 GϾ A 1 0.55 0.19 3271 ϩ 8 AϾG3271 ϩ 8 AϾG 1 0.55 0.19 3271delGG 1 0.55 0.19 3272 - 26 AϾG 2 1.09 0.39 3876delA 2 1.09 0.39 4016insT 1 0.55 0.19 406 - 1 GϾA 6 3.28 1.17 406 - 6 TϾC 1 0.55 0.19 4374 ϩ 13 A ϾG 1 0.55 0.19 663delT 1 0.55 0.19 874insTACA874insTACA 1 0.55 0.19 A1009T 2 1.09 0.39 A559T 1 0.55 0.19 D1152H 1 0.55 0.19 D1270N 3 1.64 0.58 D1445N 2 1.09 0.39 D836Y 1 0.55 0.19 DeltaF311 1 0.55 0.19 DeltaF508 53 28.96 10.31 DeltaI507 1 0.55 0.19 E116K 2 1.09 0.39 E585X 1 0.55 0.19 E588VE588V 2 1.09 0.39 E831X 1 0.55 0.19 F311L 1 0.55 0.19 F693L 1 0.55 0.19 G1244E 1 0.55 0.19 G542X 7 3.83 1.36 G576A 1 0.55 0.19 H199Y 3 1.64 0.58 I1027T 3 1.64 0.58 I285FI285F 1 0.55 0.19 L206W 3 1.64 0.58 L320V 1 0.55 0.19 L967S 1 0.55 0.19 L997F 3 1.64 0.58 P1372LP1372L 1 0.55 0.19 P205S 1 0.55 0.19 P439SP439S 1 0.55 0.19 Q1313X 1 0.55 0.19 Q890X 2 1.09 0.39 Q98R 1 0.55 0.19 R1066C 1 0.55 0.19 R1066H 1 0.55 0.19 (Table continues) missense variant, I1027T (3212TϾC), in exon 17a.25 Family studies have not been performed to identify which allele carries two mutations. Login to comment
187 CFTR Sequence Variants Identified in Five Comprehensive CFTR Studies in US Hispanics CFTR mutations Alleles Relative mutation frequency (%) (of 317) deltaF508 123 38.80 3876delA 15 4.70 G542X 12 3.80 406 - 1GϾA 8 2.50 3849 ϩ 10kbCϾT 5 1.60 R75X 4 1.30 935delA 4 1.30 S549N 4 1.30 W1204X 4 1.30 R334W 4 1.30 2055del9ϾA 3 1 R74W 3 1 H199Y 3 1 L206W 3 1 663delT 3 1 3120 ϩ 1GϾA 3 1 L997F 3 1 I1027T 3 1 R1066C 3 1 W1089X 3 1 D1270N 3 1 2105del13insAGAAA 3 1 Q98R 2 Ͻ1 E116K 2 Ͻ1 I148T 2 Ͻ1 R668C 2 Ͻ1 P205S 2 Ͻ1 V232D 2 Ͻ1 S492F 2 Ͻ1 T501A 2 Ͻ1 1949del84 2 Ͻ1 Q890X 2 Ͻ1 3271delGG 2 Ͻ1 3272 - 26AϾG 2 Ͻ1 G1244E 2 Ͻ1 D1445N 2 Ͻ1 R553X 2 Ͻ1 E588V 2 Ͻ1 1717 - 8GϾA 2 Ͻ1 A1009T 2 Ͻ1 S1235R 2 Ͻ1 G85E 1 Ͻ1 296 ϩ 28AϾG 1 Ͻ1 406 - 6TϾC 1 Ͻ1 V11I 1 Ͻ1 Q179K 1 Ͻ1 V201 mol/L 1 Ͻ1 874insTACA 1 Ͻ1 I285F 1 Ͻ1 deltaF311 1 Ͻ1 F311L 1 Ͻ1 L320V 1 Ͻ1 T351S 1 Ͻ1 R352W 1 Ͻ1 1248 ϩ 1GϾA 1 Ͻ1 1249 - 29delAT 1 Ͻ1 1288insTA 1 Ͻ1 1341 ϩ 80GϾA 1 Ͻ1 1429del7 1 Ͻ1 1525 - 42GϾA 1 Ͻ1 P439S 1 Ͻ1 1717 - 1GϾA 1 Ͻ1 1811 ϩ 1GϾA 1 Ͻ1 deltaI507 1 Ͻ1 G551D 1 Ͻ1 A559T 1 Ͻ1 Y563N 1 Ͻ1 (Table continues) In this study, we used temporal temperature gradient gel electrophoresis (TTGE) and direct DNA sequencing to increase the sensitivity of mutation detection in U.S. Hispanics, and to determine whether additional mutations are recurrent. Login to comment

PMID: 15698946 [PubMed] des Georges M et al: "High heterogeneity of CFTR mutations and unexpected low incidence of cystic fibrosis in the Mediterranean France."

No. Sentence Comment

68 of chromosomes (frequency %) p.M1V 1 1 (0.23) p.M1K 1 1 (0.23) c.300delA 3 1 (0.23) p.P67L 3 1 (0.23) c.359insT 3 1 (0.23) p.G85E 3 3 (0.70) c.394delTT 3 1 (0.23) p.Q98R 4 1 (0.23) p.R117H 4 2 (0.47) p.Y122X 4 2 (0.47) p.Y161N 4 1 (0.23) c.621+1GNT intron 4 1 (0.23) c.621+2TNG intron 4 1 (0.23) p.I175V 5 2 (0.47) c.711+1GNT intron 5 5 (1.16) p.L206W 6 3 (0.70) p.Q220X 6 1 (0.23) p.L227R 6 1 (0.23) c.1078delT 7 2 (0.47) p.R334W 7 7 (1.63) p.R347P 7 2 (0.47) c.1215delG 7 1 (0.23) c.T5 intron 8 1 (0.23) p.D443Y 9 1 (0.23) p.I506T 10 1 (0.23) p.I507del 10 4 (0.93) p.F508del 10 259 (60.23) p.F508C 10 1 (0.23) c.1677delTA 10 1 (0.23) c.1717-8GNA intron 10 1 (0.23) c.1717-1GNA intron 10 6 (1.40) p.G542X 11 23 (5.35) p.S549R 11 1 (0.23) p.G551D 11 2 (0.47) p.R553X 11 1 (0.23) c1811+1.6kbANG intron 11 4 (0.93) c.1812-1GNA intron 11 1 (0.23) p.T582I 12 1 (0.23) p.E585X 12 2 (0,47) c.1898+1GNA intron 12 1 (0.23) [c.1898+5GNA ;p.E725K] intron 12 1 (0.23) c.1898+73TNG intron 12 1 (0.23) c.2183AANG 13 4 (0.93) c.2184insA 13 1 (0.23) p.K710X 13 4 (0.93) c.2423delG 13 1 (0.23) p.S776X 13 1 (0.23) c.2493ins8 13 1 (0.23) p.R792X 13 1 (0.23) p.K830X 13 1 (0.23) p.D836Y 14a 1 (0.23) p.W846X1 14a 1 (0.23) c.2711delT 14a 1 (0.23) c.2789+5GNA intron 14b 3 (0.70) p.S945L 15 3 (0.70) p.D993Y 16 1 (0.23) c.3129del4 17a 1 (0.23) c.3195del6 17a 1 (0.23) c.3272-26ANG intron 17a 1 (0.23) [c.3395insA ;pI148T] 17b/4 1 (0,23) p.Y1092X 17b 3 (0.70) Table 1 (continued) Mutation Location exon/intron No. Login to comment

PMID: 10923036 [PubMed] Claustres M et al: "Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France."

No. Sentence Comment

109 h M1K, K14X, W19X, 211delG, G27E, R31C, 237insA, 241delAT, Q39X, 244delTA, 296+2T>C, 297-3C>T, W57X+F87L, 306delTAGA, P67L, A72D, 347delC, R75Q, 359insT, 394delT, 405+4A>G, Q98R, 457TAT>G, R117H+5T, R117H+I1027T, R117L, R117P, H139R, A141D, M152V, N186K, D192N, D192del, E193X, 711+1G>A, 711+3A>G, 712-1G>T, L206F, W216X, C225R, Q237E, G241R, 852del22, 876-14del12, 905delG, 993del5, E292K, Y304X, F311del, 1161delC, R347L, R352Q, W361R, 1215delG, S364P, S434X, D443Y, S466X, C491R, T501A, I506T, F508C, I507del+F508C, F508del+L467F, 1774delCT, R553G, 1802delC, 1806delA, A559E, Y563N, 1833delT, Y569C, Y569H, Y569X, G576X, G576A, T582I, 1898+3A>G+186-13C>G, 1918delGC, R600G, L610S, G628R, 2043delG, 2118del4, E664X, 2174insA, Q689X, K698R, K716X, L732X, 2347delG, 2372del8, R764X, 2423delG, S776X, 2634insT, 2640delT, C866Y, 2752-1G>T, W882X, Y913C, V920M, 2896insAG, H939D, H939R, D979V, D985H, D993Y, 3120G>A, I1005R, 3195del6, 3293delA, 3320ins5, W1063X, A1067T, 3359delCT, T1086I, W1089X, Y1092X+S1235R, W1098X, E1104X, R1128X, 3532AC>GTA, 3548TCAT>G, M1140del, 3600G>A, R1162L, 3667ins4, 3732delA+K1200E, S1206X, 3791delC, S1235R+5T, Q1238R, Q1238X, 3849+4A>G, T1246I, 3869insG, S1255P, R1283K, F1286S, 4005+1G>T, 4006-8T>A, 4015delA, N1303H, N1303I, 4172delGC, 4218insT, 4326delTC, Q1382X, 4375-1C>T, 4382delA, D1445N, CF40kbdel4-10, Cfdel17b. Login to comment

PMID: 9150159 [PubMed] Macek M Jr et al: "Identification of common cystic fibrosis mutations in African-Americans with cystic fibrosis increases the detection rate to 75%."

No. Sentence Comment

70 Finally, 13 mutations found in one patient each had been previously reported in Caucasian patients (Q98R, R352Q, V520F, 1812-1G--A, G542X, S549N, and Y913C) (Romey et al. 1995; Welsh et al. 1995) or in African-American patients (444delA, G480C, 1342-2delAG [originally reported as 1342-1G--+C], 2307insA, 3662delA, and W1316X) (Cutting et al. 1990b; White et al. 1991; Zielenski et al. Login to comment
71 Finally, 13 mutations found in one patient each had been previously reported in Caucasian patients (Q98R, R352Q, V520F, 1812-1G--A, G542X, S549N, and Y913C) (Romey et al. 1995; Welsh et al. 1995) or in African-American patients (444delA, G480C, 1342-2delAG [originally reported as 1342-1G--+C], 2307insA, 3662delA, and W1316X) (Cutting et al. 1990b; White et al. 1991; Zielenski et al. Login to comment

PMID: 9222762 [PubMed] Jordanova A et al: "SSCP analysis: a blind sensitivity trial."

No. Sentence Comment

22 List of Mutations Included in the Experiment and Original Method of Detection Used by the Referring Laboratory Referring Probe Original method laboratory no.a Mutation Exon of detection Original SSCP conditions Institut de 1 1677delTA 10 Heteroduplexes Recerca 1 1859G/C 12 DDGE Oncologica, 3 W1282X 20 SSCPb 6% 19:1 (AA:bisAA) 4°C 5h 30W Department 4 delF508 10 Heteroduplexes de Genetica 4 Q1313X 20 SSCPb 6% 19:1 (AA:bisAA) 4°C 5h 30W Molecular, 5 1609delCA 10 SSCPb 6% 19:1 (AA:bisAA) RT 28h 10W10% glycerol Barcelona, 7 T582R 12 DGGE Spain 8 1898+3G→A ivs 12 DGGE Molecular 910085 1161delC 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Genetics 860176 1138insG 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Laboratory, 930215 1154insTC 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Royal 930838 delF508 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Manchester 930127 delI507 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Children`s 931205 Q493X 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Hospital, 900592 V520F 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm UK G12984 S489X 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 910143 G551D 11 ARMS 930274 S549N 11 SSCP/Heteroduplexes 10% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 920132 1811+1G→C ivs 11 SSCP/Heteroduplexes 10% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 930140 1898+1G→A ivs 12 SSCP/Heteroduplexes 930334 W1282X 20 SSCP/Heteroduplexes 7.25% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 140735 3850-1G→A 20 SSCP/Heteroduplexes 7.25% 49:1 (AA:bisAA) 4°C 20 h 10 V/cm Laboratoire 293 G551D 11 SSCPb 5% 19:1 (AA:bisAA) 4°C 5 h 50W and de Biochimie 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol Genetique, 324 S549R 11 ASO Hybridization Centre 649 1898+1G→A ivs 12 DGGE Hospitalier 583 E585X 12 DGGE Universitaire 710 L967S 15 DGGE Montpellier, 325 S945L 15 SSCPb 5% 19:1 (AA:bisAA) 4° 5h 50W and France 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 473 N1303H 21 SSCPb 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 216 300delA 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 287 394delTT 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 559 R74W 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 237 P67L 3 DGGE 1023 R75X 3 DGGE 885 1215delG 7 DGGE 113 Y122X 4 DGGE, SSCP 356 621+1G→T ivs 4 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 709 621+2T→G ivs 4 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 802 I148T 4 DGGE 1016 Q98R 4 DGGE V75 R117H 4 SSCP 5% 19:1 (AA:bisAA) 4°C 5 h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol a Identification numbers given by referring laboratories. Login to comment
57 Type of Mutations Detected by SSCP Analysis in This Study Type of mutation Mutation Mutation characteristics Detected by SSCP analysis Deletions 1677delTA deletion of TA from 1677 Yes delF508 deletion of 3 bp from 1655 Yes delI507 deletion of 3 bp from 1648 Yes 1609delCA deletion of CA from 1609 Yes 1161delC deletion of C at 1161 Yes 300delA deletion of A at 300 Yes 394delTT deletion of TT from 394 Yes 1215delG deletion of G at 1215 No Insertions 1138insG insertion of G after 1138 Yes 1154insTC insertion of TC after 1154 Yes Base 1859G/C Yes substitutions W1282X G→A at 3978 Yes Q1313X C→T at 4069 Yes T582R C→G at 1877 Yes 1898+3G→A A→G at 1898+3 Yes Q493X C→T at 1609 Yes V520F G→T at 1690 Yes S489X C→A at 1598 Yes G551D G→A at 1784 No S549N G→A at 1778 Yes 1811+1G→C G→C at 1811+1 Yese 1898+1G→A G→A at 1898 Yes 3850-1G→A G→A at 3850-1 Yes S549R T→G at 1779 Yes E585X G→T at 1885 Yes L967S C→T at 2966 Yes S945L C→T at 2966 No N1303H A→C at 4039 Yes R74W C→T at 352 Yes P67L C→T at 332 Yes R75X C→T at 355 Yes Y122X T→A at 498 No 621+1G→T G→T at 621+1 No 621+2T→G T→G at 621+2 No I148T T→C at 575 Yes Q98R A→G at 425 Yes R117H G→A at 482 Yes FIGURE 1. Login to comment

PMID: 23810505 [PubMed] Prach L et al: "Novel CFTR variants identified during the first 3 years of cystic fibrosis newborn screening in California."

No. Sentence Comment

26 Newborns were screened using the California method, which includes i) analysis of serum immunoreactive trypsinogen (IRT) levels using the AutoDELFIA neonatal IRT L kit (PerkinElmer, Waltham, MA) in all newborn blood spot specimens, ii) CFTR mutation panel [29-40 mutations (the mutations on the California panel were selected for the most part according to allelic frequencies found in a comprehensively genotyped group of California CF cases to achieve a 95% race/ethnicity-specific rate of CF case detection in black, white, and Hispanic individuals in California and include c.1585-1G>A, c.1680-1G>A, c.1973-1985del13insAGAAA, c.2175_2176insA, c.164 &#fe; 2T>A (removed on August 12, 2008), c.2988 &#fe; 1G>A, c.3717 &#fe; 12191C>T, c.3744delA, c.274-1G>A, c.489 &#fe; 1G>T, c.579 &#fe; 1G>T, p.A559T, p.F311del, p.F508del, p.I507del, p.G542X, p.G551D, p.G85E, p.H199Y, p.N1303K, p.R1066C, p.R1162X, p.R334W, p.R553X, p.S549N, p.W1089X, p.W1204X (c.3611G>A), p.W1282X, c.1153_1154insAT [added October 4, 2007], c.1923_1931del9insA, c.3140-26A>G, c.531delT, c.803delA, c.54-5940_273 &#fe; 10250del21kb, p.P205S, p.Q98R, p.R75X, p.S492F [added December 12, 2007], c.3659delC, p.G330X, p.W1204X [c.3612G>A] [added August 12, 2008] [Signature CF 2.0 ASR; Asuragen Inc., Austin, TX])] testing of specimens with IRT 62 ng/mL (highest 1.5%), iii) CFTR gene scanning and sequence analysis (Ambry Test: CF; Ambry Genetics, Aliso Viejo, CA) for specimens found to have only one mutation after CFTR mutation panel testing, and iv) referral to 1 of 15 pediatric CF care centers (CFCs) for sweat chloride (SC) testing and follow-up of all newborns with either two CFTR mutations detected during panel testing or one CFTR mutation detected during panel testing and one (or more) additional CFTR mutation and/or variant detected during sequencing. Login to comment

PMID: 24517344 [PubMed] Raju SV et al: "Impact of heterozygote CFTR mutations in COPD patients with chronic bronchitis."

No. Sentence Comment

81 As expected based on genotype-phenotype correlations in the disease [33], HBE cells derived from a F508del CFTR heterozygote had slightly lower CFTR activity at baseline than wild type monolayers as measured by Table 1 List of CFTR mutations analyzed F508del R117H 1717-1G > A R117C G85E R334W 1898 + 1G > A Y122X A455E R347P 2184delA G178R I507del R553X 2789 + 5G > A G314E G542X R560T 3120 + 1G > A G330X G551D W1282X 3659delC R347H N1303K 621 + 1G > T K710X 406-1G > A R1162X 711 + 1G > T E60X G480C R1066C W1089X V520F A559T S1196X Q1238X S1251N S1255X 663delT 935delA 1161delC 1288insTA 2184insA 2307insA 2711delT 2869insG R709X R764X R1158X 574delA Q493X 1898 + 5G > T 3905insT I506T 3849 + 10kbC > T 712-1G > T Q98R Q552X S549N 1078delT H199Y 444delA S549R (T > G) 2143delT P205S 2043delG 1811 + 1.6kbA > G 3272-26A > G L206W 3791delC Y1092X (C > G) 3199del6 F508C 2108delA Y1092X (C > A) D1152H V520I 3667del4 394delTT 3876delA M1101K 1677delTA W1098X (TGA) 1812-1G > A 4016insT 1609delCA 3171delC response to forskolin stimulation (49.3 &#b1; 11.5 bc;A/cm2 in CFTR (+/+) vs. 40.5 &#b1; 5.3 bc;A/cm2 in CFTR (+/-), although this was not statistically significant (Figure 1A,B). Login to comment

PMID: 25553309 [PubMed] et al: "Erratum: Heterogeneous spectrum of CFTR gene mutations in Korean patients with cystic fibrosis."

No. Sentence Comment

6 Frequency of CFTR mutations in Korean CF patients Case No. Amino acid change Exon Nucleotide number Nucleotide change Type of mutation Method of detection Familial targeted mutation study Ref Father Mother Brother Sister 1 Q98R Exon 4 293 A>G Missense Sequencing ND - - NA This study L728NfsX38 Exon 13 2,052 delA Frameshift Sequencing ND + + NA 2 IVS 4 579+5 G>A Splicing Sequencing ND ND NA NA This study 3 Q98R Exon 4 293 A>G Missense Sequencing + - + - [15] Q220X Exon 6a 658 C>T Nonsense Sequencing - + - - 4 Q98R Exon 4 293 A>G Missense Sequencing + - NA NA [16] Q1352H Exon 24 4,056 G>C Missense Sequencing - + NA NA 5 IVS 12 1,766+2 T>C Splicing Sequencing + - NA NA [18] N1303KfsX6 Exon 21 3,908 dupA Frameshift Sequencing - + NA NA 6 IVS 17a 3,272-26 A>G Splicing Sequencing MLPA ND ND NA NA [17] Exon14a 2,623-2,751+? Login to comment
9 Frequency of CFTR mutations in Korean CF patients Case No. Amino acidchange Exon Nucleotide number* Nucleotide change Type of mutation Method of detection Familial targeted mutation study Ref Father Mother Brother Sister 1 Q98R Exon 4 293 A>G Missense Sequencing ND - - NA This study K684NfsX38 Exon 13 2,052 delA Frameshift Sequencing ND + + NA 2 IVS 4 579+5 G>A Splicing Sequencing ND ND NA NA This study 3 Q98R Exon 4 293 A>G Missense Sequencing + - + - [15] Q220X Exon 6a 658 C>T Nonsense Sequencing - + - - 4 Q98R Exon 4 293 A>G Missense Sequencing + - NA NA [16] Q1352H Exon 24 4,056 G>C Missense Sequencing - + NA NA 5 IVS 12 1,766+2 T>C Splicing Sequencing + - NA NA [18] N1303KfsX6 Exon 21 3,908 dupA Frameshift Sequencing - + NA NA 6 IVS 17a 3,272-26 A>G Splicing Sequencing ND ND NA NA [17] Exon14a 2,623-2,751+? Login to comment

PMID: 25824995 [PubMed] Salinas DB et al: "Benign outcome among positive cystic fibrosis newborn screen children with non-CF-causing variants."

No. Sentence Comment

32 All but three of the variants on the panel (F311del, 935delA, and Q98R) have been evaluated by CFTR2 and determined to be CF-causing. Login to comment

PMID: 26574590 [PubMed] Kharrazi M et al: "Newborn Screening for Cystic Fibrosis in California."

No. Sentence Comment

77 July 16, 2007 c.164+2T.A (296+2T.A) 28 c.254G.A (G85E) c.274-1G.A (406-1G.A) c.489+1G.T (621+1G.T) c.579+1G.T (711+1G.T) c.595C.T (H199Y) c.933_935delCTT (F311del) c.1000C.T (R334W) c.1519_1521delATC (I507del) c.1521_1523delCTT (F508del) c.1585-1G.A (1717-1G.A) c.1624G.T (G5423) c.1646G.A (S549N) c.1652G.A (G551D) c.1657C.T (R5533) c.1675G.A (A559T) c.1680-1G.A (1812-1G.A) c.1973-1985del13insAGAAA (2105-2117del13insAGAAA) c.2175_2176insA (2307insA) c.2988+1G.A (3120+1G.A) c.3196C.T (R1066C) c.3266G.A (W10893) c.3485G.T (R11623) c.3611G.A (W12043 [3743G.A]) c.3717+12191C.T (3849+10kbC.T) c.3744delA (3876delA) c.3846G.A (W12823) c.3909C.G (N1303K) October 4, 2007 c.1153_1154insAT (1288insTA) 29 December 12, 2007 c.54-5940_273+10250del21kb (CFTRdele2,3(21kb)) 38 c.531delT (663delT) c.613C.T (P205S) c.803delA (935delA) c.1475C.T (S492F) c.1923_1931del9insA (2055del9.A) c.223C.T (R753) c.293A.G (Q98R) c.3140-26A.G (3272-26A.G) August 12, 2008 c.988G.T (G3303) 40 c.3612G.A (W12043 [3744G.A]) c.3659delC (3791delC) c.164+2T.A (296+2T.A), removed cDNA, complementary DNA. Login to comment