ABCMdb

ABCC7 p.Ile336Lys

Admin's notes:	Class II-III (maturation defect, gating defect) Veit et al.
ClinVar:	c.1007T>A , p.Ile336Lys D , Pathogenic
CF databases:	c.1007T>A , p.Ile336Lys D , CF-causing ; CFTR1: This is a missense mutation which is caused by a subsitution of a T to an A nucleotide position 1139 thereby replacing an uncharged amino acid for an charged amino acid in the first transmembrane region of the CFTR gene. This mutation was found in 1 out of 61 unrelated Belgian CF chromosomes. c.1006A>C , p.Ile336Leu (CFTR1) ? ,
Predicted by SNAP2:	A: D (91%), C: D (85%), D: D (95%), E: D (95%), F: D (95%), G: D (95%), H: D (95%), K: D (53%), L: D (91%), M: D (91%), N: D (95%), P: D (95%), Q: D (95%), R: D (95%), S: D (95%), T: D (95%), V: N (53%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	A: N, C: N, D: D, E: D, F: N, G: D, H: D, K: D, L: N, M: N, N: D, P: D, Q: D, R: D, S: N, T: N, V: N, W: D, Y: D,

[switch to compact view]
Comments [show]

II-III (maturation defect, gating defect) <a href="https://www.ncbi.nlm.nih.gov/pubmed/26823392">Veit et al.</a>
admin on 2016-08-19 15:16:22

Publications
[hide] Mutations of the cystic fibrosis gene, but not cat... Am J Gastroenterol. 2000 Aug;95(8):2061-7. Ockenga J, Stuhrmann M, Ballmann M, Teich N, Keim V, Dork T, Manns MP
Mutations of the cystic fibrosis gene, but not cationic trypsinogen gene, are associated with recurrent or chronic idiopathic pancreatitis.
Am J Gastroenterol. 2000 Aug;95(8):2061-7., [PMID:10950058]

Abstract [show]
OBJECTIVE: We investigated whether mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene and cationic trypsinogen gene are associated with recurrent acute, or chronic idiopathic pancreatitis. METHODS: Twenty patients with idiopathic pancreatitis (11 women, nine men; mean age, 30 yr) were studied for the presence of a CFTR mutation by screening the genomic DNA for more than 30 mutations and variants in the CFTR gene. Selected mutations of the cationic trypsinogen gene were screened by Afl III restriction digestion or by a mutation-specific polymerase chain reaction (PCR). In each patient exons 1, 2, and 3 of the cationic trypsinogen gene were sequenced. Patients with a CFTR mutation underwent evaluation of further functional electrophysiological test (intestinal current measurement). RESULTS: No mutation of the cationic trypsinogen gene was detected. A CFTR mutation was detected in 6/20 (30.0%) patients. Three patients (15.0%) had a cystic fibrosis (CF) mutation on one chromosome (deltaF508, I336K, Y1092X), which is known to cause phenotypical severe cystic fibrosis. One patient was heterozygous for the 5T allele. In addition, two possibly predisposing CFTR variants (R75Q, 1716G-->A) were detected on four patients, one of these being a compound heterozygous for the missense mutation I336K and R75Q. No other family member (maternal I336K; paternal R75Q; sister I1336K) developed pancreatitis. An intestinal current measurement in rectum samples of patients with a CFTR mutation revealed no CF-typical constellations. CONCLUSIONS: CFTR mutations are associated with recurrent acute, or chronic idiopathic pancreatitis, whereas mutations of the cationic trypsinogen mutation do not appear to be a frequent pathogenetic factor.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
8 Three patients (15.0%) had a cystic fibrosis (CF) mutation on one chromosome (⌬F508, I336K, Y1092X), which is known to cause phenotypical severe cystic fibrosis. Login to comment
10 In addition, two possibly predisposing CFTR variants (R75Q, 1716G3A) were detected on four patients, one of these being a compound heterozygous for the missense mutation I336K and R75Q. Login to comment
11 No other family member (maternal I336K; paternal R75Q; sister I1336K) developed pancreatitis. Login to comment
54 Finally, we tested all samples for the presence of mutations or variants R75Q, I336K, R347H, IVS8-5T (5T allele), 1716G3A, 2143delT, 2789ϩ5G3A, Y1092X, 3272-26A3G, D1152H, and CFTRdel2,3 (21kb) by PCR and restriction enzyme digestion with the respective enzymes (for mutation references, see http://www.genet. Login to comment
77 RESULTS CFTR Screening In 3/20 (15.0%, CI: 5.2-36.0%) patients a CFTR mutation (⌬F508, I336K, Y1092X) known to cause a phenotypical severe clinical course of cystic fibrosis was detected (p Ͻ 0.05 compared to expected frequency of 4%). Login to comment
78 In four patients two potentially predisposing variants, 1716G3A and R75Q, were also present, one of these being compound heterozygous for I336K and R75Q, whereas the other two carried only R75Q or 1716G3A. Login to comment
89 Characteristics of the Study Population Patient Gender CFTR Genotype PolyT Genotype Age at Study, Yr Age at Onset of Disease, Yr Inclusion Criteria Pseudomonas Antibody* Exocrine Insufficiency† Morphological Changes‡ S. K. F I336K/R75Q 7T/7T 34 26 CP 2.44 Yes Mild M. T. M Y1092X/wt 7T/7T 34 30 CP 1.06 Yes Moderate K. M. M R75Q/wt 7T/7T 24 19 RAP 0.46 No Mild L. A. F 1716G3A/wt 7T/7T 27 26 RAP 0.45 No Normal C. B. F ⌬F508/wt 7T/9T 40 38 CP 0.84 No Mild W. O. M 1716G3A/wt 7T/7T 31 29 RAP 0.86 No Normal L. M. F wt/wt 5T/7T 37 27 CP 1.25 Yes Moderate H. K. F wt/wt 7T/7T 27 20 CP 0.84 Yes Mild K. A. M wt/wt 7T/7T 24 19 CP 0.57 Yes Mild H. K. M wt/wt 7T/7T 23 19 CP 0.58 Yes Severe E. H. M wt/wt 7T/7T 25 20 RAP 1.36 No Normal M. K. F wt/wt 7T/7T 35 30 CP 0.55 No Moderate W. S. M wt/wt 7T/7T 19 19 RAP 0.58 No Normal L. D. F wt/wt 7T/7T 33 30 CP 1.07 Yes Severe S. Login to comment
104 Family Study of CFTR In the compound heterozygous patient S.K., we investigated the parents and the sister of this patient for the presence of the missense substitutions R75Q and I336K. Login to comment
106 DNA analysis determined the mutation I336K in patient S.K. and her sister; the mutation had been inherited from their mother. Login to comment
124 Results of Sweat Test, Intestinal Current Measurement Test, and Anamnestic Features of Patients With Idiopathic Recurrent Acute or Chronic Pancreatic Disease and an Abnormal CFTR Allele Patient CFTR Genotype PolyT Genotype Sweat Chloride (mmol/L) Intestinal Current Measurement (␮A/cm2 )* Anamnestic Features Known to be Associated With Atypical CF S. K. I336K/R75Q 7T/7T 26 50 Nasal polyps M. T. Y1092X/wt 7T/7T 42 27 K. M. R75Q/wt 7T/7T 61 31 L. A. Login to comment
136 Restriction enzyme analysis of exon 7 with SspI detected an atypical band at 410 bp (panel A), suggesting a heterozygosity for I336K. Login to comment
137 Further direct sequence analysis (panel B) showed an exchange of thymidin (T) to adenine (A) at position 1139, confirming the presence of mutation I336K (37). Login to comment
151 In addition, we detected the mutations I336K and Y1092X, which have not been described before, in patients with idiopathic pancreatitis. Login to comment
155 The missense substitution R75Q was found in two unrelated pancreatitis patients (10%), one of them compound heterozygous for R75Q/I336K. Login to comment
182 The fact that the paternal CFTR allele from our patient S.K. harboring the R75Q substitution is different from the paternal CFTR allele of her sister-who, like her mother, carries the I336K mutation without having developed pancreatitis-supports this theory. Login to comment

[hide] Effect of genistein on native epithelial tissue fr... Br J Pharmacol. 2000 Aug;130(8):1884-92. Mall M, Wissner A, Seydewitz HH, Hubner M, Kuehr J, Brandis M, Greger R, Kunzelmann K
Effect of genistein on native epithelial tissue from normal individuals and CF patients and on ion channels expressed in Xenopus oocytes.
Br J Pharmacol. 2000 Aug;130(8):1884-92., [PMID:10952679]

Abstract [show]
The flavonoid genistein has been shown to activate a Cl(-) conductance in various cell types expressing CFTR. We examined if similar effects can be observed when genistein is applied to native ex vivo tissues from human respiratory tract and rectum. We further compared the effects when genistein was applied to oocytes of Xenopus laevis expressing CFTR. In oocytes, both wtCFTR and DeltaF508-CFTR were activated by genistein while both cyclic AMP (K(v)LQT1) and Ca(2+) (SK4) activated K(+) channels were inhibited at high concentrations of genistein. Biopsies from nasal polyps and rectal mucosa were obtained from normal individuals (non-CF) and CF patients and in the presence of amiloride (10 micromol l(-1); mucosal side) the effects of genistein were assessed using a perfused Ussing chamber. In non-CF airway epithelia, genistein (50 micromol l(-1); mucosal side) increased lumen negative I(sc) but had no additional effects on tissues pre-stimulated with IBMX and forskolin (100 micromol l(-1) and 1 micromol l(-1); both sides). In non-CF rectal biopsies, in the presence of amiloride (10 micromol l(-1); mucosal side) and indomethacin (10 micromol l(-1); basolateral side), genistein increased lumen negative I(sc) and enabled cholinergic (carbachol; CCH, 100 micromol l(-1); basolateral side) stimulation of Cl(-) secretion indicating activation of luminal CFTR Cl(-) channels. However, after stimulation with IBMX/forskolin, genistein induced opposite effects and significantly inhibited CCH activated I(sc). In CF airway and intestinal tissues genistein failed to induce Cl(-) secretion. Thus, genistein is able to activate luminal CFTR Cl(-) conductance in non-CF tissues and mutant CFTR in oocytes. However, additional inhibitory effects on basolateral K(+) conductance and missing effects in native CF tissues do not support the use for pharmacological intervention in CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
30 In all CF patients from whom rectal biopsies were studied DNA analysis was carried out for the following CFTR mutations: DF508; R117H and S108F in exon 4; R347P, R347H, I336K and T338I in exon 7; S549N, G551D, R553X, G542X, Q552X, 1717-1 G?A in exon 11; W1282X and 3905insT in exon 20; N1303K in exon 21 and 3849+10kB C?T in intron 19. Login to comment

[hide] DHPLC screening of cystic fibrosis gene mutations. Hum Mutat. 2002 Apr;19(4):374-83. Ravnik-Glavac M, Atkinson A, Glavac D, Dean M
DHPLC screening of cystic fibrosis gene mutations.
Hum Mutat. 2002 Apr;19(4):374-83., [PMID:11933191]

Abstract [show]
Denaturing high performance liquid chromatography (DHPLC) using ion-pairing reverse phase chromatography (IPRPC) columns is a technique for the screening of gene mutations. In order to evaluate the potential utility of this assay method in a clinical laboratory setting, we subjected the PCR products of 73 CF patients known to bear CFTR mutations to this analytic technique. We used thermal denaturation profile parameters specified by the MELT program tool, made available by Stanford University. Using this strategy, we determined an initial analytic sensitivity of 90.4% for any of 73 known CFTR mutations. Most of the mutations not detected by DHPLC under these conditions are alpha-substitutions. This information may eventually help to improve the MELT algorithm. Increasing column denaturation temperatures for one or two degrees above those recommended by the MELT program allowed 100% detection of CFTR mutations tested. By comparing DHPLC methodology used in this study with the recently reported study based on Wavemaker 3.4.4 software (Transgenomic, Omaha, NE) [Le Marechal et al., 2001) and with previous SSCP analysis of CFTR mutations [Ravnik-Glavac et al., 1994] we emphasized differences and similarities in order to refine the DHPLC system and discuss the relationship to the alternative approaches. We conclude that the DHPLC method, under optimized conditions, is highly accurate, rapid, and efficient in detecting mutations in the CFTR gene and may find high utility in screening individuals for CFTR mutations. Hum Mutat 19:374-383, 2002. Published 2002 Wiley-Liss, Inc.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 The following mutations have been studied: exon 3: W57G, R74W, R75Q, G85E, 394delTT, 405+ 1G>A; exon 4: E92X, P99L, 441delA, 444delA, 457TAT>G, D110H, R117C, R117H, A120T, 541delC, 544delCA, Q151X, 621+1G>T, 662- 2A>C; exon 7: 1078delT, F331L, R334W, I336K, R347C, R347P, A349V, R352Q, 1221delCT; exon 10: S492F, Q493X, 1609delCA, deltaI507, deltaF508; exon 11: G542X, S549N, G551D, R553X, A559T, R560K, R560T; exon 13: K716X, Q685X, G628R, L719X; exon 17b: H1054D, G1061R, 3320ins5, R1066H, R1066L, R1070Q, 3359delCT, L1077P, H1085R, Y1092X; exon 19: R1162X, 3659delC, 3662delA, 3667del4, 3737delA, I1234V, S1235R, 3849G>A; exon 20: 3860ins31,S1255X,3898insC,3905insT,D1270N, W1282X, Q1291R; and exon 21: N1303H, N1303K, W1316X. Login to comment

[hide] Determination of the relative contribution of thre... Eur J Hum Genet. 2002 Feb;10(2):100-6. Audrezet MP, Chen JM, Le Marechal C, Ruszniewski P, Robaszkiewicz M, Raguenes O, Quere I, Scotet V, Ferec C
Determination of the relative contribution of three genes-the cystic fibrosis transmembrane conductance regulator gene, the cationic trypsinogen gene, and the pancreatic secretory trypsin inhibitor gene-to the etiology of idiopathic chronic pancreatitis.
Eur J Hum Genet. 2002 Feb;10(2):100-6., [PMID:11938439]

Abstract [show]
In the last 5 years, mutations in three genes, the cystic fibrosis transmembrane conductance regulator (CFTR) gene, the cationic trypsinogen (PRSS1) gene, and the pancreatic secretory trypsin inhibitor (PSTI) gene, have been found to be associated with chronic pancreatitis (CP). In this study, using established mutation screening methods, we systematically analysed the entire coding sequences and all exon/intron junctions of the three genes in 39 patients with idiopathic CP (ICP), with a view to evaluating the relative contribution of each gene to the aetiology of the disease. Our results demonstrate that, firstly, 'gain-of-function' mutations in the PRSS1 gene may occasionally be found in an obvious ICP subject. Secondly, presumably 'loss-of-function' mutations in the PSTI gene appear to be frequent, with a detection rate of at least 10% in ICP and, finally, abnormal CFTR alleles are common: at least 20% of patients carried one of the most common CFTR mutations, and about 10% of patients were compound heterozygotes, having at least one 'mild' allele. Thus, in total, about 30% of ICP patients carried at least one abnormal allele in one of the three genes, and this is the most conservative estimate. Moreover, a trans-heterozygous state with sequence variations in the PSTI/CFTR genes was found in three patients. However, an association between the 5T allele in intron 8 of the CFTR gene and ICP remains unproven.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
93 Thus, as in the case of the two previously reported compound heterozygotes, F508del/R117H4 and I336K/R75Q,32 none of our four compound heterozygotes could be described as carrying two `severe' CFTR mutations. Login to comment

[hide] Analysis by mass spectrometry of 100 cystic fibros... Hum Reprod. 2002 Aug;17(8):2066-72. Wang Z, Milunsky J, Yamin M, Maher T, Oates R, Milunsky A
Analysis by mass spectrometry of 100 cystic fibrosis gene mutations in 92 patients with congenital bilateral absence of the vas deferens.
Hum Reprod. 2002 Aug;17(8):2066-72., [PMID:12151438]

Abstract [show]
BACKGROUND: Limited mutation analysis for congenital bilateral absence of the vas deferens (CBAVD) has revealed only a minority of men in whom two distinct mutations were detected. We aimed to determine whether a more extensive mutation analysis would be of benefit in genetic counselling and prenatal diagnosis. METHODS: We studied a cohort of 92 men with CBAVD using mass spectrometry and primer oligonucleotide base extension to analyse an approximately hierarchical set of the most common 100 CF mutations. RESULTS: Analysis of 100 CF mutations identified 33/92 (35.9%) patients with two mutations and 29/92 (31.5%) with one mutation, compound heterozygosity accounting for 94% (31/33) of those with two mutations. This panel detected 12.0% more CBAVD men with at least one mutation and identified a second mutation in >50% of those considered to be heterozygotes under the two routine 25 mutation panel analyses. CONCLUSION: Compound heterozygosity of severe/mild mutations accounted for the vast majority of the CBAVD patients with two mutations, and underscores the value of a more extensive CF mutation panel for men with CBAVD. The CF100 panel enables higher carrier detection rates especially for men with CBAVD, their partners, partners of known CF carriers, and those with 'mild' CF with rarer mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 Given the frequency of CF mutations, especially in the Caucasian population ( in 25), and the common request by CBAVD men to sire their own offspring by using surgical Table I. The 100 most common cystic fibrosis mutations listed by exon Mutationa Exonb Frequency (%)c G85E 3 0.1 394delTT 3 Swedish E60X 3 Belgium R75X 3 405ϩ1G→A Int 3 R117H 4 0.30 Y122X 4 French 457TAT→G 4 Austria I148T 4 Canada (French Canadian) 574delA 4 444delA 4 R117L 4 621ϩ1G→T Int 4 0.72 711ϩ1G→T Int 5 Ͼ0.1 712-1G→T Int 5 711ϩ5G→A Int 5 Italy (Caucasian) L206W 6a R347P 7 0.24 1078delT 7 Ͼ0.1 R334W 7 Ͼ0.1 1154InsTC 7 T338I 7 Italy R347H 7 Turkey Q359K/T360K 7 Israel (Georgian Jews) I336K 7 R352Q 7 G330X 7 S364P 7 A455E 9 0.20 I507 10 0.21 F508 10 66.02 1609delCA 10 Spain (Caucasian) V520F 10 Q493X 10 C524X 10 G480C 10 Q493R 10 1717-1G→A Int 10 0.58 R553X 11 0.73 G551D 11 1.64 G542X 11 2.42 R560T 11 Ͼ0.1 S549N 11 Q552X 11 Italy S549I 11 Israel (Arabs) A559T 11 African American R553G 11 R560K 11 1812-1G→A Int 11 A561E 12 E585X 12 Y563D 12 Y563N 12 1898ϩ1G→A Int 12 0.22 1898ϩ1G→C Int 12 2183AA→G 13 Italian 2184delA 13 Ͻ0.1 K710X 13 2143delT 13 Moscow (Russian) 2184InsA 13 1949del84 13 Spain (Spanish) 2176InsC 13 2043delG 13 2307insA 13 2789ϩ5G→A Int 14b Ͼ0.1 2869insG 15 S945L 15 Q890X 15 3120G→A 16 2067 Table I. continued Mutationa Exonb Frequency (%)c 3120ϩ1G→A Int 16 African American 3272-26A→G Int 17a R1066C 17b Portugal (Portugese) L1077P 17b R1070Q 17b Bulgarian W1089X 17b M1101K 17b Canada (Hutterite) R1070P 17b R1162X 19 0.29 3659delC 19 Ͼ0.1 3849G→A 19 3662delA 19 3791delC 19 3821delT 19 Russian Q1238X 19 S1235R 19 France, South S1196X 19 K1177R 19 3849ϩ10kbC→T Int 19 0.24 3849ϩ4A→G Int 19 W1282X 20 1.22 S1251N 20 Dutch, Belgian 3905insT 20 Swiss, Acadian, Amish G1244E 20 R1283M 20 Welsh W1282R 20 D1270N 20 S1255X 20 African American 4005ϩ1G→A Int 20 N1303K 21 1.34 W1316X 21 aMutations were chosen according to their frequencies (Cystic Fibrosis Genetic Analysis Consortium, 1994; Zielenski and Tsui, 1995; Estivill et al., 1997). Login to comment

[hide] CFTR gene mutations in sarcoidosis. Eur J Hum Genet. 2002 Nov;10(11):729-32. Schurmann M, Albrecht M, Schwinger E, Stuhrmann M
CFTR gene mutations in sarcoidosis.
Eur J Hum Genet. 2002 Nov;10(11):729-32., [PMID:12404105]

Abstract [show]
Sarcoidosis is a complex disease of multiorgan granulomatous inflammation. Genetic susceptibility is involved in the pathogenesis of the disorder. Two successive studies from Italy have shown a high frequency of mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene in patients suffering from sarcoidosis. We have genotyped a panel of 63 families with two or more affected siblings for the CFTR gene mutation R75Q, which was found to be present in three of 26 cases of the Italian study. Although R75Q was present in seven families, it was neither associated with the sarcoidosis phenotype in the German population (P=0.5), nor was it linked to sarcoidosis (P=0.54). In addition, a screening for 34 functional CFTR mutations was performed in a subset of 54 patients from 25 families. These patients were known to be concordant for at least one parental copy of the CFTR gene. With the exception of the mayor CF mutation deltaF508, which was present in three patients and absent in one patient from two families, we did not find any other CF mutation in these 54 patients. Our results do not support the hypothesis that CFTR mutations have a major influence on the pathogenesis of sarcoidosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
30 A list of the corresponding mutations with detailed frequencies in the German population is given in ref. 12 Finally, we tested all 54 samples for the presence of I336K, Y1092X, 3272-26A?G and CFTRdel2,3 (21 kb) by PCR and restriction enzyme digestion with the respective enzymes (for mutation references, refer to the Cystic Fibrosis Genetic Analysis Consortium database). Login to comment

[hide] Isolated idiopathic chronic pancreatitis associate... Gastroenterol Clin Biol. 2003 Aug-Sep;27(8-9):821-4. Reboul MP, Laharie D, Amouretti M, Lacombe D, Iron A
Isolated idiopathic chronic pancreatitis associated with a compound heterozygosity for two mutations of the CFTR gene.
Gastroenterol Clin Biol. 2003 Aug-Sep;27(8-9):821-4., [PMID:14586256]

Abstract [show]
We report the case of a patient suffering from idiopathic chronic pancreatitis (ICP) and compound heterozygous for mutations G542X and S1235R of the cystic fibrosis transmembrane regulator (CFTR) gene. The patient had normal sweat test and no other clinical sign usually linked with a typical or moderate pathology (bronchiectasis, nasal polyposis, congenital absence of the vas deferens) of the CFTR gene. G542X is a severe mutation, which is usually found in classical cystic fibrosis when associated with other severe mutations. S1235R is a quite rare abnormality recently reported as being potentially pathogenic when combined in trans with a second CF mutation. Our case is quite similar to the only other six patients in the literature in whom only the pancreas is affected and who bear a rare mutation with moderate effect. The history and the clinical features of our patient indicate an unambiguous isolated ICP in which the presence of the S1235R mutation--in trans with regard to G542X--is likely responsible for the ICP phenotype. This case could throw light on some of the as yet poorly known abnormalities of the CFTR gene in the ICP phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
80 Patient CFTR no PolyT genotype Sex genotype Age (years) Sweat chloride (mmol/L) Anamnestic features known to be associated with atypical CF Reference 1 F508del/R117H 9T/7T M 45 29 CBAVD [4] 2 N1303K/R117H 9T/7T F n.a. 37 bronchiectasis, sinusitis, positive NPD [5] 3 R1162X/2789+5G>A 7T/7T F n.a. 108 chronic cough [5] 4 I336K/R75Q 7T/7T F 26 26 nasal polyposis [7] 5 F508del/L997F 9T/7T M 17 24 none [11] 6 3849+10kbC>T/3878delG 7T/7T M 14 n.a. none [11] 7 S1235R/L997F 5T/7T M 27 25 none [11] 8 F508del/R117H n.a. M 45 29 CBAVD, smooth P. aeruginosa [12] 9 F508del/I1027T n.a. F 32 59 none [12] 10 F508del/D1152H n.a. M 8 62 none [12] 11 F508del/D1152H n.a. F 15 32 none [12] 12 F508del/P574H n.a. F 26 81 sinus surgery, S. aureus, S. maltophilia [12] 13 F508del/3120G>A n.a. F 40 n.a. n.a. [12] 14 F508del/G1069R n.a. M 16 n.a. n.a. [12] 15 G542X/S1235R 7T/7T M 35 15 none [this study] n.a.: not available. Login to comment

[hide] Pharmacological induction of CFTR function in pati... Pediatr Pulmonol. 2005 Sep;40(3):183-96. Kerem E
Pharmacological induction of CFTR function in patients with cystic fibrosis: mutation-specific therapy.
Pediatr Pulmonol. 2005 Sep;40(3):183-96., [PMID:15880796]

Abstract [show]
CFTR mutations cause defects of CFTR protein production and function by different molecular mechanisms. Mutations can be classified according to the mechanisms by which they disrupt CFTR function. This understanding of the different molecular mechanisms of CFTR dysfunction provides the scientific basis for the development of targeted drugs for mutation-specific therapy of cystic fibrosis (CF). Class I mutations are nonsense mutations that result in the presence of a premature stop codon that leads to the production of unstable mRNA, or the release from the ribosome of a short, truncated protein that is not functional. Aminoglycoside antibiotics can suppress premature termination codons by disrupting translational fidelity and allowing the incorporation of an amino acid, thus permitting translation to continue to the normal termination of the transcript. Class II mutations cause impairment of CFTR processing and folding in the Golgi. As a result, the mutant CFTR is retained in the endoplasmic reticulum (ER) and eventually targeted for degradation by the quality control mechanisms. Chemical and molecular chaperones such as sodium-4-phenylbutyrate can stabilize protein structure, and allow it to escape from degradation in the ER and be transported to the cell membrane. Class III mutations disrupt the function of the regulatory domain. CFTR is resistant to phosphorylation or adenosine tri-phosphate (ATP) binding. CFTR activators such as alkylxanthines (CPX) and the flavonoid genistein can overcome affected ATP binding through direct binding to a nucleotide binding fold. In patients carrying class IV mutations, phosphorylation of CFTR results in reduced chloride transport. Increases in the overall cell surface content of these mutants might overcome the relative reduction in conductance. Alternatively, restoring native chloride pore characteristics pharmacologically might be effective. Activators of CFTR at the plasma membrane may function by promoting CFTR phosphorylation, by blocking CFTR dephosphorylation, by interacting directly with CFTR, and/or by modulation of CFTR protein-protein interactions. Class V mutations affect the splicing machinery and generate both aberrantly and correctly spliced transcripts, the levels of which vary among different patients and among different organs of the same patient. Splicing factors that promote exon inclusion or factors that promote exon skipping can promote increases of correctly spliced transcripts, depending on the molecular defect. Inconsistent results were reported regarding the required level of corrected or mutated CFTR that had to be reached in order to achieve normal function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 C-D565G II DF508 D1507 S549R S549I S549N S549R S945D S945L H1054D G1061R L1065P R1066C R1066M L1077P H1085R N1303K G85E III G551D S492F V520F R553G R560T R560S Y569D IV R117H, R117C, R117P, R117L D1152H, L88S, G91R, E92K, Q98R, P205S, L206W, L227R, F311L, G314E, R334W, R334Q, I336K, T338I, L346P, R347C, R347H, R347L, R347P, L927P, R1070W, R1070Q V 3849 þ 10 kb C ! Login to comment

[hide] Two-tiered immunoreactive trypsinogen-based newbor... J Pediatr. 2005 Sep;147(3 Suppl):S83-8. Sontag MK, Hammond KB, Zielenski J, Wagener JS, Accurso FJ
Two-tiered immunoreactive trypsinogen-based newborn screening for cystic fibrosis in Colorado: screening efficacy and diagnostic outcomes.
J Pediatr. 2005 Sep;147(3 Suppl):S83-8., [PMID:16202790]

Abstract [show]
OBJECTIVE: To examine immunoreactive trypsinogen (IRT)-based screening for cystic fibrosis (CF) for recall rate, genotype distribution, and "borderline" sweat test results. STUDY DESIGN: CF newborn screening in Colorado began in 1982, and >1,153,000 infants were screened through 2002 with an IRT-based screen (IRT/IRT). RESULTS: We have identified 313 infants with CF, giving an overall incidence of 1 in 3684 and a Hispanic incidence of 1 in 6495. Fifty-five infants with meconium ileus (17.6%) were excluded from analysis. Fourteen infants with false-negative results were identified (5.4%). The average recall rate was 0.6%, with a positive predictive value of 4.7%. Ninety-three percent of the infants had at least 1 DeltaF508 mutation, and 98% of the infants had at least 1 mutation from the American College of Medical Genetics recommended panel. Six infants had hypertrypsinogenemia and borderline results on sweat tests (30-60 mmol/L). Increased variability in sweat chloride levels were seen in these infants compared with infants with homozygous DeltaF508. Three children with initial borderline results on sweat tests had CF diagnosed. CONCLUSIONS: The recall and false-negative rates of our IRT/IRT CF screening program are reported. Additionally, genotypes of the patients identified mirror the CF population genotypes, reflecting similar disease severity in the screened population. Finally, infants with persistent hypertrypsinogenemia and borderline sweat test results need long-term follow-up.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
86 The pancreatic sufficient mutations identified were 18981 5G>T, 278915G>A, A455E, G551S, G85E, I336K, P67L, R117C, R117H, R334W, R347P. Login to comment

[hide] Serum zinc concentrations in cystic fibrosis patie... Biol Trace Elem Res. 2007 Oct;119(1):19-26. Van Biervliet S, Van Biervliet JP, Vande Velde S, Robberecht E
Serum zinc concentrations in cystic fibrosis patients aged above 4 years: a cross-sectional evaluation.
Biol Trace Elem Res. 2007 Oct;119(1):19-26., [PMID:17914215]

Abstract [show]
AIM: Assess the risk of zinc (Zn) deficiency in the older cystic fibrosis (CF) population. METHOD: Cross-sectional investigation of all CF patients above the age of 4 followed at the Ghent University center between 2002 and 2003. Data on age, weight, height z-score, pancreatic and pulmonary functions, chronic Pseudomonas infection, and CF transmembrane conductance regulator (CFTR) mutations were collected. Serum Zn, vitamins (vit) A and E, retinol-binding protein (RBP), albumin, sedimentation rate, total IgG, and cholesterol were determined. Serum Zn was compared with a local healthy control group (Van Biervliet et al., Biol Trace Elem Res 94:33-40, 2003) and with literature data (Hotz C, et al. Am J Clin Nutr 78:756-764, 2003). RESULTS: 101 patients (median age 16 years) were included. There was no difference in serum Zn concentration between CF patients and controls. In CF patients no difference in serum Zn concentration between pancreatic-sufficient or pancreatic-insufficient patients was seen. Serum Zn was not associated to nutritional status or height z-score. A significant association serum Zn to serum albumin (p < 0.0005) and to vit A (p < 0.01) was seen. No associations of serum Zn to serum vit E, RBP, cholesterol, or CFTR were present, but there is a significant association serum Zn to forced vital capacity (p < 0.01). Serum Zn was not associated to inflammatory parameters or chronic Pseudomonas infection. CONCLUSION: Comparison of CF patients with local controls revealed no significant differences. However, because persisting steatorrhea increases Zn loss (Easley et al., J Pediatr Gastroenterol Nutr 26:136-139, 1998) and 12.6% of our population has a serum Zn below the p value of 2.5 of the NHANES II study (Hotz C, et al. Am J Clin Nutr 78:756-764, 2003), there could remain an increased risk of Zn deficiency in some CF patients. Furthermore, the association with pulmonary function needs more investigation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
73 Table 1 Genotype of the 101 CF Patients: Details of the CF Mutations and Classification into Two Groups Genotype Groups Genotype No of Patients A ΔF508/ΔF508 47 ΔF508/E60X 1 ΔF508/G542X 7 ΔF508/N1303K 3 ΔF508/Q493X 1 ΔF508/1717-1G→A 1 ΔF508/Y1092X 1 ΔF508/394delTT 1 ΔF508/R785X 1 ΔF508/R553X 1 ΔF508/ΔI507 1 394delTT/394delTT 1 N1303K/N1303K 2 B ΔF508/3849+10kbC-T 1 ΔF508/306ΔTAGA 1 ΔF508/S1251N 8 ΔF508/L927P 1 G458V/1717-1G→A 1 ΔF508/I336K 2 G542X/622-2 A→C 1 ΔF508/G970R 3 ΔF508/3272-26A→G 2 ΔF508/R117H 2 ΔF508/2789+5G→A 2 1717-1G->A/S1251N 1 G542X/G970R 1 394delTT/Y913C 1 N1303K/deletion exon 19 1 Unidentified/unidentified 2 3600+2insTA/2005 del T 1 ΔF508/1898+1G→A 1 Deletion exon 2/del exon 2 1 There was no difference according to gender or age. Login to comment

[hide] Phenotypic characterisation of patients with inter... Thorax. 2009 Aug;64(8):683-91. Epub 2009 Mar 23. Goubau C, Wilschanski M, Skalicka V, Lebecque P, Southern KW, Sermet I, Munck A, Derichs N, Middleton PG, Hjelte L, Padoan R, Vasar M, De Boeck K
Phenotypic characterisation of patients with intermediate sweat chloride values: towards validation of the European diagnostic algorithm for cystic fibrosis.
Thorax. 2009 Aug;64(8):683-91. Epub 2009 Mar 23., [PMID:19318346]

Abstract [show]
BACKGROUND: In patients with symptoms suggestive of cystic fibrosis (CF) and intermediate sweat chloride values (30-60 mmol/l), extensive CFTR gene mutation analysis and nasal potential difference (NPD) measurement are used as additional diagnostic tests and a positive result in either test provides evidence of CFTR dysfunction. To define the phenotype of such patients and confirm the validity of grouping them, patients with intermediate sweat chloride values in whom either additional CF diagnostic test was abnormal were compared with subjects in whom this was not the case and patients with classic CF. METHODS: The phenotypic features of four groups were compared: 59 patients with CFTR dysfunction, 46 with an intermediate sweat chloride concentration but no evidence of CFTR dysfunction (CF unlikely), 103 patients with CF and pancreatic sufficiency (CF-PS) and 62 with CF and pancreatic insufficiency (CF-PI). RESULTS: The CFTR dysfunction group had more lower respiratory tract infections (p = 0.01), more isolation of CF pathogens (p<0.001) and clubbing (p = 0.001) than the CF unlikely group, but less frequent respiratory tract infections with CF pathogens than the CF-PS group (p = 0.05). Patients in the CF-PS group had a milder phenotype than those with PI. Many features showed stepwise changes through the patient groups. CONCLUSION: Patients with intermediate sweat chloride values and two CFTR mutations or an abnormal NPD measurement have a CF-like phenotype compatible with CFTR dysfunction and, as a group, differ phenotypically from patients with intermediate sweat chloride values in whom further CF diagnostic tests are normal as well as from CF-PS and CF-PI patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
60 Table 2 CFTR mutations in the patient subgroups CF-PS CFTR dysfunction CF unlikely Genotype Subjects (n) Genotype Subjects (n) Genotype Subjects (n) F508del*/Not found 12 F508del*/3849+10 kb(C.T){ 11 Not found/Not found 39 Not found/Not found 10 F508del*/R117H{ 7 F508del*/Not found 4 F508del*/3849+10 kb(C.T){ 7 F508del*/Not found 7 IVS8-5T{/Not found 1 F508del*/R347P{ 5 Not found/Not found 5 S1235E/E528E 1 F508del*/R117H{ 4 F508del*/D1152H{ 4 No mutation analysis 1 F508del*/2789+5G.A{ 4 F508del*/IVS8-5T{ 4 Total 46 F508del*/S945L* 3 F508del*/S945L* 2 2789+5G.A{/Not found 3 W1282X*/IVS8-5T{ 2 F508del*/3272-26 A.G{ 2 F508del*/R1070W{ 1 F508del*/A455E{ 2 F508del*/L159S 1 F508del*/711+5G.A 2 F508del*/T1246I 1 F508del*/2789+5G.A 2 F508del*/L165S 1 G542X*/R334W{ 2 W1282X*/D1152H{ 1 F508del*/R334W{ 2 R1162X*/D1152H{ 1 R347P{/Not found 2 R347Hu/D1152H{ 1 F508del*/2116delCTAA 1 R553X*/R117H{ 1 F508del*/IVS8-5T{ 1 3659delC*/R117H{ 1 F508del*/D1152H{ 1 3849+10kb(C.T){/G551R 1 F508del*/711+3A.G 1 R1162X*/3849+10 kb(C.T){ 1 F508del*/L206W{ 1 2789+5G.A{/Not found 1 F508del*/I336K{ 1 G542X*/T854A 1 F508del*/G970D 1 R553X*/Q1463H 1 F508del*/L159S 1 S1235R/R668C 1 F508del*/R751L 1 2789+5G.A{/S977F 1 F508del*/E656X 1 No mutation analysis 1 F508del*/4015delA 1 Total 59 F508del*/Y913S 1 F508del*/L165S 1 F508del*/2143delT 1 G551D*/I336K{ 1 G551D*/3272-26A.G{ 1 G551D*/711+3A.G 1 R553X*/4005+2T.C 1 R553X*/E92K{ 1 G542X*/L206W{ 1 W1282X*/I336K 1 R1162X*/3849+10 kb(C.T){ 1 R1162X*/2789+5G.A{ 1 574delA*/3141del9 1 9890X/I105N 1 R334W{/R1070Q{ 1 3272-26A.G{/4218insT 1 3272-26A.G{/L165S 1 711+3A.G/G1244E 1 R352Q/1812-1G.A 1 F1052V/IVS8-5T{ 1 R74W/D1270N 1 1898-3G.A/1898-3G.A 1 1717-1G.A*/R334W{ 1 3659delC*/Not found 1 394delTT/Not found 1 R1162X*/Not found 1 R553X*/Not found 1 R117H{/Not found 1 G85E*/Not found 1 3849+10k(C.T){/Not found 1 Total 103 *Mutation class I, II or III. Login to comment

[hide] Geosmithia argillacea: an emerging pathogen in pat... J Clin Microbiol. 2010 Jul;48(7):2381-6. Epub 2010 May 12. Giraud S, Pihet M, Razafimandimby B, Carrere J, Degand N, Mely L, Favennec L, Dannaoui E, Bouchara JP, Calenda A
Geosmithia argillacea: an emerging pathogen in patients with cystic fibrosis.
J Clin Microbiol. 2010 Jul;48(7):2381-6. Epub 2010 May 12., [PMID:20463155]

Abstract [show]
We report eight cases of airway colonization by Geosmithia argillacea in patients with cystic fibrosis. This filamentous fungus, resembling members of the genera Penicillium and Paecilomyces, was identified by molecular analysis. All patients carried a mutation on each CFTR (cystic fibrosis transmembrane conductance regulator) allele, with at least one copy of the F508del mutation. The first isolation of this fungus occurred from F508del-homozygous patients at a younger age than in F508del-heterozygous patients. Before recovery of G. argillacea, all patients were treated with itraconazole; two of them had also received voriconazole for an Aspergillus fumigatus infection. However, antifungal susceptibility patterns showed high MICs of voriconazole for all isolates, and high MICs of amphotericin B and itraconazole for the majority of them, but mostly low minimum effective concentrations (MECs) of caspofungin. The appearance and persistence of G. argillacea in the airways were not associated with exacerbation of the disease. However, the clinical implications of G. argillacea, particularly in immunocompromised patients, remain a concern, particularly given recent observations suggesting that this fungus may also cause disseminated infections.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
108 Clinical characteristics of CF patients colonized by Geosmithia argillacea Patient Hospital location Sexa Age (yr) at CF diagnosis Relevant CFTR mutation Age (yr) at first isolation of Geosmithia argillacea A Angers F 14 F508del/C.622-248-4del20pb 23 B Angers M Birth F508del/F508del 8 C Giens F 2 F508del/F508del 7 D Giens M Birth F508del/F508del 6 E Giens M 20 F508del/E92K 36 F Giens M 4 F508del/F508del 17 G Rouen F Birth F508del/F508del 13 H Rouen F 14 F508del/I336K 48 Ib Giens M Birth F508del/F508del 12 a F, female; M, male. Login to comment

[hide] Membrane-integration characteristics of two ABC tr... J Mol Biol. 2009 Apr 17;387(5):1153-64. Epub 2009 Feb 21. Enquist K, Fransson M, Boekel C, Bengtsson I, Geiger K, Lang L, Pettersson A, Johansson S, von Heijne G, Nilsson I
Membrane-integration characteristics of two ABC transporters, CFTR and P-glycoprotein.
J Mol Biol. 2009 Apr 17;387(5):1153-64. Epub 2009 Feb 21., [PMID:19236881]

Abstract [show]
To what extent do corresponding transmembrane helices in related integral membrane proteins have different membrane-insertion characteristics? Here, we compare, side-by-side, the membrane insertion characteristics of the 12 transmembrane helices in the adenosine triphosphate-binding cassette (ABC) transporters, P-glycoprotein (P-gp) and the cystic fibrosis transmembrane conductance regulator (CFTR). Our results show that 10 of the 12 CFTR transmembrane segments can insert independently into the ER membrane. In contrast, only three of the P-gp transmembrane segments are independently stable in the membrane, while the majority depend on the presence of neighboring loops and/or transmembrane segments for efficient insertion. Membrane-insertion characteristics can thus vary widely between related proteins.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
113 For CFTR, we chose mutations located in TM1CFTR (F87L, G91R), TM3CFTR (P205S, L206W), TM4CFTR (C225R), TM5CFTR (DF311, G314E), TM6CFTR (R334L/W, I336K/R/D, I340N/S, L346P, R347L/H), TM8CFTR (S909I, S912L), TM9CFTR (I1005R, A1006E), TM10CFTR (Y1032N), and TM12CFTR (M1137R, ΔM1140, M1140K), or close to the TM region of TM1CFTR (R74W, L102R/P), TMF2CFTR (R117P/L, L137P), and TM11CFTR (M1101K/R). Login to comment
115 As seen in Supplementary Data Table S2, only a few of the tested mutations in the 19 residue long CFTR TM segments alter the insertion efficiency significantly: TM4CFTR (C225R) (decrease from 88% to 34%), TM6CFTR (I336K/R/D) (decrease from 55% to 34%, 36% and 35%, respectively), TM6CFTR (I340N/S) (decrease from 55% to 32% and 35%, respectively), TM6CFTR (L346P) (decrease from 55% to 14%,), and TM12CFTR (ΔM1140) (decrease from 34% to 7%). Login to comment
116 One mutation, TM6CFTR (R334L), increased the insertion efficiency from 55% to 85%, as expected for a charged-to-hydrophobic replacement. Login to comment
120 Mutations TM6VCFTR (I336K), TM6VCFTR (I340N), and TM6VCFTR (L346P) still caused a large decrease in membrane insertion (from 81% to 39%, 35% and 14%, respectively). Login to comment
121 Addition of flanking segments did not rescue the insertion of TMF6CFTR (I336K) or TMF6CFTR (L346P) (decrease from 87% to 52% and 21%, respectively), nor did the addition of TMF5CFTR and the intervening loop to TMF6CFTR (L346P) (decrease from 86% to 36%). Login to comment
133 In particular, neither TM1P-gp nor TM2P-gp have been found capable of independent integration into the lipid bilayer.37 Also, TM3P-gp has been found not to be able to re-initiate translocation.36,40 Both TM3CFTR and TM4CFTR have been found to exhibit weak signal-anchor activities, and the translocation of the second extra cellular loop of the protein was found to be efficient when both segments were present.34-36 Interestingly, very recent results show that the poorly inserting TM8CFTR stays close to the translocon for an extended period of time before integrating fully into the membrane, and that this retention depends on an acidic residue, Asp924, located near the center of the TM segment.64 Three of the non-conservative mutations in CFTR and P-gp that we have studied strongly reduce the insertion of a transmembrane helix even when flanking residues are included: TMF6CFTR (I336K), TMF6CFTR (L346P), and TMF1P-gp (L70P). Login to comment
109 For CFTR, we chose mutations located in TM1CFTR (F87L, G91R), TM3CFTR (P205S, L206W), TM4CFTR (C225R), TM5CFTR (DF311, G314E), TM6CFTR (R334L/W, I336K/R/D, I340N/S, L346P, R347L/H), TM8CFTR (S909I, S912L), TM9CFTR (I1005R, A1006E), TM10CFTR (Y1032N), and TM12CFTR (M1137R, ƊM1140, M1140K), or close to the TM region of TM1CFTR (R74W, L102R/P), TMF2CFTR (R117P/L, L137P), and TM11CFTR (M1101K/R). Login to comment
111 As seen in Supplementary Data Table S2, only a few of the tested mutations in the 19 residue long CFTR TM segments alter the insertion efficiency significantly: TM4CFTR (C225R) (decrease from 88% to 34%), TM6CFTR (I336K/R/D) (decrease from 55% to 34%, 36% and 35%, respectively), TM6CFTR (I340N/S) (decrease from 55% to 32% and 35%, respectively), TM6CFTR (L346P) (decrease from 55% to 14%,), and TM12CFTR (ƊM1140) (decrease from 34% to 7%). Login to comment
117 Addition of flanking segments did not rescue the insertion of TMF6CFTR (I336K) or TMF6CFTR (L346P) (decrease from 87% to 52% and 21%, respectively), nor did the addition of TMF5CFTR and the intervening loop to TMF6CFTR (L346P) (decrease from 86% to 36%). Login to comment
129 In particular, neither TM1P-gp nor TM2P-gp have been found capable of independent integration into the lipid bilayer.37 Also, TM3P-gp has been found not to be able to re-initiate translocation.36,40 Both TM3CFTR and TM4CFTR have been found to exhibit weak signal-anchor activities, and the translocation of the second extra cellular loop of the protein was found to be efficient when both segments were present.34-36 Interestingly, very recent results show that the poorly inserting TM8CFTR stays close to the translocon for an extended period of time before integrating fully into the membrane, and that this retention depends on an acidic residue, Asp924, located near the center of the TM segment.64 Three of the non-conservative mutations in CFTR and P-gp that we have studied strongly reduce the insertion of a transmembrane helix even when flanking residues are included: TMF6CFTR (I336K), TMF6CFTR (L346P), and TMF1P-gp (L70P). Login to comment

[hide] Prospective and parallel assessments of cystic fib... Eur J Pediatr. 2012 Aug;171(8):1223-9. Epub 2012 May 12. Krulisova V, Balascakova M, Skalicka V, Piskackova T, Holubova A, Paderova J, Krenkova P, Dvorakova L, Zemkova D, Kracmar P, Chovancova B, Vavrova V, Stambergova A, Votava F, Macek M Jr
Prospective and parallel assessments of cystic fibrosis newborn screening protocols in the Czech Republic: IRT/DNA/IRT versus IRT/PAP and IRT/PAP/DNA.
Eur J Pediatr. 2012 Aug;171(8):1223-9. Epub 2012 May 12., [PMID:22581207]

Abstract [show]
Cystic fibrosis (CF) is a life-threatening disease for which early diagnosis following newborn screening (NBS) improves the prognosis. We performed a prospective assessment of the immunoreactive trypsinogen (IRT)/DNA/IRT protocol currently in use nationwide, versus the IRT/pancreatitis-associated protein (PAP) and IRT/PAP/DNA CF NBS protocols. Dried blood spots (DBS) from 106,522 Czech newborns were examined for IRT concentrations. In the IRT/DNA/IRT protocol, DNA-testing was performed for IRT >/= 65 ng/mL. Newborns with IRT >/= 200 ng/mL and no detected cystic fibrosis transmembrane conductance regulator gene (CFTR) mutations were recalled for a repeat IRT. In the same group of newborns, for both parallel protocols, PAP was measured in DBS with IRT >/= 50 ng/mL. In PAP-positive newborns (i.e., >/=1.8 if IRT 50-99.9 or >/=1.0 if IRT >/= 100, all in ng/mL), DNA-testing followed as part of the IRT/PAP/DNA protocol. Newborns with at least one CFTR mutation in the IRT/DNA/IRT and IRT/PAP/DNA protocols; a positive PAP in IRT/PAP; or a high repeat IRT in IRT/DNA/IRT were referred for sweat testing. CONCLUSION: the combined results of the utilized protocols led to the detection of 21 CF patients, 19 of which were identified using the IRT/DNA/IRT protocol, 16 using IRT/PAP, and 15 using IRT/PAP/DNA. Decreased cut-offs for PAP within the IRT/PAP protocol would lead to higher sensitivity but would increase false positives. Within the IRT/PAP/DNA protocol, decreased PAP cut-offs would result in high sensitivity, an acceptable number of false positives, and would reduce the number of DNA analyses. Thus, we concluded that the IRT/PAP/DNA protocol would represent the most suitable protocol in our conditions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 According to the protocol, this result indicated the sequencing of the Table 1 Parallel comparison of CF NBS protocols IRT/DNAa /IRT IRT/PAP IRT/PAP/DNAa Newborns screened (N) 106,522 106,522 106,522 IRT positives (N; %) 1,158 (1.09) 3,155 (2.96) 3,155 (2.96) PAP positives (N; %) - 260 (0.24) 260 (0.24) Median age (range) at the availability of DNA-testinga results (days) 36 (9-222b ) - 36 (9-222b ) 1 and/or 2 CF mutations detected (N; %) 76 (0.07) - 27 (0.03) Recalled newborns for repeated IRT examination (N; %) 47 (0.04) - - Positive CF NBS (N; %) 123 (0.12) 260 (0.24) 27 (0.03) Positive IRT in newborns recalled for repeated examination (N) 1 - - ST indicated (N; %) 77 (0.07) 260 (0.24) 27 (0.03) ST carried out (N; % of indicated ST) 72c (93.51) 204c (78.46) 24c (88.89) CF carriers (N) 55 - 12 Prevalence of CF carriers 1 in 21 - 1 in 22 Diagnosed CF patients (N) 19 16 15 False positives based on performed ST (N; % of all cases screened) 99d (0.09) 188 (0.18) 9 (0.01) Newborns with equivocal diagnosis [F508del/R117H-IVS-8 T(7) and ST<30 mmol/L; N] 2 - 0 False negatives (N) 2 5 6 Total of CF patients detected (N) 21e Median age (range) at diagnosis (days) 36 (9-57)e CF prevalence 1 in 5,072e Sensitivity (TP/TP+FN) 0.9048 0.7619 0.7142 Specificity (TN/TN+FP) 0.9991 0.9982 0.9999 PPV (TP/TP+FP) 0.1610 0.0784 0.625 N number, % of all cases screened, TP true positives, FN false negatives, TN true negatives, FP false positives, PPV positive predictive value, ST sweat test a CF-causing mutations covered by Elucigene assays ("legacy" nomenclature) with the CF-EU1Tm accounting for: p.Arg347Pro (R347P), c.2657+ 5G>A (2789+5G>A), c.2988+1G>A (3120+1G>A), c.579+1G>T (711+1G>T), p.Arg334Trp (R334W), p.Ile507del (I507del), p.Phe508del (F508del), c.3718-2477C>T (3849+10kbC>T), p.Phe316LeufsX12 (1078delT), p.Trp1282X (W1282X), p.Arg560Thr (R560T), p.Arg553X (R553X), p.Gly551Asp (G551D), p.Met1101Lys (M1101K), p.Gly542X (G542X), p.Leu1258PhefsX7 (3905insT), p.Ser1251Asn (S1251N), c.1585-1G>A (1717-1G>A), p.Arg117His (R117H), p.Asn1303Lys (N1303K), p.Gly85Glu (G85E), c.1766+1G>A (1898+1G>A), p.Lys684AsnfsX38 (2184delA), p.Asp1152His (D1152H), c.54-5940_273+10250del (CFTRdele2,3), p.Pro67Leu (P67L), p.Glu60X (E60X), p.Lys1177SerfsX15 (3659delC), c.489+1G>T (621+1G>T), p.Ala455Glu (A455E), p.Arg1162X (R1162X), p.Leu671X (2143delT), c.1210-12T[n] (IVS8-T(n) variant), including additional mutations in the CF-EU2Tm : p.Gln890X (Q890X), p.Tyr515X (1677delTA), p.Val520Phe (V520F), c.3140-26A>G (3272-26A>G), p.Leu88IlefsX22 (394delTT), p.Arg1066Cys (R1066C), p.Ile105SerfsX2 (444delA), p.Tyr1092X (C>A) (Y1092X(C>A)), p.Arg117Cys (R117C), p.Ser549Asn (S549N), p.Ser549ArgT>G (S549R T>G), p.Tyr122X (Y122X), p.Arg1158X (R1158X), p.Leu206Trp (L206W), c.1680-886A>G (1811+1.6kbA>G), p.Arg347His (R347H), p.Val739TyrfsX16 (2347delG) and p.Trp846X (W846X) b failed DNA isolation from DBS, including repetition of DNA-testing c deceased patient or non-compliance with referrals (five CF carriers in IRT/DNA/IRT, 56 newborns in IRT/PAP, three CF carriers in IRT/PAP/DNA) d comprising newborns with repeated IRT (47 newborns) e aggregate data from all protocols entire CFTR coding region in both newborns, and led to the identification of p.Ile336Lys (I336K) and p.Glu1104Lys (E1104K) mutations. Login to comment

[hide] Pilot newborn screening project for cystic fibrosi... J Cyst Fibros. 2009 May;8(3):224-7. Epub 2009 Feb 8. Balascakova M, Holubova A, Skalicka V, Zemkova D, Kracmar P, Gonsorcikova L, Camajova J, Piskackova T, Lebl J, Drevinek P, Gregor V, Vavrova V, Votava F, Macek M Jr
Pilot newborn screening project for cystic fibrosis in the Czech Republic: defining role of the delay in its symptomatic diagnosis and influence of ultrasound-based prenatal diagnosis on the incidence of the disease.
J Cyst Fibros. 2009 May;8(3):224-7. Epub 2009 Feb 8., [PMID:19208501]

Abstract [show]
The objective need for cystic fibrosis (CF) newborn screening (NBS) in the Czech Republic has recently been substantiated by a significant delay of its symptomatic diagnosis. This trend most likely resulted from the process of decentralisation of health care which led to the deterioration of care for patients who need specialised approaches. Applied newborn screening model (IRT/DNA/IRT) was efficacious enough to detect CF cases with median age at diagnosis of 37 days. The incidence of CF (1 in 6946 live births) ascertained in this project was lower than that established previously by epidemiological studies (1 in 2700-1 in 3300). However, adjustment for broadly applied ultrasound-based prenatal diagnosis (PND) in the 2nd trimester of pregnancy, that was performed within the period of the project (1/2/2005-2/11/2006), rendered an incidence estimate of 1 in 4023. This value is closer to that observed in other CF NBS programmes and reflects influence of PND on the incidence of CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
60 Sweat chloride concentration was positive (75 mM/L) in one newborn with the p.F508del mutation, where subsequent direct sequencing detected the p. I336K mutation [13], absent in the extended panel. Login to comment
57 Sweat chloride concentration was positive (75 mM/L) in one newborn with the p.F508del mutation, where subsequent direct sequencing detected the p. I336K mutation [13], absent in the extended panel. Login to comment

[hide] Genotyping microarray for the detection of more th... J Mol Diagn. 2005 Aug;7(3):375-87. Schrijver I, Oitmaa E, Metspalu A, Gardner P
Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations.
J Mol Diagn. 2005 Aug;7(3):375-87., [PMID:16049310]

Abstract [show]
Cystic fibrosis (CF), which is due to mutations in the cystic fibrosis transmembrane conductance regulator gene, is a common life-shortening disease. Although CF occurs with the highest incidence in Caucasians, it also occurs in other ethnicities with variable frequency. Recent national guidelines suggest that all couples contemplating pregnancy should be informed of molecular screening for CF carrier status for purposes of genetic counseling. Commercially available CF carrier screening panels offer a limited panel of mutations, however, making them insufficiently sensitive for certain groups within an ethnically diverse population. This discrepancy is even more pronounced when such carrier screening panels are used for diagnostic purposes. By means of arrayed primer extension technology, we have designed a genotyping microarray with 204 probe sites for CF transmembrane conductance regulator gene mutation detection. The arrayed primer extension array, based on a platform technology for disease detection with multiple applications, is a robust, cost-effective, and easily modifiable assay suitable for CF carrier screening and disease detection.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS. Login to comment
73 Genomic DNA Samples Used for Mutation Evaluation on the APEX Array Mutations validated with native DNA CFTRdel 2,3 (21 kb) 394delTT G85E R75X 574delA Y122X R117C R117H 621 ϩ 1GϾT 621 ϩ 3AϾG 711 ϩ 1GϾT I336K R334W R347P IVS8-5T IVS8-7T IVS8-9T A455E ⌬F508 ⌬I507 1677delTA 1717 - 1GϾA G542X G551D R553X R560T S549N 1898 ϩ 1GϾA 1898 ϩ 1GϾC 2183AAϾG 2043delG R668C 2143delT 2184delA 2184insA 2789 ϩ 5GϾA S945L 3120 ϩ 1GϾA I1005R 3272 - 26AϾG R1066C G1069R Y1092X (CϾA) 3500 - 2AϾT R1158X R1162X 3659delC S1235R 3849 ϩ 10 kb CϾT W1282X primer. Login to comment

[hide] Spectrum of CFTR mutations in cystic fibrosis and ... Hum Mutat. 2000;16(2):143-56. Claustres M, Guittard C, Bozon D, Chevalier F, Verlingue C, Ferec C, Girodon E, Cazeneuve C, Bienvenu T, Lalau G, Dumur V, Feldmann D, Bieth E, Blayau M, Clavel C, Creveaux I, Malinge MC, Monnier N, Malzac P, Mittre H, Chomel JC, Bonnefont JP, Iron A, Chery M, Georges MD
Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France.
Hum Mutat. 2000;16(2):143-56., [PMID:10923036]

Abstract [show]
We have collated the results of cystic fibrosis (CF) mutation analysis conducted in 19 laboratories in France. We have analyzed 7, 420 CF alleles, demonstrating a total of 310 different mutations including 24 not reported previously, accounting for 93.56% of CF genes. The most common were F508del (67.18%; range 61-80), G542X (2.86%; range 1-6.7%), N1303K (2.10%; range 0.75-4.6%), and 1717-1G>A (1.31%; range 0-2.8%). Only 11 mutations had relative frequencies >0. 4%, 140 mutations were found on a small number of CF alleles (from 29 to two), and 154 were unique. These data show a clear geographical and/or ethnic variation in the distribution of the most common CF mutations. This spectrum of CF mutations, the largest ever reported in one country, has generated 481 different genotypes. We also investigated a cohort of 800 French men with congenital bilateral absence of the vas deferens (CBAVD) and identified a total of 137 different CFTR mutations. Screening for the most common CF defects in addition to assessment for IVS8-5T allowed us to detect two mutations in 47.63% and one in 24.63% of CBAVD patients. In a subset of 327 CBAVD men who were more extensively investigated through the scanning of coding/flanking sequences, 516 of 654 (78. 90%) alleles were identified, with 15.90% and 70.95% of patients carrying one or two mutations, respectively, and only 13.15% without any detectable CFTR abnormality. The distribution of genotypes, classified according to the expected effect of their mutations on CFTR protein, clearly differed between both populations. CF patients had two severe mutations (87.77%) or one severe and one mild/variable mutation (11.33%), whereas CBAVD men had either a severe and a mild/variable (87.89%) or two mild/variable (11.57%) mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
107 f 306insA, W79X, R117C, P205S, L227R, I336K, 1248+1G>A, 1609delCA, 1717-8G>A, S549R(T>G), S549N, 1812-1G>A, P574H, 2176insC, R709X, E827X, D836Y, 3007delG, L1065P, L1077P, H1085R, M1101K, 4021insT. Login to comment

[hide] Novel and characteristic CFTR mutations in Saudi A... J Med Genet. 1997 Dec;34(12):996-9. el-Harith EA, Dork T, Stuhrmann M, Abu-Srair H, al-Shahri A, Keller KM, Lentze MJ, Schmidtke J
Novel and characteristic CFTR mutations in Saudi Arab children with severe cystic fibrosis.
J Med Genet. 1997 Dec;34(12):996-9., [PMID:9429141]

Abstract [show]
More than 600 different CFTR (cystic fibrosis transmembrane conductance regulator) gene mutations have been identified so far that are considered to cause the fatal genetic disorder cystic fibrosis (CF). We have investigated 15 Arab children from 12 families, who were diagnosed as having CF, for mutations in the coding region and in the flanking intron sequences of the CFTR gene. Six different CFTR mutations were identified including two novel mutations, 1548delG in exon 10 and 406-2A-->G in intron 3. Prominent mutations were the splice mutation 3120 + 1G-->A (intron 16) followed by N1303K (exon 21) and 1548delG (exon 10). Most CF children were homozygotes who presented with a severe form of the disease including failure to thrive, recurrent chest infections, particularly with Pseudomonas aeruginosa, and frequent hospital admissions. Identification of the CFTR mutations facilitates molecular investigation of the disease and better understanding of its pathophysiology in Arab children, among whom CF is probably an underdiagnosed disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 Deletions of two or more base pairs were screened for by electrophoresis using a native 12% polyacrylamide gel. The 20 common CFTR mutations that were screened for were AF508, AI507, 1677delTA, R347P, R347H, R553X, G551D, G542X, N1303K, 3849+1OKbC-8'T, R334W, I336K, 2789+5G-A, 1717-1G-A, 3272- 26A- G, Y1092X, 2143delT, W1282X, RI 17H, and the 5T allele. Login to comment

[hide] Distinct spectrum of CFTR gene mutations in congen... Hum Genet. 1997 Sep;100(3-4):365-77. Dork T, Dworniczak B, Aulehla-Scholz C, Wieczorek D, Bohm I, Mayerova A, Seydewitz HH, Nieschlag E, Meschede D, Horst J, Pander HJ, Sperling H, Ratjen F, Passarge E, Schmidtke J, Stuhrmann M
Distinct spectrum of CFTR gene mutations in congenital absence of vas deferens.
Hum Genet. 1997 Sep;100(3-4):365-77., [PMID:9272157]

Abstract [show]
Congenital absence of the vas deferens (CAVD) is a frequent cause for obstructive azoospermia and accounts for 1%-2% of male infertility. A high incidence of mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene has recently been reported in males with CAVD. We have investigated a cohort of 106 German patients with congenital bilateral or unilateral absence of the vas deferens for mutations in the coding region, flanking intron regions and promotor sequences of the CFTR gene. Of the CAVD patients, 75% carried CFTR mutations or disease-associated CFTR variants, such as the "5T" allele, on both chromosomes. The distribution of mutation genotypes clearly differed from that observed in cystic fibrosis. None of the CAVD patients was homozygous for delta F508 and none was compound heterozygous for delta F508 and a nonsense or frameshift mutation. Instead, homozygosity was found for a few mild missense or splicing mutations, and the majority of CAVD mutations were missense substitutions. Twenty-one German CAVD patients were compound heterozygous for delta F508 and R117H, which was the most frequent CAVD genotype in our study group. Haplotype analysis indicated a common origin for R117H in our population, whereas another frequent CAVD mutation, viz. the "5T allele" was a recurrent mutation on different intragenic haplotypes and multiple ethnic backgrounds. We identified a total of 46 different mutations and variants, of which 15 mutations have not previously been reported. Thirteen novel missense mutations and one unique amino-acid insertion may be confined to the CAVD phenotype. A few splice or missense variants, such as F508C or 1716 G-->A, are proposed here as possible candidate CAVD mutations with an apparently reduced penetrance. Clinical examination of patients with CFTR mutations on both chromosomes revealed elevated sweat chloride concentrations and discrete symptoms of respiratory disease in a subset of patients. Thus, our collaborative study shows that CAVD without renal malformation is a primary genital form of cystic fibrosis in the vast majority of German patients and links the particular expression of clinical symptoms in CAVD with a distinct subset of CFTR mutation genotypes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
43 This initial screening included the mutations ∆F508, G542X, R553X, G551D, N1303K, 1717-1 G→A, 3272-26 A→G, Y1092X, 2143delT, R347P, R347H, R334W, I336K, R117H, R117C, 2789+5 G→A, 3849+10kB C→T and the "5T" allele, the latter two splice variants being tested according to the instructions of Highsmith et al. (1994) and Chillón et al. (1995). Login to comment
83 The German CBAVD patient in our study was compound heterozygous for R334L and for the missense mutation I336K in the same exon. Login to comment
86 The V938G substitution was identified in two unrelated patients, one homozygote with unilateral ab- 368 Table 1A Frequency distribution and haplotypes of CFTR mutations in 106 CAVD patients Mutationa Nucleotide changesb Locationc Frequencyd Haplotypee Referencef 174delA deletion of A at 174 exon 1 1 D3 This study E56K G→A at 298 exon 3 1 B3 This study D58N G→A at 304 exon 3 1 C2 This study D110H G→A at 460 exon 4 2 C2 Dean et al. (1990) R117H G→A at 482 exon 4 24 B6 Dean et al. (1990) A120T G→A at 490 exon 4 1 n.p. Chillón et al. (1994) ̃L138 insertion of CTA after 546 exon 4 1 A2 This study L206W T→G at 749 exon 6a 1 B8 Claustres et al. (1993) M265R T→G at 926 exon 6b 1 A2 Schwarz et al. (pers. comm.) R297W C→T at 1021 exon 7 1 C2 This study 1078delT deletion of T at 1078 exon 7 1 C2 Claustres et al. (1992) R334W C→T at 1132 exon 7 1 B1 Gasparini et al. (1991) R334L G→T at 1133 exon 7 1 D3 This study I336K T→A at 1139 exon 7 1 A2 Cuppens et al. (1993) R347H G→A at 1172 exon 7 3 D1 Cremonesi et al. (1992) L375F A→C at 1257 exon 8 1 B3 Jézéquel et al. (1996) ∆F508 deletion of 3 bp between 1652-1655 exon 10 57 B1 Kerem et al. (1989) G542X G→T at 1756 exon 11 2 B1 Kerem et al. (1990) R553X C→T at 1789 exon 11 1 A4 Cutting et al. (1990) L568F G→T at 1836 exon 12 1 B3 This study 2184insA insertion of A at 2184 exon 13 1 D3 Dörk et al. (1994b) 2789+5 G→A G→A at 2789+5 intron 14b 4 D3 Highsmith et al. (1997) R933S A→T at 2931 exon 15 1 n.p. Login to comment
137 Complex alleles are indicated a One CF allele with R75X and 125G→C b One CBAVD allele with R75Q and R933S c One CBAVD allele with 5T and Q1352H d Two CF alleles with F508C and S1251N e One CF allele with 1716G→A and L619S f G576A and R668C were linked on two CBAVD and three CF alleles, whereas two additional CF alleles carried R668C together with the 3849+10kB C→T mutation (Dörk and Stuhrmann 1995) 371 Table 3 CFTR mutation genotypes in 106 males with CAVD Genotype PolyT Frequency Ethnic descent Diagnosis ∆F508/R117H 9/7 21 German, Austrian 20 CBAVD, 1 CUAVD ∆F508/5T 9/5 9 German, Austrian 8 CBAVD, 1 CUAVD ∆F508/F508C 9/7 3 German CBAVD ∆F508/R347H 9/9 2 German CBAVD ∆F508/1716 G→A 9/7 2 German CBAVD ∆F508/3272-26 A→G 9/7 2 German CBAVD ∆F508/E56K 9/7 1 German CBAVD ∆F508/M265R 9/7 1 German-Portuguese CBAVD ∆F508/R334W 9/9 1 German CBAVD ∆F508/T351S 9/9 1 German CBAVD ∆F508/L375F 9/7 1 Volga German CBAVD ∆F508/G576A & R668C 9/7 1 German CBAVD ∆F508/R933S 9/7 1 German CBAVD ∆F508/L997F 9/9 1 German CBAVD ∆F508/Y1032C 9/7 1 German CBAVD ∆F508/D1152H 9/7 1 German CBAVD ∆F508/K1351E 9/7 1 German CBAVD ∆F508/D1377H 9/7 1 Portuguese CBAVD ∆F508/L1388Q 9/7 1 German CBAVD ∆F508/unknown 9/7 4 German 3 CBAVD, 1 CUAVD 5T/5T 5/5 2 German CBAVD 5T/G542X 5/9 2 German, Turkish CBAVD 5T/D58N 5/7 1 Lebanese CBAVD 5T/̃L138 5/7 1 German-Polish CBAVD 5T/1078delT 5/7 1 German CBAVD 5T/R553X 5/7 1 German CBAVD 5T/2184insA 5/7 1 Turkish CBAVD 5T/D979A 5/7 1 Vietnamese CBAVD 5T/D1152H 5/7 1 Turkish CBAVD 5T/3659delC 5/7 1 German CBAVD 5T/S1235R 5/7 1 Greek CBAVD 5T/W1282X 5/7 1 German CBAVD 5T & Q1352H/ R297W & Q1352H 5/7 1 Vietnamese CBAVD 5T/unknown 5/7 1 German CBAVD R117H/L206W 7/9 1 German CBAVD R117H/2789+5 G→A 7/7 1 German CBAVD R117H/unknown 7/7 1 German CBAVD 2789+5 G→A/2789+5 G→A 7/7 1 Lebanese CBAVD 2789+5 G→A/L973F 7/7 1 German CBAVD V938G/V938G 7/7 1 Greek CBAVD V938G/174delA 7/7 1 German CBAVD D110H/D110H 7/7 1 Turkish CBAVD R334L/I336K 7/7 1 German CBAVD R347H/N1303K 9/9 1 German CBAVD L568F/D1152H 7/7 1 Turkish CBAVD 3272-26 A→G/V1153E 7/7 1 German CBAVD R75Q/unknown 7/7 1 German CBAVD A120T/unknown 9/7 1 German CBAVD 1716G→A/unknown 7/7 1 German CBAVD G576A & R668C/unknown 7/7 1 German CBAVD 2752-15 C→G/unknown 7/7 1 Iranian CBAVD Unknown/unknown 17 German, Turkish 7 CBAVD and 1 CUAVD without observed renal agenesis, 9 CBAVD with renal agenesis allele and the R297W mutation on a homozygous Q1352H background may then reduce CFTR function to a disease-causing level. Login to comment
145 Maldigestion 13 25 5T/D58N 184 99 55 - 14 34 5T/̃L138 177 80 53 - 15 33 5T/1078delT 187 87 56 Recurrent bronchitis 16 31 5T/G542X 181 85 79 - 17 31 5T/2184insA n.d. n.d. 60 Borderline pancreatic sufficiency 18 31 5T/D979A n.d. n.d. 55 Recurrent infections, FEVI 76% 19 29 5T/D1152H n.d. n.d. 57 - 20 32 5T/W1282X 180 76 n.d. Recurrent infections, nasal polyposis 21 37 5T/unknown 180 74 n.d. Nasal polyposis 22 28 D110H/D110H 175 80 n.d Asthma bronchiale, obstipation 23 33 R334L/I336K 170 65 n.d. Recurrent infections, nasal polyposis, maldigestion, salt depletion episodes 24 35 N1303K/R347H 167 77 93 - 25 30 V938G/174delA n.d. n.d. 42 - 26 29 V938G/V938G 197 115 n.d. Asthma bronchiale Fig.2 Spectrum of CFTR mutation genotypes in CF patients (left) and in patients with congenital absence of the vas deferens (right). Login to comment

[hide] Genotype-phenotype relationships in a cohort of ad... Eur Respir J. 1996 Nov;9(11):2207-14. Hubert D, Bienvenu T, Desmazes-Dufeu N, Fajac I, Lacronique J, Matran R, Kaplan JC, Dusser DJ
Genotype-phenotype relationships in a cohort of adult cystic fibrosis patients.
Eur Respir J. 1996 Nov;9(11):2207-14., [PMID:8947061]

Abstract [show]
In cystic fibrosis (CF), relationships between genotype and phenotype have been shown for pancreatic status but not for pulmonary disease. One hundred and ten adult CF patients were classified according to the expected effect of their mutations on cystic fibrosis transmembrane conductance regulator (CFTR) protein: Group 1 (n=48) included deltaF508 homozygotes; Group 2 (n=26), patients with two "severe" mutations and no expected CFTR production; Group 3 (n=17), patients with expected partly functional CFTR corresponding to at least one "mild" mutation; Group 4 (n=19), patients with no mutation identified or only one identified "severe" mutation. As compared to Groups 1 and 2: patients from Groups 3 and 4 had higher arterial oxygen tension (Pa,O2) (9.5+/-1.9 and 9.9+/-1.5 vs 8.8+/-1.5 and 8.3+/-1.7 kPa, respectively p<0.02); and a slower decline in their pulmonary function, estimated by the mean annual loss in forced vital capacity (FVC) (1.2+/-1.0 and 1.5+/-1.1 vs 2.0+/-0.9 and 2.2+/-1.0%, respectively; p<0.01) and in forced expiratory volume in one second (FEV1) (1.7+/-1.1 and 1.9+/-1.3 vs 2.6+/-1.0 and 2.8+/-1.0%, respectively; p<0.005). They had fewer episodes of colonization of the airways by Pseudomonas aeruginosa, and colonization occurred at a more advanced age (median age 25 and 19 vs 15 and 17 yrs, respectively; p<0.01) and required fewer intravenous antibiotic courses (p<0.01). Pancreatic insufficiency was less frequent in Groups 3 (23%) and 4 (63%) than in Groups 1 (100%) and 2 (96%). This study suggests that the phenotype of adult cystic fibrosis patients, including the severity of the lung disease, is related to the severity of the cystic fibrosis transmembrane conductance regulator mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
77 - Genotype of the 110 CF patients: details of the CF mutations and classification into four groups Genotype Genotype Pts groups n 1 ∆F508/∆F508 48* 2 ∆F508/G542X 6 ∆F508/E827X 3† ∆F508/R553X 2 ∆F508/W1282X 2 ∆F508/E595X 1 ∆F508/E60X 1 ∆F508/W846X 1 ∆F508/1078delT 1 ∆F508/2143delT 1 ∆F508/2347delG 1 ∆F508/3659delC 1 ∆F508/4382delA 1 ∆F508/2183 AA→G 1 ∆F508/1717-1 G→A 1 ∆F508/1811+1.6 kb A→G 1 E595X/Y1092X 1 1717-1 G→A/1078delT 1 3 ∆F508/I336K 1 ∆F508/G27E 1 ∆F508/D192N 1 ∆F508//I980K 1 ∆F508/P205S 1 ∆F508/2789+5 G→A 1 ∆F508/3272-26 A→G 1 G542X/3849+10 kb C→T 2‡ G542X/2789+5 G→A 1 W361R/297-3 C→T 1 G551D/1717-1 G→A 1 N1303H/2183 AA→G 1 2789+5 G→A/2183 AA→G 1 R1070Q/D1152H 1 R1070Q/unidentified 1 S1251N/unidentified 1 4 ∆F508/unidentified 7 ∆I507/unidentified 2 1811+1.6 kb A→G/unidentified 1 1161delC/unidentified 1 unidentified/unidentified 8 *: two patients are brothers; †: three brothers; ‡: two sisters. Login to comment

[hide] Haplotype analysis of 94 cystic fibrosis mutations... Hum Mutat. 1996;8(2):149-59. Morral N, Dork T, Llevadot R, Dziadek V, Mercier B, Ferec C, Costes B, Girodon E, Zielenski J, Tsui LC, Tummler B, Estivill X
Haplotype analysis of 94 cystic fibrosis mutations with seven polymorphic CFTR DNA markers.
Hum Mutat. 1996;8(2):149-59., [PMID:8844213]

Abstract [show]
We have analyzed 416 normal and 467 chromosomes carrying 94 different cystic fibrosis (CF) mutations with polymorphic genetic markers J44, IVS6aGATT, IVS8CA, T854, IVS17BTA, IVS17BCA, and TUB20. The number of mutations found with each haplotype is proportional to its frequency among normal chromosomes, suggesting that there is no preferential haplotype in which mutations arise and thus excluding possible selection for specific haplotypes. While many common mutations in the worldwide CF population showed absence of haplotype variation, indicating their recent origins, some mutations were associated with more than one haplotype. The most common CF mutations, delta F508, G542X, and N1303K, showed the highest number of slippage events at microsatellites, suggesting that they are the most ancient CF mutations. Recurrence was probably the case for 9 CF mutations (R117H, H199Y, R347YH, R347P, L558S, 2184insA, 3272-26A-->G, R1162X, and 3849 + 10kbC-->T). This analysis of 94 CF mutations should facilitate mutation screening and provides useful data for studies on population genetics of CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
99 Mutations AF508, AI507, and I336K were found associated with haplotypes that should be the result of recombinations (Table 5). Login to comment
105 CFTR Haplotypes for Diallelic and Multiallelic DNA Markers for 94 CF Mutations" J44-GATT- 8CA-17BTA- No. of T854-TUB20 17BCA Mutation chromosomes % Normal Laboratory Reference 2-7-1-2 17-47-13 (55.4%) 17-46-13 17-45-13 17-34-13 17-32-13 17-31-14 17-31-13 17-29-14 17-28-13 16-48-13 16-46-14 16-46-13 16-45-13 16-44-13 16-35-13 16-33-13 16-32-13 16-31-14 16-31-13 16-30-13 16-29-13 16-26-13 16-25-13 16-24-13 14-31-13 1-7-2-1 17-7-17 (16.8%) R334W R334W 3860ins31 G1244E R1162X R1162X R1162X G91R MllOlK R347P R334W R117C E92K 3849+lOkbC+T 3293delA 1811+1.6kb A-tG 1811+1.6kb A-tG 2184insA P205S 3659delC G673X 11005R I336K W58S R347P W846X 405+1-A G178R 3905insT R1162X R347H 3100insA E60X 1078delT 4005+1-A K710X 1677delTA H199Y 3601-2AjG 3850-3T+G 3272-26A-tG 3850-1-A 1812-1-A R117H L1059X S492F Y1092X Y569H 3732delA C866Y 711+1G+T 711+1-T G85E 1949del84 2789+5-A H1085R W1282X R1066C 2043delG V456F 2 1 1 1 2 1 6 2 2 1 2 1 1 2 1 1 4 1 1 1 3 2 1 1 1 1 1 1 2 7 1 1 1 1 2 1 1 3 19 3 3 1 1 2 1 1 5 1 1 1 1 3 6 3 5 1 13 2 1 1 - 0.48 0.48 - - - 0.24 - - - 2.65 2.40 1.93 2.65 1.68 2.65 0.72 13.94 13.46 1.93 - 0.72 0.24 3.37 - b b fP fP fP t b,fb.fP h fb t h t h h fP fP b.h b h h b h h h h h fb fb,fP.t fP fP fP9t fP b t fPh b h fb b.fb,h fb*fP b,fP h h t h fb fb,fp,h.t fP fP fb t b.fP,t b,fb,h,t b f b h h fb b,fb.fP,h fP h h Gasparini et al. (1991b) Chilldn et al. (1993a) Devoto et al. (1991) Gasparini et al. (1991b) Dork et al. (1993a) Guillermit et al. (1993) Zielenski et al. (1993) Dean et al. (1990) Dork et al. (1994a) Nunes et al. (1993) Highsmith et al. (1994) Ghanem et al. (1994) Chilldn et al. (1995) Dork et al. (1994a) Dork et al. (1993a) Chilldn et al. (1993b) Kerem et al. (1990) Dork et al. (1994a) Dork et al. (1994a) Cuppenset al. (1993) Fanen et al. (1992) Maggio et al. (personal communication) Audrezet et al. (1993) Vidaud et al. (1990) Dork et al. (1993b) Zielenski et al. (1991a) Chilldn et al. (1994b) Malik et al. (personal communication) Cremonesi et at. Login to comment
106 (1992) Dork et al. (1994a) Malone et al. (personal communication) Claustreset al. (1992) Ferec et al. (1992) Fanen et al. (1992) lvaschenko et al. (1991) T. Dork (personal communication) Dean et al. (1990) Dork et al. (1994a) Ferec et al. (1992) Bozon et al. (1994) Costes et al. (personal communication) Fanen et al. (1992) Audrezet et al. (personal communication) Zielenski et al. (1991a) Zielenski et al. (1991a) Granell et al. (1992) Highsmith et al. (1990) Mercier et al. (1993b) Vidaud et al. (1990) Fanen et al. (1992) Fanen et al. (1992) Dork et al. (1994b) (continued) HAPLOTYPESFOR 94 CF MUTATIONS TABLE2. CFTR HaplotvpesforDiallelic and Multiallelic DNA Markers for 94 CF Mutations"(Continued) ~~ ~ J44-GAIT- 8CA-17BTA- No. of TSU-TUB20 17BCA Mutation chromosomes % Normal Laboratory Reference 1-6-1-2 (9.1%) 1-6-2-2 (8.9%) 1-7-1-2 (3.4%) 1-7-2-2 (2.6%) 2-7-1-1 (1.2%) 2-7-2-2 (0.7%) 17-7-16 16-7-18 16-7-17 15-7-17 24-31-13 23-52-13 23-34-13 23-33-14 23-33-13 23-32-13 23-31-13 23-30-13 23-21-19 23-18-13 22-35-13 22-31-13 22-30-13 21-31-13 19-33-13 18-45-13 18-37-13 18-35-13 17-57-11 17-55-13 17-55-11 17-54-11 17-53-11 17-52-11 17-51-11 17-33-13 16-46-13 16-45-13 16-44-13 16-42-13 16-35-13 16-30-13 16-30-13 16-7-17 16-21-19 L107% L1077P 24ldelAT L719X A1507 3849+10kbC-T 2184insA 2991de132 G551D 1154insTC V520F R560T 4114ATA+lT 3667de14 435insA Q414X C225R Q39X N1303K R1162X H199Y G542X G542X w1204x R347H G542X AF50gb N1303K 2143delT 3849f 10kbC-T N1303K 681delC R347H A455E N1303K A120T 621+1 h T 574delA 1221delCT F311L R560K R553X R533X R553X Q552X R553X Q552X R116W R553X 1898+5 h T 3272-26A-G 1717-1hA 1342-2A-C A1507 2869insG 2869insG E92X 4374+1 h T 2183AA-G R117H 1609delCA I336K W1063X 1 1 1 1 6 1 3 1 1 22 17 1 1 1 1 1 1 1 1 1 1 1 1 1 17 1 1 4 157 7 1 2 2 1 1 2 2 1 9 1 1 1 1 1 1 6 1 1 1 2 1 3 2 1 3 1 1 1 4 2 4 1 1 - - 10.33 1.45 - - 0.48 1.45 - 0.24 1.45 0.24 - - - - 0.24 0.48 - - - - - - 0.49 0.48 - 0.24 0.24 0.24 - - - - - 0.72 0.24 0.72 - t h fP h b.fb,fP h b,fp.t t h b.fb.fp,h,t b.fb.fp,h,t t t t h b h h fP h fP fb b fP b.fb,fP,h.t fP fb b,fP,t b.fb,fp,h,t b.fb,h h h h,t t fb t b b b.fb.t fP fb fb tb h fP h h t t b h t h b b h h b,fb,h fP.h b h fP fP Bozon et al. (1994) Fanen et al. (1992) Dork et al. (1994a) Kerem et al. (1990) Dork et al. (1994~) Cutting et al. (1990) Kerem et al. (1990) lannuui et d. Login to comment

[hide] CFTR haplotype backgrounds on normal and mutant CF... Hum Mol Genet. 1994 Apr;3(4):607-14. Cuppens H, Teng H, Raeymaekers P, De Boeck C, Cassiman JJ
CFTR haplotype backgrounds on normal and mutant CFTR genes.
Hum Mol Genet. 1994 Apr;3(4):607-14., [PMID:7520797]

Abstract [show]
Ten polymorphic loci, located in a 1 Mb interval across the cystic fibrosis locus, were analyzed on normal and mutant CFTR genes. A different distribution of haplotype backgrounds among normal and mutant CFTR genes was observed. With exception of the D7S8 locus, the three most common mutations, delta F508, G542X and N1303K, were found on an identical haplotype background. In agreement with the observed linkage equilibrium between the Q1463Q and D7S8 loci, both alleles at the D7S8 locus were found on delta F508 CFTR genes. However, the G542X and N1303K mutations, which have been estimated to be at least 35000 years old, were found to be associated with a single allele at the D7S8 locus. Absence of recombination between the D7S8 and Q1463Q loci was also observed on normal CFTR genes with this haplotype background. At the Tn locus in intron 8, allele 9 known to result in very efficient splicing was associated with the most frequent mutations. At the M470V locus, located in a conserved region of the first nucleotide binding fold, the amino acid methionine was found to be associated with the frequent mutations, in particular with mutations located in one of the two nucleotide binding folds which are generally known as severe mutations with regard to exocrine pancreatic function. On mutant CFTR gene, this locus was in complete association with the centromeric D9 locus, in the absence of a complete association with the intervening loci.(ABSTRACT TRUNCATED AT 250 WORDS)

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
34 Distribution of alleles at 10 polymorphic loci Locus Allele Normal Mutant Mutations XV2c KM19 D9 1 2 1 2 1 2 58 (0.492) 60 (0.508) 84 (0.622) 51 (0.378) 78 (0.586) 55 (0.414) 146 (0.918) 13 (0.082) 19(0.109) 156 (0.891) 15 (0.085) 161 (0.915) 1001 + llC/T Tn 115 (0.927) R 9 (0.073) 5 7 (0.057) 7 102 (0.836) 9 13 (0.107) M470V C 62 (0.496) R 63 (0.504) 1898+15 2T/A C 84(0.641) R 47 (0.359) T854T Q1463Q D7S8 C 82 (0.636) R 47 (0.364) C 90 (0.692) R 40 (0.308) 1 38 (0.317) 2 82 (0.683) 33 (0.192) 139 (0.808) 0 (0.000) 32 (0.190) 136 (0.810) 156 (0.902) 17 (0.098) 163 (0.926) 13 (0.074) 162 (0.926) 13 (0.074) 162 (0.931) 12 (0.069) 91 (0.569) 69 (0.431) E60X, 622-2A-C, A455E, AF508 (98.3%), 1717-1G-A, G542X, 0.479 63.54 G628R(G-C)/S1235R,2183AA-G, G970R, W1282X, N1303K p<10~ G458V, AI5O7, AF508 (1.7%), 1898 + 1G-C, E73OX, 3272-26A-G, W1310X, 4218insT, UA, UB, UC I336K, W401X, 2T2ldelll, Y1092X, 3659delC, S1251N: not included (5%) E60X, 622-2A-C, W401X, G458V, AF5O8 (1.6%), 1898+ 1G-C, -0.541 90.63 G628R(G-Q/S1235R, E730X, G970R, 3272-26A-G (50.0%), p<10" Y1092X, 3659delC, S1251N, W1310X, UB, UTC A455E, AI507, AF5O8 (98.4%), 1717- 1G-A, G542X, 2183AA-G, 3272-26A-G (50.0%), W1282X, N13O3K, 4218insT, UA 1336K, 2721delU: not included (1%) E60X, 622-2A-C, W401X, G458V, 1898 +1G-C, E730X, G970R, -0.541 90.46 Y1092X, 3659delC, S1251N, W1310X, UB, UC p<10" A455E, AI507, AF508, 1717- 1G-A, G542X, G628R(G-Q/S1235R, 2183AA-G, 3272-26A-G, W1282X, N13O3K, 4218insT, UA I336K, 2721delll: not included (1%) E60X, 622-2A-C, I336K, W401X, G458V, AI507, 1717- 1G-A, -0.726 155.94 1898 + 1G-C, G628R(G-C)/S1235R, 2183AA-G, E730X, 2721delll, p< 10" G970R, 3272-26A-G, Y1092X, 3659delC, S1251N, W1282X, W1310X, 4218insT, UA, UB, UC A455E, AF5O8, G542X, N13O3K E60X, 622-2A-C, I336K, W401X, G458V, AI507, 1717-1G-A, 1898 + 1G-C, G628R(G-C)/S1235R, 2183AA-G, E730X, 2721delll, G970R, 3272-26A-G, Y1092X, 3659delC, S1251N, W1282X, W1310X, 4218insT, UA, UB, UC A455E, AF5O8, G542X, N13O3K A455E, AI5O7, AF508, 1717-1G-A, G542X, G628R(G-Q/S1235R, 2183AA-G, 3272-26A-G, W1282X, N13O3K, 4218insT, UA E60X, 622-2A-C, W401X, G458V, 1898 + 1G-C, E730X, G970R, Y1092X, 3659delC, S1251N, W1310X, UB, UC 1336K, midclll: not included (1%) E60X, 622-2A-C, W401X, A455E, G458V, AF508 (99.2%), G542X, 1898 + 1G-C, 2183AA-G, E730X, G970R, Y1092X, 3659delC, S1251N, N1303K, W1310X, UB, UC AI507, AF5O8 (0.8%), 1717-1G-A, G628R(G-Q/S1235R, 3272-26A-G, W1282X, 4218insT, UA I336K, 2721delU: not included (1%) E60X, 622-2A-C, W401X, A455E, G458V, AF508 (99.2%), G542X, 1898+1G-C, 2183AA-G, E730X, G970R, Y1092X, 3659delC,S1251N, N13O3K, W1310X, UB, UC AI507, AF508 (0.8%), 1717-1G-A, G628R(G-C)/S1235R, 3272-26A-G, W1282X, 4218insT, UA 1336K, midelll: not included (1%) E60X, 622-2A-C, W401X, A455E, G458V, AF5O8 (99.2%), G542X, G628R(G-Q/S1235R, 2183AA-G, E730X, G970R, Y1092X, 3659delC, S1251N,N1303K, W1310X, UC AI507, AF5O8 (0.8%), 1717-1G-A, 1898 + 1G-C, 3272-26A-G, W1282X, 4218insT 1336K, 2721del11. Login to comment
73 The I336K, W401X, 2721delll, Y1092X, 3659delC and S1251N mutations, contributing for 5% of all mutant CFTR genes, are not included. Login to comment

[hide] Detection of 98.5% of the mutations in 200 Belgian... Genomics. 1993 Dec;18(3):693-7. Cuppens H, Marynen P, De Boeck C, Cassiman JJ
Detection of 98.5% of the mutations in 200 Belgian cystic fibrosis alleles by reverse dot-blot and sequencing of the complete coding region and exon/intron junctions of the CFTR gene.
Genomics. 1993 Dec;18(3):693-7., [PMID:7508414]

Abstract [show]
We have previously shown that about 85% of the mutations in 194 Belgian cystic fibrosis alleles could be detected by a reverse dot-blot assay. In the present study, 50 Belgian chromosomes were analyzed for mutations in the cystic fibrosis transmembrane conductance regulator gene by means of direct solid phase automatic sequencing of PCR products of individual exons. Twenty-six disease mutations and 14 polymorphisms were found. Twelve of these mutations and 3 polymorphisms were not described before. With the exception of one mutant allele carrying two mutations, these mutations were the only mutations found in the complete coding region and their exon/intron boundaries. The total sensitivity of mutant CF alleles that could be identified was 98.5%. Given the heterogeneity of these mutations, most of them very rare, CFTR mutation screening still remains rather complex in our population, and population screening, whether desirable or not, does not appear to be technically feasible with the methods currently available.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
43 TABLE 1 Mutations (and Their Frequencies) Identified in This Study Predicted amino Mutation Nucleotide change~ acid change Location Frequencyb Reference E60X G --~ T at 310 (TAGATAGCT) Glu --~ Stop at 60 Malone et al. in (21); this study G --~ A at 482 (GAACACTCT) (8) A --~ C at 622-2 (TTTTCGACT) This study T --~ A at 1139 (AAAAAATTC) This study G --~ A at 1335 (TCTGAGAGG) This study C --~ A at 1496 (TTGGAGGTT) (14) G -~ T at 1505 (GCTGTATCC) (6) Deletion of ATC from 1651 (14); Schwarz et al. (TATC_TTTG) in (21) Deletion of CTT from 1653 145 (13) (TCAT_TGGT) G --~ A at 1717-1 (AATAAGACA) G --~ T at 1756 (TCTTTGAGA) G --~ C at 1898 + 1 (AAAGCTATG) G --~ C at 2014 (TTATCGGAC Deletion of A at 2184; A --~ G at 2183 (AAAAG CAAT) G --~ T at 2320 (TGATTAGCC Deletion of 11 nucleotides from 2721 (TGCT_TAGT) G --~ C at 3040 (AGCACGTAC A --~ G at 3272-26 (TGCAGTGTT) C --~ A at 3408 (TGTAACTGT) Deletion of C at 3659 (CCTA_CAAG) T --~ G at 3837 (TAAGGCCTG G --* A at 3884 (AAGAATACT G --~ A at 3978 (AGTGAAGGA' C --~ G at 4041 (AAAAGTTGG G -~ A at 4061 (CAGTAGAGT Insertion of T after 4218 (CAGTTAAGG) R117H 622-2A --~ C I336K W401X A455E G458V AI507 AF508 1717-1G -~ A G542X 1898+ 1G-~C G628R(G -~ C) 2184delA plus A -~ G at 2183 E730X 2721de111 G970R 3272-26A --~ G Y1092X 3659delc $1235R $1251N W1282X N1303K W1310X 4218insT Exon 3 2 (1.0%) Arg --~ His at 117 Exon 4 c 3' splice signal Intron 4 1 (0.5%) Ile -~ Lys at 336 Exon 7 1 (0.5%) Trp --~ Stop at 401 Exon 8 2 (1.0%) Ala --~ Glu at 455 Exon 9 2 (1.0%) Gly --* Val at 458 Exon 9 1 (0.5%) Deletion of Ile 507 Exon 10 1 (0.5%) Deletion of Phe 508 Exon 10 (72.5%) 3' splice signal Intron 10 5 (2.5%) Gly --* Stop at 542 Exon 11 11 (5.5%) 5' splice signal Intron 12 1 (0.5%) Gly -~ Arg at 628 Exon 13 1 (0.5%) Frameshift Exon 13 2 (1.0%) Glu --~ Stop at 730 Exon 13 1 (0.5%) Frameshift Exon 14a I (0.5%) Gly --~ Arg at 970 Exon 15 1 (0.5%) 5' splice signal? Login to comment
78 The second newly described missense mutation, I336K, is located in the first transmembrane domain and results in the substitution of a neutral amino acid by a basic one. Login to comment
80 It has been shown that mutagenesis of the neighboring amino acid 335 from a basic amino acid to an acidic amino acid (K335E) results in a CFTR protein with altered anion permeability sequence and conductivity sequence properties of the different halides (2). Login to comment
81 The I336K mutation will result in an extra positive charge in the neighborhood of the critical K335 amino acid. Login to comment
83 It could not be excluded that the I336K and 2721de111 mutations were present on a single allele in this individual, as no DNA of the parents was available. Login to comment
84 Subsequent to the identification of the I336K mutation in this individual, an A508/I336K patient with mild CF, who was diagnosed at the age of 12 years, has been iden- tiffed (T. DSrk, pers. Login to comment
87 The presence of the I336K and 2721de111 mutations on a single CFTR allele therefore seems unlikely. Login to comment
88 The I336K mutation further substantiates the observation that mutations in the first transmembrane regions result in a mild CF phenotype (8, 19). Login to comment
42 TABLE 1 Mutations (and Their Frequencies) Identified in This Study Predicted amino Mutation Nucleotide change~ acid change Location Frequencyb Reference E60X G --~ T at 310 (TAGATAGCT) Glu --~ Stop at 60 Malone et al. in (21); this study G --~ A at 482 (GAACACTCT) (8) A --~ C at 622-2 (TTTTCGACT) This study T --~ A at 1139 (AAAAAATTC) This study G --~ A at 1335 (TCTGAGAGG) This study C --~ A at 1496 (TTGGAGGTT) (14) G -~ T at 1505 (GCTGTATCC) (6) Deletion of ATC from 1651 (14); Schwarz et al. (TATC_TTTG) in (21) Deletion of CTT from 1653 145 (13) (TCAT_TGGT) G --~ A at 1717-1 (AATAAGACA) G --~ T at 1756 (TCTTTGAGA) G --~ C at 1898 + 1 (AAAGCTATG) G --~ C at 2014 (TTATCGGAC Deletion of A at 2184; A --~ G at 2183 (AAAAG CAAT) G --~ T at 2320 (TGATTAGCC Deletion of 11 nucleotides from 2721 (TGCT_TAGT) G --~ C at 3040 (AGCACGTAC A --~ G at 3272-26 (TGCAGTGTT) C --~ A at 3408 (TGTAACTGT) Deletion of C at 3659 (CCTA_CAAG) T --~ G at 3837 (TAAGGCCTG G --* A at 3884 (AAGAATACT G --~ A at 3978 (AGTGAAGGA' C --~ G at 4041 (AAAAGTTGG G -~ A at 4061 (CAGTAGAGT Insertion of T after 4218 (CAGTTAAGG) R117H 622-2A --~ C I336K W401X A455E G458V AI507 AF508 1717-1G -~ A G542X 1898+ 1G-~C G628R(G -~ C) 2184delA plus A -~ G at 2183 E730X 2721de111 G970R 3272-26A --~ G Y1092X 3659delc $1235R $1251N W1282X N1303K W1310X 4218insT Exon 3 2 (1.0%) Arg --~ His at 117 Exon 4 c 3' splice signal Intron 4 1 (0.5%) Ile -~ Lys at 336 Exon 7 1 (0.5%) Trp --~ Stop at 401 Exon 8 2 (1.0%) Ala --~ Glu at 455 Exon 9 2 (1.0%) Gly --* Val at 458 Exon 9 1 (0.5%) Deletion of Ile 507 Exon 10 1 (0.5%) Deletion of Phe 508 Exon 10 (72.5%) 3' splice signal Intron 10 5 (2.5%) Gly --* Stop at 542 Exon 11 11 (5.5%) 5' splice signal Intron 12 1 (0.5%) Gly -~ Arg at 628 Exon 13 1 (0.5%) Frameshift Exon 13 2 (1.0%) Glu --~ Stop at 730 Exon 13 1 (0.5%) Frameshift Exon 14a I (0.5%) Gly --~ Arg at 970 Exon 15 1 (0.5%) 5' splice signal? Login to comment
77 The second newly described missense mutation, I336K, is located in the first transmembrane domain and results in the substitution of a neutral amino acid by a basic one. Login to comment
82 It could not be excluded that the I336K and 2721de111 mutations were present on a single allele in this individual, as no DNA of the parents was available. Login to comment
86 The presence of the I336K and 2721de111 mutations on a single CFTR allele therefore seems unlikely. Login to comment

[hide] Genotype analysis of adult cystic fibrosis patient... Hum Mol Genet. 1993 Oct;2(10):1557-60. Ferec C, Verlingue C, Guillermit H, Quere I, Raguenes O, Feigelson J, Audrezet MP, Moullier P, Mercier B
Genotype analysis of adult cystic fibrosis patients.
Hum Mol Genet. 1993 Oct;2(10):1557-60., [PMID:7505690]

Abstract [show]
To assess the relationship between the genotype and phenotype of adult CF patients we have selected from a group of 512 CF patients attending centres in France, all these of greater than 35 years. We have analysed the entire coding sequence of their CFTR genes. The complete genotype was determined in 7 of the 8 patients and clinical data regarding pancreatic, respiratory and reproductive function were carefully evaluated. All these patients are compound heterozygote, seven carrying the delta F508 and one the G542X on one allele. The other allele carried is: (i) a missense mutation located in exons coding for transmembrane region in five patients [R334W (1); I336K (2); R117H (1); H1054D (1)]; (ii) a splice mutation in two patients [2789 + 5G-->A], (iii) an uncharacterised mutations in one patient. These results strongly suggest less severe CF phenotype to be associated with these mutations and strengthen the hypothesis that less severe phenotype are genetically determined.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
5 The other allele carried is: (i) a missense mutation located in exons coding for transmembrane region in five patients [R334W (1); I336K (2); R117H (1); H1054D (1)]; (ii) a splice mutation in two patients [2789 + 5G - A], (ill) an uncharacterised mutations In one patient. Login to comment
36 The I336K which results in a Lysine instead of an Isoleucine (Cassiman, personal communication), is found in two patients Figure 1. Login to comment
40 The I336K, introduces an Sspl restriction site in exon 7 and can, therefore, be detected by digestion with this enzyme. Login to comment
57 '*'* < GENOTYPE * • • ;i^>"; ' ' FUJ34W/G542X Exon 7/ Exon 11 Arginine •-> Tryptophan AF508/I336K Exon 10/Exon 7 Isoleucine ••> Lysine AF5O8/H1054O Exon 10/Exon 17b Histidine --> Aspartc Acid AF508 Unknown AF508 / 2789+5 G->A Exon 10/ Exon 14b Splice mutation AF508/2789+5 G->A Exon 10/ Exon 14b Splice mutation AF5O8/R117H Exon 10/Exon 4 Arginine -->Histidine AF508/O36K Exon 10/Exon 7 Isoteucine ••> Lysine SEX 4 M F M M F F F M DIAGNOSiS 13 13 27 17 39 32 30 17 PROFESSIONAL; . Login to comment
87 In this group two patients (a brother and a sister) compound heterozygotes for AF5O8 and I336K present with different phenotypes with regard to pancreatic status and pulmonary function, the male being PS and free of Pseudomonas Aeruginosa colonisation at 40 years old. Login to comment
91 Several different types of mutations have been found in this group, a splice mutation being present in two patients (2789+5 G - A in exon 14b), and missense mutations (R334W in exon 7, I336K in exon 7, Rl 17H in exon 4 and H1054D in exon 17b) present in the others. Login to comment

[hide] Distribution of CFTR mutations in the Czech popula... J Cyst Fibros. 2013 Sep;12(5):532-7. doi: 10.1016/j.jcf.2012.12.002. Epub 2012 Dec 29. Krenkova P, Piskackova T, Holubova A, Balascakova M, Krulisova V, Camajova J, Turnovec M, Libik M, Norambuena P, Stambergova A, Dvorakova L, Skalicka V, Bartosova J, Kucerova T, Fila L, Zemkova D, Vavrova V, Koudova M, Macek M, Krebsova A, Macek M Jr
Distribution of CFTR mutations in the Czech population: positive impact of integrated clinical and laboratory expertise, detection of novel/de novo alleles and relevance for related/derived populations.
J Cyst Fibros. 2013 Sep;12(5):532-7. doi: 10.1016/j.jcf.2012.12.002. Epub 2012 Dec 29., [PMID:23276700]

Abstract [show]
BACKGROUND: This two decade long study presents a comprehensive overview of the CFTR mutation distribution in a representative cohort of 600 Czech CF patients derived from all regions of the Czech Republic. METHODS: We examined the most common CF-causing mutations using the Elucigene CF-EU2v1 assay, followed by MLPA, mutation scanning and/or sequencing of the entire CFTR coding region and splice site junctions. RESULTS: We identified 99.5% of all mutations (1194/1200 CFTR alleles) in the Czech CF population. Altogether 91 different CFTR mutations, of which 20 were novel, were detected. One case of de novo mutation and a novel polymorphism was revealed. CONCLUSION: The commercial assay achieved 90.7%, the MLPA added 1.0% and sequencing increased the detection rate by 7.8%. These comprehensive data provide a basis for the improvement of CF DNA diagnostics and/or newborn screening in our country. In addition, they are relevant to related Central European populations with lower mutation detection rates, as well as to the sizeable North American "Bohemian diaspora".

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
85 The Elucigene CF-EU2v1ࡊ assay was shown to achieve sufficient mutation detection rates for multi-tier CF NBS (i.e. more than 85%), although the I336K and S945L, with frequency over 0.5% (Table 1), should also be included in the Czech national screening panel [1]. Login to comment
89 Mutations/HGVS nomenclature/ Mutations/traditional nomenclature, legacy name/ Czech Republic 2012 (this study) (N=1200) Slovakia 2010 (N=856) Eastern Hungary 2011 (N=80) Germany Bavaria 2002 (N=250) Austria Tyrol 1997 (N=126) Austria NorthEast, North- North 2002 (N=118) Poland (N=1726) c.1521_1523delCTT F508del 67.42 66.80 70.00 74.00 74,60 70.30 57.0 c.54-5940_273+10250del21 kb CFTRdele2,3/21kb 5.75 2.26 5.00 1.2* 2.6# NA 1.80 c.1652GNA G551D 2.91 b0.50 0.00 6.40 1.60 2.50 0.50 c.3909CNG N1303K 2.42 2.03 5.00 2.40 0.00 NA 1.80 c.1624GNT G542X 2.00 4.06 3.75 3.20 2.40 5.10 2.60 c.3718-2477CNT 3849+10kbCNT 1.67 4.28 0.00 NA 0.00 3.40 2.70 c.1766+1GNA 1898+1GNA 1.42 b0.50 0.00 NA 0.00 NA NA c.1040GNC R347P 0.92 1.10 1.25 0.80 1.60 2.50 NA c.2012delT 2143delT 0.92 1.10 0.00 NA 0.00 NA NA c.3140-26ANG 3272-26ANG 0.67 b0.50 0.00 NA 0.00 NA NA c.3846GNA W1282X 0.58 b0.50 0.00 NA 0.00 NA 0.70 c.1007TNA I336K 0.58 0.00 0.00 NA 0.00 NA NA c.1657CNT R553X 0.50 0.90 0.00 1.20 0.00 NA 1.90 c.2657+5GNA 2789+5GNA 0.50 0.00 0.00 NA 2.40 NA NA c.2834CNT S945L 0.50 0.00 0.00 NA 0.00 NA NA c.2052_2053insA 2184insA 0.42 1.58 5.00 NA 0.00 NA NA Legend: data for Slovakia [12], Eastern Hungary [14], Germany-Bavaria [13], Austria-Tyrol [18], Austria North East and North West [13], Poland and *[8], and # [16]. Login to comment

[hide] Effect of ivacaftor on CFTR forms with missense mu... J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23. Van Goor F, Yu H, Burton B, Hoffman BJ
Effect of ivacaftor on CFTR forms with missense mutations associated with defects in protein processing or function.
J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23., [PMID:23891399]

Abstract [show]
BACKGROUND: Ivacaftor (KALYDECO, VX-770) is a CFTR potentiator that increased CFTR channel activity and improved lung function in patients age 6 years and older with CF who have the G551D-CFTR gating mutation. The aim of this in vitro study was to evaluate the effect of ivacaftor on mutant CFTR protein forms with defects in protein processing and/or channel function. METHODS: The effect of ivacaftor on CFTR function was tested in electrophysiological studies using a panel of Fischer rat thyroid (FRT) cells expressing 54 missense CFTR mutations that cause defects in the amount or function of CFTR at the cell surface. RESULTS: Ivacaftor potentiated multiple mutant CFTR protein forms that produce functional CFTR at the cell surface. These included mutant CFTR forms with mild defects in CFTR processing or mild defects in CFTR channel conductance. CONCLUSIONS: These in vitro data indicated that ivacaftor is a broad acting CFTR potentiator and could be used to help stratify patients with CF who have different CFTR genotypes for studies investigating the potential clinical benefit of ivacaftor.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 None M1V A46D E56K P67L R74W G85E E92K D110E D110H R117C R117H E193K L206W R334W I336K T338I S341P R347H R347P R352Q A455E L467P S492F F508del V520F A559T R560S R560T A561E Y569D D579G R668C L927P S945L S977F L997F F1052V H1054D K1060T L1065P R1066C R1066H R1066M A1067T R1070Q R1070W F1074L L1077P H1085R M1101K D1152H S1235R D1270N N1303K 0 100 200 300 400 500 600 * * * CFTR Mutation mRNA (% Normal CFTR) Fig. 1. Login to comment
64 Mutant CFTR form CFTR processing Mature/total % Normal CFTR Normal 0.89 &#b1; 0.01 100.0 &#b1; 18.5 G85E -0.05 &#b1; 0.04 -1.0 &#b1; 0.9 R560S 0.00 &#b1; 0.00 0.0 &#b1; 0.0 R1066C 0.02 &#b1; 0.01 0.0 &#b1; 0.0 S492F 0.00 &#b1; 0.00 0.1 &#b1; 0.1 R560T 0.01 &#b1; 0.01 0.2 &#b1; 0.1 V520F 0.05 &#b1; 0.03 0.3 &#b1; 0.2 M1101K 0.05 &#b1; 0.03 0.3 &#b1; 0.1 A561E 0.08 &#b1; 0.04 0.5 &#b1; 0.2 R1066M 0.02 &#b1; 0.02 0.5 &#b1; 0.4 N1303K 0.02 &#b1; 0.02 0.5 &#b1; 0.3 A559T 0.16 &#b1; 0.09 0.6 &#b1; 0.2 M1V 0.06 &#b1; 0.06 0.7 &#b1; 0.6 Y569D 0.11 &#b1; 0.04 0.6 &#b1; 0.2 R1066H 0.08 &#b1; 0.02a 0.7 &#b1; 0.2a L1065P 0.05 &#b1; 0.05 1.0 &#b1; 0.8 L467P 0.10 &#b1; 0.07 1.2 &#b1; 0.8 L1077P 0.08 &#b1; 0.04 1.5 &#b1; 0.6 A46D 0.21 &#b1; 0.08 1.9 &#b1; 0.5a E92K 0.06 &#b1; 0.05 1.9 &#b1; 1.3 H1054D 0.09 &#b1; 0.04 1.9 &#b1; 0.8 F508del 0.09 &#b1; 0.02a 2.3 &#b1; 0.5a H1085R 0.06 &#b1; 0.01a 3.0 &#b1; 0.7a I336K 0.42 &#b1; 0.05a 6.5 &#b1; 0.7a L206W 0.35 &#b1; 0.10a 6.8 &#b1; 1.7a F1074L 0.52 &#b1; 0.03a 10.9 &#b1; 0.6a A455E 0.26 &#b1; 0.10a 11.5 &#b1; 2.5a E56K 0.29 &#b1; 0.04a 12.2 &#b1; 1.5a R347P 0.48 &#b1; 0.04a 14.6 &#b1; 1.8a R1070W 0.61 &#b1; 0.04a 16.3 &#b1; 0.6a P67L 0.36 &#b1; 0.04a 28.4 &#b1; 6.8a R1070Q 0.90 &#b1; 0.01a 29.5 &#b1; 1.4a S977F 0.97 &#b1; 0.01a 37.3 &#b1; 2.4a A1067T 0.78 &#b1; 0.03a 38.6 &#b1; 6.1a D579G 0.72 &#b1; 0.02a 39.3 &#b1; 3.1a D1270N 1.00 &#b1; 0.00a,c 40.7 &#b1; 1.2a S945L 0.65 &#b1; 0.04a 42.4 &#b1; 8.9a L927P 0.89 &#b1; 0.01a,b 43.5 &#b1; 2.5a,b R117C 0.87 &#b1; 0.02a,b 49.1 &#b1; 2.9a,b T338I 0.93 &#b1; 0.03a,b 54.2 &#b1; 3.7a,b L997F 0.90 &#b1; 0.04a,b 59.8 &#b1; 10.4a,b D110H 0.97 &#b1; 0.01a,b 60.6 &#b1; 1.5a,b S341P 0.79 &#b1; 0.02a 65.0 &#b1; 4.9a,b R668C 0.94 &#b1; 0.03a,b 68.5 &#b1; 1.9a,b R74W 0.78 &#b1; 0.01a 69.0 &#b1; 2.7a,b D110E 0.92 &#b1; 0.05a,b 87.5 &#b1; 9.5a,b R334W 0.91 &#b1; 0.05a,b 97.6 &#b1; 10.0a,b K1060T 0.87 &#b1; 0.02a,b 109.9 &#b1; 28.0a,b R347H 0.96 &#b1; 0.02a,c 120.7 &#b1; 2.8a,b S1235R 0.96 &#b1; 0.00a,c 139.0 &#b1; 9.0a,b E193K 0.84 &#b1; 0.02a,b 143.0 &#b1; 17.1a,b R117H 0.86 &#b1; 0.01a,b 164.5 &#b1; 34.2a,b R352Q 0.98 &#b1; 0.01a,b 179.9 &#b1; 8.0a,c F1052V 0.90 &#b1; 0.01a,b 189.9 &#b1; 33.1a,b D1152H 0.96 &#b1; 0.02a,c 312.0 &#b1; 45.5a,b Notes to Table 1: Quantification of steady-state CFTR maturation expressed as the mean (&#b1;SEM; n = 5-9) ratio of mature CFTR to total CFTR (immature plus mature) or level of mature mutant CFTR relative to mature normal-CFTR (% normal CFTR) in FRT cells individually expressing CFTR mutations. Login to comment
74 Because the level of CFTR mRNA was similar across the panel of cell lines tested, the range in baseline activity and ivacaftor response likely reflects the severity of the functional defect and/or the 0 50 100 150 200 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L E56K P67L R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V Baseline With ivacaftor * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Chloride transport (% Normal) Mutant CFTR form 0 100 200 300 400 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L P67L E56K R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Mature CFTR (% Normal) Mutant CFTR form A B Fig. 2. Login to comment
82 Mutation Patientsa Chloride transport (bc;A/cm2 ) Chloride transport (% normal) EC50 Baseline With ivacaftor Baseline With ivacaftor Fold increase over baselineb Normal 204.5 &#b1; 33.3 301.3 &#b1; 33.8c 100.0 &#b1; 16.3 147.3 &#b1; 16.5c 1.5 266 &#b1; 42 G551D 1282 1.5 &#b1; 0.7 113.2 &#b1; 13.0c 1.0 &#b1; 0.5 55.3 &#b1; 6.3c 55.3 312 &#b1; 73 F1052V 12 177.3 &#b1; 13.7 410.2 &#b1; 11.3c 86.7 &#b1; 6.7 200.7 &#b1; 5.6c 2.3 177 &#b1; 14 S1235R ND 160.6 &#b1; 25.7 352.1 &#b1; 43.4c 78.5 &#b1; 12.6 172.2 &#b1; 21.2c 2.2 282 &#b1; 104 D1152H 185 117.3 &#b1; 23.0 282.7 &#b1; 46.9c 57.4 &#b1; 11.2 138.2 &#b1; 22.9c 2.4 178 &#b1; 67 D1270N 32 109.5 &#b1; 20.5 209.5 &#b1; 27.4c 53.6 &#b1; 10.0 102.4 &#b1; 13.4c 1.9 254 &#b1; 56 R668C 45 99.0 &#b1; 9.4 217.6 &#b1; 11.7c 48.4 &#b1; 4.6 106.4 &#b1; 5.7c 2.2 517 &#b1; 105 K1060T ND 89.0 &#b1; 9.8 236.4 &#b1; 20.3c 43.5 &#b1; 4.8 115.6 &#b1; 9.9c 2.7 131 &#b1; 73 R74W 25 86.8 &#b1; 26.9 199.1 &#b1; 16.8c 42.5 &#b1; 13.2 97.3 &#b1; 8.2c 2.3 162 &#b1; 17 R117H 739 67.2 &#b1; 13.3 274.1 &#b1; 32.2c 32.9 &#b1; 6.5 134.0 &#b1; 15.7c 4.1 151 &#b1; 14 E193K ND 62.2 &#b1; 9.8 379.1 &#b1; 1.1c 30.4 &#b1; 4.8 185.4 &#b1; 1.0c 6.1 240 &#b1; 20 A1067T ND 55.9 &#b1; 3.2 164.0 &#b1; 9.7c 27.3 &#b1; 1.6 80.2 &#b1; 4.7c 2.9 317 &#b1; 214 L997F 27 43.7 &#b1; 3.2 145.5 &#b1; 4.0c 21.4 &#b1; 1.6 71.2 &#b1; 2.0c 3.3 162 &#b1; 12 R1070Q 15 42.0 &#b1; 0.8 67.3 &#b1; 2.9c 20.6 &#b1; 0.4 32.9 &#b1; 1.4c 1.6 164 &#b1; 20 D110E ND 23.3 &#b1; 4.7 96.4 &#b1; 15.6c 11.4 &#b1; 2.3 47.1 &#b1; 7.6c 4.1 213 &#b1; 51 D579G 21 21.5 &#b1; 4.1 192.0 &#b1; 18.5c 10.5 &#b1; 2.0 93.9 &#b1; 9.0c 8.9 239 &#b1; 48 D110H 30 18.5 &#b1; 2.2 116.7 &#b1; 11.3c 9.1 &#b1; 1.1 57.1 &#b1; 5.5c 6.2 249 &#b1; 59 R1070W 13 16.6 &#b1; 2.6 102.1 &#b1; 3.1c 8.1 &#b1; 1.3 49.9 &#b1; 1.5c 6.2 158 &#b1; 48 P67L 53 16.0 &#b1; 6.7 88.7 &#b1; 15.7c 7.8 &#b1; 3.3 43.4 &#b1; 7.7c 5.6 195 &#b1; 40 E56K ND 15.8 &#b1; 3.1 63.6 &#b1; 4.4c 7.7 &#b1; 1.5 31.1 &#b1; 2.2c 4.0 123 &#b1; 33 F1074L ND 14.0 &#b1; 3.4 43.5 &#b1; 5.4c 6.9 &#b1; 1.6 21.3 &#b1; 2.6c 3.1 141 &#b1; 19 A455E 120 12.9 &#b1; 2.6 36.4 &#b1; 2.5c 6.3 &#b1; 1.2 17.8 &#b1; 1.2c 2.8 170 &#b1; 44 S945L 63 12.3 &#b1; 3.9 154.9 &#b1; 47.6c 6.0 &#b1; 1.9 75.8 &#b1; 23.3c 12.6 181 &#b1; 36 S977F 9 11.3 &#b1; 6.2 42.5 &#b1; 19.1c 5.5 &#b1; 3.0 20.8 &#b1; 9.3c 3.8 283 &#b1; 36 R347H 65 10.9 &#b1; 3.3 106.3 &#b1; 7.6c 5.3 &#b1; 1.6 52.0 &#b1; 3.7c 9.8 280 &#b1; 35 L206W 81 10.3 &#b1; 1.7 36.4 &#b1; 2.8c 5.0 &#b1; 0.8 17.8 &#b1; 1.4c 3.6 101 &#b1; 13 R117C 61 5.8 &#b1; 1.5 33.7 &#b1; 7.8c 2.9 &#b1; 0.7 16.5 &#b1; 3.8c 5.7 380 &#b1; 136 R352Q 46 5.5 &#b1; 1.0 84.5 &#b1; 7.8c 2.7 &#b1; 0.5 41.3 &#b1; 3.8c 15.2 287 &#b1; 75 R1066H 29 3.0 &#b1; 0.3 8.0 &#b1; 0.8c 1.5 &#b1; 0.1 3.9 &#b1; 0.4c 2.6 390 &#b1; 179 T338I 54 2.9 &#b1; 0.8 16.1 &#b1; 2.4c 1.4 &#b1; 0.4 7.9 &#b1; 1.2c 5.6 334 &#b1; 38 R334W 150 2.6 &#b1; 0.5 10.0 &#b1; 1.4c 1.3 &#b1; 0.2 4.9 &#b1; 0.7c 3.8 259 &#b1; 103 G85E 262 1.6 &#b1; 1.0 1.5 &#b1; 1.2 0.8 &#b1; 0.5 0.7 &#b1; 0.6 NS NS A46D ND 2.0 &#b1; 0.6 1.1 &#b1; 1.1 1.0 &#b1; 0.3 0.5 &#b1; 0.6 NS NS I336K 29 1.8 &#b1; 0.2 7.4 &#b1; 0.1c 0.9 &#b1; 0.1 3.6 &#b1; 0.1c 4 735 &#b1; 204 H1054D ND 1.7 &#b1; 0.3 8.7 &#b1; 0.3c 0.8 &#b1; 0.1 4.2 &#b1; 0.1c 5.3 187 &#b1; 20 F508del 29,018 0.8 &#b1; 0.6 12.1 &#b1; 1.7c 0.4 &#b1; 0.3 5.9 &#b1; 0.8c 14.8 129 &#b1; 38 M1V 9 0.7 &#b1; 1.4 6.5 &#b1; 1.9c 0.4 &#b1; 0.7 3.2 &#b1; 0.9c 8.0 183 &#b1; 85 E92K 14 0.6 &#b1; 0.2 4.3 &#b1; 0.8c 0.3 &#b1; 0.1 2.1 &#b1; 0.4c 7.0 198 &#b1; 46 V520F 58 0.4 &#b1; 0.2 0.5 &#b1; 0.2 0.2 &#b1; 0.1 0.2 &#b1; 0.1 NS NS H1085R ND 0.3 &#b1; 0.2 2.1 &#b1; 0.4 0.2 &#b1; 0.1 1.0 &#b1; 0.2 NS NS R560T 180 0.3 &#b1; 0.3 0.5 &#b1; 0.5 0.1 &#b1; 0.1 0.2 &#b1; 0.2 NS NS L927P 15 0.2 &#b1; 0.1 10.7 &#b1; 1.7c 0.1 &#b1; 0.1 5.2 &#b1; 0.8c 52.0 313 &#b1; 66 R560S ND 0.0 &#b1; 0.1 -0.2 &#b1; 0.2 0.0 &#b1; 0.0 -0.1 &#b1; 0.1 NS NS N1303K 1161 0.0 &#b1; 0.0 1.7 &#b1; 0.3 0.0 &#b1; 0.0 0.8 &#b1; 0.2 NS NS M1101K 79 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1077P 42 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066M ND 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066C 100 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1065P 25 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS Y569D 9 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS A561E ND 0.0 &#b1; 0.1 0.0 &#b1; 0.1 0.0 &#b1; 0.0 0.0 &#b1; 0.1 NS NS A559T 43 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S492F 16 0.0 &#b1; 0.0 1.7 &#b1; 1.2 0.0 &#b1; 0.0 0.8 &#b1; 0.6 NS NS L467P 16 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R347P 214 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S341P 9 0.0 &#b1; 0.0 0.2 &#b1; 0.2 0.0 &#b1; 0.0 0.1 &#b1; 0.1 NS NS a Number of individuals with the individual mutation in the CFTR-2 database (www.CFTR2.org). Login to comment
99 A small but significant response to ivacaftor was also observed in FRT cells expressing the severe processing mutations, M1V, H1054D, and I336K (Table 2; Fig. 2). Login to comment

[hide] CFTR mutations spectrum and the efficiency of mole... PLoS One. 2014 Feb 26;9(2):e89094. doi: 10.1371/journal.pone.0089094. eCollection 2014. Zietkiewicz E, Rutkiewicz E, Pogorzelski A, Klimek B, Voelkel K, Witt M
CFTR mutations spectrum and the efficiency of molecular diagnostics in Polish cystic fibrosis patients.
PLoS One. 2014 Feb 26;9(2):e89094. doi: 10.1371/journal.pone.0089094. eCollection 2014., [PMID:24586523]

Abstract [show]
Cystic fibrosis (CF) is caused by mutations in the cystic fibrosis transmembrane regulator gene (CFTR). In light of the strong allelic heterogeneity and regional specificity of the mutation spectrum, the strategy of molecular diagnostics and counseling in CF requires genetic tests to reflect the frequency profile characteristic for a given population. The goal of the study was to provide an updated comprehensive estimation of the distribution of CFTR mutations in Polish CF patients and to assess the effectiveness of INNOLiPA_CFTR tests in Polish population. The analyzed cohort consisted of 738 patients with the clinically confirmed CF diagnosis, prescreened for molecular defects using INNOLiPA_CFTR panels from Innogenetics. A combined efficiency of INNOLiPA CFTR_19 and CFTR_17_TnUpdate tests was 75.5%; both mutations were detected in 68.2%, and one mutation in 14.8% of the affected individuals. The group composed of all the patients with only one or with no mutation detected (109 and 126 individuals, respectively) was analyzed further using a mutation screening approach, i.e. SSCP/HD (single strand conformational polymorphism/heteroduplex) analysis of PCR products followed by sequencing of the coding sequence. As a result, 53 more mutations were found in 97 patients. The overall efficiency of the CF allele detection was 82.5% (7.0% increase compared to INNOLiPA tests alone). The distribution of the most frequent mutations in Poland was assessed. Most of the mutations repetitively found in Polish patients had been previously described in other European populations. The most frequent mutated allele, F508del, represented 54.5% of Polish CF chromosomes. Another eight mutations had frequencies over 1%, 24 had frequencies between 1 and 0.1%; c.2052-2053insA and c.3468+2_3468+3insT were the most frequent non-INNOLiPA mutations. Mutation distribution described herein is also relevant to the Polish diaspora. Our study also demonstrates that the reported efficiency of mutation detection strongly depends on the diagnostic experience of referring health centers.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
71 Exon / intron (legacy) Exon / intron (Ensembl) Protein change SVM value cDNA (HGVS nomenclature) gDNA (cDNA +132 bp) Number of PL CF chromosomes Reference a Mutations in trans Pathogenic mutations 1 1 L15Ffs10X c.43delC 175delC 1 CFMDB 1717-1G.A 2 2 G27V 21.92 c.80G.T 212G.T 1 Novel F508del 2 2 S18RfsX16 c.54-5940_273 +10250del21kb exon2,3del21kb 66 IL19 various CF mutations i2 i2 IVS2_Donor c.164+1G.A 296+1G.A 3 CFMDB various CF mutations 3 3 G85E 22.61 c.254G.A 386G.A 1 IL17 unknown 3 3 E60X c.178G.T 310G.T 0 IL17 x 3 3 L88IfsX22 c.262_263delTT 394delTT 0 IL17 x 4 4 E92K 21.92 c.274G.A 406G.A 2 CFMDB c.164+1G.A; c.2051- 2AA.G 4 4 L101X c.302T.G 434T.G 1 CFMDB c.3717+12191C.T 4 4 K114IfsX5 c.341_353del13bp 473del13bp 1 Novel F508del 4 4 R117H 20.35 c.350G.A 482G.A 5 IL17 F508del; 2x unknown 4 4 R117C 22.07 c.349C.T 481C.T 2 CFMDB S1206X;1x unknown 4 4 L137_L138insT c.412_413insACT L138ins 1 CFMDB F508del 4 4 R153I 22.61 c.458G.T 590G.T 2 Novel F508del; c.3527delC i4 i4 IVS4_Donor c.489+1G.T 621+1G.T 5 IL17 F508del; c.489+1G.T 5 5 L165X c.494T.A 626T.A 1 Novel F508del i5 i5 IVS5_Donor c.579+1G.T 711+1G.T 0 IL19 x i5 i5 IVS5_Donor c.579+3A.G 711+3A.G 2 CFMDB 2,3del21kb; c.2052-3insA i5 i5 IVS5_Donor c.579+5G.A 711+5G.A 0 IL17 x 7 8 F311L 20.90 c.933C.G 965C.G 2 CFMDB 2x F508 7 8 G314R 20.58 c.940G.A 1072G.A 4 CFMDB various CF mutations 7 8 F316LfsX12 c.948delT 1078delT 1 IL17 unkown 7 8 R334W 22.41 c.1000C.T 1132C.T 6 IL17 various CF mutations 7 8 I336K 22.07 c.1007T.A 1139T.A 2 CFMDB 2,3de21kb; F508del 7 8 R347P 22.27 c.1040G.C 1172G.C 11 IL17 various CF mutations i7 i8 IVS8_Donor c.1116+2T.A 1248+2T.A 1 Novel Q1412X 9 10 A455E 22.61 c.1364C.A 1496C.A 0 IL17 x i9 i10 IVS10_Donor c.1392+1G.A 1524+1G.A 1 CFMDB c.3816-7delGT 10 11 S466X c.1397C.G 1529C.G 1 CFMDB G542X 10 11 I507del c.1519_1521delATC 1651delATC 2 IL19 F508del 10 11 F508del c.1521_1523delCTT 1654delCTT 805 IL19 various CF mutations i10 i11 IVS11_Acceptor c.1585-1G.A 1717-1G.A 27 IL19 various CF mutations 11 12 G542X c.1624G.T 1756G.T 25 IL19 various CF mutations 11 12 G551D 21.24 c.1624G.T 1756G.T 5 IL19 various CF mutations 11 12 Q552X c.1654C.T 1786C.T 0 IL19 x 11 12 R553X c.1657C.T 1789C.T 14 IL19 various CF mutations 11 12 R560T 21.92 c.1679G.C 1811G.C 0 IL19 x i12 i13 IVS13_Donor c.1766+1G.A 1898+1G.A 6 IL19 various CF mutations i12 i13 IVS13_Donor c.1766+1G.C 1898+1G.C 1 CFMDB F508del 13 14 H620P 21.73 c.1859A.C 1991A.C 1 CFMDB F508del 13 14 R668C//G576A 21.61//1.73 c.2002C.T//c.1727G.C 2134C.T// 1859G.C 5 b CFMDB// rs1800098 c.1585-1G.A; 4 unknown 13 14 L671X c.2012delT 2143delT 27 IL17 various CF mutations 13 14 K684SfsX38 c.2051_2052delAAinsG 2183AA.G 10 IL17 various CF mutations 13 14 K684NfsX38 c.2052delA 2184delA 0 IL17 x 13 14 Q685TfsX4 c.2052_2053insA 2184insA 15 CFMDB various CF mutationsc , 1 unknown Table 2. Cont. Exon / intron (legacy) Exon / intron (Ensembl) Protein change SVM value cDNA (HGVS nomenclature) gDNA (cDNA +132 bp) Number of PL CF chromosomes Reference a Mutations in trans 13 14 L732X c.2195T.G 2327T.G 1 CFMDB F508del 14A 15 R851X c.2551C.T 2683C.T 3 CFMDB various CF mutations 14A 15 I864SfsX28 c.2589_2599del11bp 2721del11bp 2 CFMDB F508del; 2,3del21kb i14B i16 IVS16_Donor c.2657+2_2657+3insA 2789+2insA 1 CFMDB F508del i14B i16 IVS16_Donor c.2657+5G.A 2789+5G.A 0 IL17 unkown 15 17 Y919C 21.02 c.2756A.G 2888A.G 1 CFMDB unknown 15 17 H939HfsX27 c.2817_2820delTACTC 2949delTACTC 1 Novel unkown i15 i17 IVS17_Donor c.2908+3A.C 3040+3A.C 1 Novel F508del i16 i18 IVS18_Donor c.2988+1G.A 3120+1G.A 0 IL19 x 17A 19 I1023_V1024del c.3067_3072delATAGTG 3199del6 0 IL19 x i17A i19 IVS19 c.3140-26A.G 3272-26A.G 9 IL19 various CF mutations 17B 20 L1065R 21.90 c.3194T.G 3326T.G 1 CFMDB F508del 17B 20 Y1092X c.3276C.A 3408C.A 1 CFMDB R334W i18 i21 IVS21_Donor c.3468+2_3468+3insT 3600+2insT 11 CFMDB various CF mutationsd , 1 unknown 18 21 E1126EfsX7 c.3376_3379delGAAG 3508delGAAG 1 Novel F508del 19 22 R1158X c.3472C.T 3604C.T 2 CFMDB F508del; R553X 19 22 R1162X c.3484C.T 3616C.T 1 IL17 F508del 19 22 L1177SfsX15 c.3528delC 3659delC 4 IL17 various CF mutations 19 22 S1206X c.3617C.A 3749C.A 1 CFMDB R117C i19 i22 IVS22 c.3717+12191C.T 3849+10kbC.T 58 IL17 various CF mutations 20 23 G1244R 22.62 c.3730G.C 3862G.C 1 CFMDB F508del 20 23 S1251N 22.28 c.3752G.A 3884G.A 0 IL19 x 20 23 L1258FfsX7 c.3773_3774insT 3905insT 0 IL19 x 20 23 V1272VfsX28 c.3816_3817delGT 3944delGT 1 CFMDB c.1392+1G.A 20 23 W1282X c.3846G.A 3978G.A 9 IL19 various CF mutations 21 24 N1303K 22.62 c.3909C.G 4041C.G 18 IL19 various CF mutations 22 25 V1327X c.3979delG 4111delG 1 Novel F508del 22 25 S1347PfsX13 c.4035_4038dupCCTA c.4167dupCCTA 1 CFMDB 2,3del21kb 23 26 Q1382X c.4144C.T 4276C.T 1 CFMDB F508del 23 26 Q1412X c.4234C.T 4366C.T 2 CFMDB F508del; c.1116+2T.A i23 i26 IVS26_Donor c.4242+1G.T 4374+1G.T 1 CFMDB F508del Sequence changes of uncertain pathogenic effect, tentatively counted as mutations 6A 6 E217G 0.30 c.650A.G 782A.G 1 CFMDB; rs1219109046 unknown 7 8 R352Q 20.01 c.1055G.A 1187G.A 1 CFMDB; rs121908753 F508del 7 8 Q359R 0.33 c.1076A.G 1208A.G 1 CFMDB F508del i8 i9 IVS9 c.1210-12T5_1210- 34_35 (TG)12 1332-12Tn_- 34TGm 6 CFMDB F508del; 3x unknown i8 i9 IVS9 c.1210-12T5_1210- 34_35 (TG)13 1332-12Tn_- 34TGm 2 CFMDB 2143delT; 1x unknown i8 i9 IVS9 c.1210-12T8 1332-12Tn 1 Novel unknown 10 11 I506V 20.21 c.1516A.G 1648A.G 1 CFMDB; rs1800091 unknown 12 13 V562L 0.79 c.1684G.C 1816G.C 1 CFMDB; rs1800097 unknown 13 14 G723V 0.44 c.2168G.T 2300G.T 1 CFMDB; rs200531709 unknown 15 17 D924N 0.03 c.2770G.A 2902G.A 1 CFMDB; rs201759207 unknown patient with F508del on another allele) was not supported by the SVM value (+0.35); the patient was PS and had ambiguous chloride values (45, 64 and 83 mmol/L). Login to comment
137 Mutations a Poland Czechs Slovakia c Germany Lithuania W. Ukraine E. Hungary Romania c Bulgaria Serbia Greece Number of chromosomes 1476 1200 856 700 98 264 80 256 208 352 874 F508del 54.54 b 67.42 d 66.80 d 72.00 d 52.0 54.17 70.00 56.3 65.38 d 72.28 d 53.40 exon2,3del21kb (l.n.CFTRdele2,3_21kb) 4.47 5.75 2.26 1.2 f 2.0 4.17 5.00 1.6 NA 0 e 0.34 e c.3717+12191C.T (l.n.3849+10kbC.T) 3.93 1.67 e 4.28 1.00 e NA 0.76 0 0.4 e 1.44 0 e 0.11 e c.2012delT (l.n.2143delT) 1.83 0.92 1.10 0.71 0 1.14 0 0 e 0 0 e 0 e c.1585-1G.A (l.n.1717-1G.A) 1.83 0.33 e NA 0.86 0 0.38 1.25 0.4 0 0 e 0 e G542X 1.69 2.00 4.06 d 1.43 0 2.65 3.75 3.9 3.37 2.57 3.90 d R347P 1.57 0.92 1.10 1.57 0 0 1.25 NA 1.44 0 e 0.11 e N1303K 1.22 2.42 2.03 2.29 2.0 4.92 d 5.00 0.8 6.73 d 0 2.63 c.2052-2053insA (l.n.2184insA) 1.02 0.42 1.58 0.57 0 7.20 d 5.00 d 0 0.48 0.28 0 e R553X 0.95 0.50 0.90 2.29 4.2 d 0.38 0 NA 0 0 0 c.3468+223insT (l.n.3600+2insT) 0.75 0.25 NA 0 e 0 NA 0 NA 0 0 0 e c.2051-2052AA.G (l.n.2183AA.G) 0.68 0.08 NA 0.57 0 0.38 0 0.8 0 0 1.38 W1282X 0.61 0.58 0.50 0.71 1.0 2.27 0 2.3 d 0.96 0 0.67 c.3140-26A.G (l.n.3272-26A.G) 0.61 0.67 0.50 0.86 0 0.76 0 0.4 0 0 0.81 l.n.IVS8 T 5 _TG 12-13 0.54 NA NA NA 0 NA NA NA NA 0 NA R334W 0.41 0.25 NA 0.29 0 0.76 0 0.4 0 0.28 0.81 c.1766+1G.A (l.n.1898+1G.A) 0.41 1.42 d 0.50 0 0 1.14 0 NA 0 0 0.11 c.489+1G.T (l.n.621+1G.T) 0.34 0.42 NA 0.14 0 0.76 0 0.8 0 2.86 d 5.72 d R117H 0.34 NA NA 0.29 0 0 0 0.4 0 0 0.23 G551D 0.34 2.91 d 0.50 1.00 0 0 0 0 0 0 0.34 G314R 0.37 0 NA 0 0 0 0 NA 0 0 0 R668C 0.34 0 NA 0 0 0 0 NA 0 0 0 c.3528delC (l.n.3659delC) 0.27 0.17 NA 0.57 0 0 0 NA 0 0 0 c.164+1G.A (l.n.296+1G.A) 0.20 0.08 NA 0 0 0 0 NA 0 0 0 R851X 0.20 0.08 NA 0 0 0 0 NA 0 0 0 I336K 0.14 0.58 NA 0.45 0 0 0 NA 0 0 0 R1158X 0.14 0.08 NA 0 0 0 0 NA 0 0 1.03 E92K 0.14 0.08 NA 0 0 0.38 0 NA 0 0 0 R153I 0.14 0 NA 0 0 0 0 NA 0 0 0 c.579+3A.G (l.n.711+3A.G) 0.14 0.17 NA 0 0 0 0 NA 0 0 0.69 c.2589-2599del11bp (l.n.2721- 31del11bp) 0.14 0.08 NA 0 0 0.38 0 NA 0 0 0 I507del 0.14 0.08 NA 0.15 0 0 0 0 0 0.28 0.69 R117C 0.14 0.08 NA 0.15 0 0 0 NA 0 0 0.23 of mutation panels [20]), listed in Table 4, were compared to those reported for several Central and Southeastern European countries [21-29]. Login to comment

[hide] Mechanisms of CFTR functional variants that impair... PLoS Genet. 2014 Jul 17;10(7):e1004376. doi: 10.1371/journal.pgen.1004376. eCollection 2014 Jul. LaRusch J, Jung J, General IJ, Lewis MD, Park HW, Brand RE, Gelrud A, Anderson MA, Banks PA, Conwell D, Lawrence C, Romagnuolo J, Baillie J, Alkaade S, Cote G, Gardner TB, Amann ST, Slivka A, Sandhu B, Aloe A, Kienholz ML, Yadav D, Barmada MM, Bahar I, Lee MG, Whitcomb DC
Mechanisms of CFTR functional variants that impair regulated bicarbonate permeation and increase risk for pancreatitis but not for cystic fibrosis.
PLoS Genet. 2014 Jul 17;10(7):e1004376. doi: 10.1371/journal.pgen.1004376. eCollection 2014 Jul., [PMID:25033378]

Abstract [show]
CFTR is a dynamically regulated anion channel. Intracellular WNK1-SPAK activation causes CFTR to change permeability and conductance characteristics from a chloride-preferring to bicarbonate-preferring channel through unknown mechanisms. Two severe CFTR mutations (CFTRsev) cause complete loss of CFTR function and result in cystic fibrosis (CF), a severe genetic disorder affecting sweat glands, nasal sinuses, lungs, pancreas, liver, intestines, and male reproductive system. We hypothesize that those CFTR mutations that disrupt the WNK1-SPAK activation mechanisms cause a selective, bicarbonate defect in channel function (CFTRBD) affecting organs that utilize CFTR for bicarbonate secretion (e.g. the pancreas, nasal sinus, vas deferens) but do not cause typical CF. To understand the structural and functional requirements of the CFTR bicarbonate-preferring channel, we (a) screened 984 well-phenotyped pancreatitis cases for candidate CFTRBD mutations from among 81 previously described CFTR variants; (b) conducted electrophysiology studies on clones of variants found in pancreatitis but not CF; (c) computationally constructed a new, complete structural model of CFTR for molecular dynamics simulation of wild-type and mutant variants; and (d) tested the newly defined CFTRBD variants for disease in non-pancreas organs utilizing CFTR for bicarbonate secretion. Nine variants (CFTR R74Q, R75Q, R117H, R170H, L967S, L997F, D1152H, S1235R, and D1270N) not associated with typical CF were associated with pancreatitis (OR 1.5, p = 0.002). Clones expressed in HEK 293T cells had normal chloride but not bicarbonate permeability and conductance with WNK1-SPAK activation. Molecular dynamics simulations suggest physical restriction of the CFTR channel and altered dynamic channel regulation. Comparing pancreatitis patients and controls, CFTRBD increased risk for rhinosinusitis (OR 2.3, p<0.005) and male infertility (OR 395, p<<0.0001). WNK1-SPAK pathway-activated increases in CFTR bicarbonate permeability are altered by CFTRBD variants through multiple mechanisms. CFTRBD variants are associated with clinically significant disorders of the pancreas, sinuses, and male reproductive system.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
269 67 SNPs (125GtoC, 1716G.A, 1717-1G.A, 1898+1G.A, 2183AA.G, 2184delA, 2789+5G.A, 3120+1G.A, 3659delC, 3849+10kbC.T, 621+ 1G.T, 711+5G.A, A455E, D110H, D1152H, D1270N, D443Y, D579G, F1052V, F1074L, F508C, F508del, G1069R, G1244E, G1349D, G178R, G542X, G551D, G551S, I1131L/V, I148T, I336K/T, I507del, I807M, IVS8T5, K1180T, L1065P, L967S, L997F, M1V, M470V, M952I, M952T, N1303K, P67L, Q1463Q, R1070Q, R1162X, R117C, R117H, R170H, R258G, R297Q, R31C, R352Q, R553X, R668C, R74W, R75Q, S1235R, S1255P, S485R, S977F, T338I, T854T, V201M, W1282X) were multiplexed into 6 wells; 14 SNPs (S492F, S945L, R74Q, R560T, R1162L, G85E, I1027T, R334W, R347P, G576A, 711+1G.T, 1001+11C.T, P1290P, 3199del6) were ascertained separately via TaqMan Gene Expression Assays, with repeat confirmation of all positive results. Login to comment

[hide] Full-open and closed CFTR channels, with lateral t... Cell Mol Life Sci. 2015 Apr;72(7):1377-403. doi: 10.1007/s00018-014-1749-2. Epub 2014 Oct 7. Mornon JP, Hoffmann B, Jonic S, Lehn P, Callebaut I
Full-open and closed CFTR channels, with lateral tunnels from the cytoplasm and an alternative position of the F508 region, as revealed by molecular dynamics.
Cell Mol Life Sci. 2015 Apr;72(7):1377-403. doi: 10.1007/s00018-014-1749-2. Epub 2014 Oct 7., [PMID:25287046]

Abstract [show]
In absence of experimental 3D structures, several homology models, based on ABC exporter 3D structures, have provided significant insights into the molecular mechanisms underlying the function of the cystic fibrosis transmembrane conductance regulator (CFTR) protein, a chloride channel whose defects are associated with cystic fibrosis (CF). Until now, these models, however, did not furnished much insights into the continuous way that ions could follow from the cytosol to the extracellular milieu in the open form of the channel. Here, we have built a refined model of CFTR, based on the outward-facing Sav1866 experimental 3D structure and integrating the evolutionary and structural information available today. Molecular dynamics simulations revealed significant conformational changes, resulting in a full-open channel, accessible from the cytosol through lateral tunnels displayed in the long intracellular loops (ICLs). At the same time, the region of nucleotide-binding domain 1 in contact with one of the ICLs and carrying amino acid F508, the deletion of which is the most common CF-causing mutation, was found to adopt an alternative but stable position. Then, in a second step, this first stable full-open conformation evolved toward another stable state, in which only a limited displacement of the upper part of the transmembrane helices leads to a closure of the channel, in a conformation very close to that adopted by the Atm1 ABC exporter, in an inward-facing conformation. These models, supported by experimental data, provide significant new insights into the CFTR structure-function relationships and into the possible impact of CF-causing mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
346 First, almost all CF-causing mutations involving residues located in the MSD transmembrane segments are encountered in MSD1 and generally concern positions lining the pore (G85E, E92K, D110H, P205S, R334W, I336K, T338I, S341P, R347H/R347P, and R352Q) (Fig. 7a). Login to comment

[hide] Improving newborn screening for cystic fibrosis us... Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209. Baker MW, Atkins AE, Cordovado SK, Hendrix M, Earley MC, Farrell PM
Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study.
Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209., [PMID:25674778]

Abstract [show]
Purpose:Many regions have implemented newborn screening (NBS) for cystic fibrosis (CF) using a limited panel of cystic fibrosis transmembrane regulator (CFTR) mutations after immunoreactive trypsinogen (IRT) analysis. We sought to assess the feasibility of further improving the screening using next-generation sequencing (NGS) technology.Methods:An NGS assay was used to detect 162 CFTR mutations/variants characterized by the CFTR2 project. We used 67 dried blood spots (DBSs) containing 48 distinct CFTR mutations to validate the assay. NGS assay was retrospectively performed on 165 CF screen-positive samples with one CFTR mutation.Results:The NGS assay was successfully performed using DNA isolated from DBSs, and it correctly detected all CFTR mutations in the validation. Among 165 screen-positive infants with one CFTR mutation, no additional disease-causing mutation was identified in 151 samples consistent with normal sweat tests. Five infants had a CF-causing mutation that was not included in this panel, and nine with two CF-causing mutations were identified.Conclusion:The NGS assay was 100% concordant with traditional methods. Retrospective analysis results indicate an IRT/NGS screening algorithm would enable high sensitivity, better specificity and positive predictive value (PPV). This study lays the foundation for prospective studies and for introducing NGS in NBS laboratories.Genet Med advance online publication 12 February 2015Genetics in Medicine (2015); doi:10.1038/gim.2014.209.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
15 Correspondence: Mei W. Baker (mwbaker@wisc.edu) Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study Mei W. Baker, MD1,2 , Anne E. Atkins, MPH2 , Suzanne K. Cordovado, PhD3 , Miyono Hendrix, MS3 , Marie C. Earley, PhD3 and Philip M. Farrell, MD, PhD1,4 Table 1ߒ CF-causing or varying consequences mutations in the MiSeqDx IUO Cystic Fibrosis System c.1521_1523delCTT (F508del) c.2875delG (3007delG) c.54-5940_273ߙ+ߙ10250del21kb (CFTRdele2,3) c.3909C>G (N1303K) c.3752G>A (S1251N) Mutations that cause CF when combined with another CF-causing mutation c.1624G>T (G542X) c.2988ߙ+ߙ1G>A (3120ߙ+ߙ1G->A) c.3964-78_4242ߙ+ߙ577del (CFTRdele22,23) c.613C>T (P205S) c.1021T>C (S341P) c.948delT (1078delT) c.2988G>A (3120G->A) c.328G>C (D110H) c.200C>T (P67L) c.1397C>A (S466X(C>A)) c.1022_1023insTC (1154insTC) c.2989-1G>A (3121-1G->A) c.3310G>T (E1104X) c.3937C>T (Q1313X) c.1397C>G (S466X(C>G)) c.1081delT (1213delT) c.3140-26A>G (3272-26A->G) c.1753G>T (E585X) c.658C>T (Q220X) c.1466C>A (S489X) c.1116ߙ+ߙ1G>A (1248ߙ+ߙ1G->A) c.3528delC (3659delC) c.178G>T (E60X) c.115C>T (Q39X) c.1475C>T (S492F) c.1127_1128insA (1259insA) c.3659delC (3791delC) c.2464G>T (E822X) c.1477C>T (Q493X) c.1646G>A (S549N) c.1209ߙ+ߙ1G>A (1341ߙ+ߙ1G->A) c.3717ߙ+ߙ12191C>T (3849ߙ+ߙ10kbC->T) c.2491G>T (E831X) c.1573C>T (Q525X) c.1645A>C (S549R) c.1329_1330insAGAT (1461ins4) c.3744delA (3876delA) c.274G>A (E92K) c.1654C>T (Q552X) c.1647T>G (S549R) c.1393-1G>A (1525-1G->A) c.3773_3774insT (3905insT) c.274G>T (E92X) c.2668C>T (Q890X) c.2834C>T (S945L) c.1418delG (1548delG) c.262_263delTT (394delTT) c.3731G>A (G1244E) c.292C>T (Q98X) c.1013C>T (T338I) c.1545_1546delTA (1677delTA) c.3873ߙ+ߙ1G>A (4005ߙ+ߙ1G->A) c.532G>A (G178R) c.3196C>T (R1066C) c.1558G>T (V520F) c.1585-1G>A (1717-1G->A) c.3884_3885insT (4016insT) c.988G>T (G330X) c.3197G>A (R1066H) c.3266G>A (W1089X) c.1585-8G>A (1717-8G->A) c.273ߙ+ߙ1G>A (405ߙ+ߙ1G->A) c.1652G>A (G551D) c.3472C>T (R1158X) c.3611G>A (W1204X) c.1679ߙ+ߙ1.6kbA>G (1811ߙ+ߙ1.6kbA->G) c.274-1G>A (406-1G->A) c.254G>A (G85E) c.3484C>T (R1162X) c.3612G>A (W1204X) c.1680-1G>A (1812-1G->A) c.4077_4080delTGTTinsAA (4209TGTT->AA) c.2908G>C (G970R) c.349C>T (R117C) c.3846G>A (W1282X) c.1766ߙ+ߙ1G>A (1898ߙ+ߙ1G->A) c.4251delA (4382delA) c.595C>T (H199Y) c.1000C>T (R334W) c.1202G>A (W401X) c.1766ߙ+ߙ3A>G (1898ߙ+ߙ 3A->G) c.325_327delTATinsG (457TAT->G) c.1007T>A (I336K) c.1040G>A (R347H) c.1203G>A (W401X) c.2012delT (2143delT) c.442delA (574delA) c.1519_1521delATC (I507del) c.1040G>C (R347P) c.2537G>A (W846X) c.2051_2052delAAinsG (2183AA->G) c.489ߙ+ߙ1G>T (621ߙ+ߙ 1G->T) c.2128A>T (K710X) c.1055G>A (R352Q) c.3276C>A (Y1092X (C>A)) c.2052delA (2184delA) c.531delT (663delT) c.3194T>C (L1065P) c.1657C>T (R553X) c.3276C>G (Y1092X (C>G)) c.2052_2053insA (2184insA) c.579ߙ+ߙ1G>T (711ߙ+ߙ 1G->T) c.3230T>C (L1077P) c.1679G>A (R560K) c.366T>A (Y122X) c.2175_2176insA (2307insA) c.579ߙ+ߙ3A>G (711ߙ+ߙ 3A->G) c.617T>G (L206W) c.1679G>C (R560T) - c.2215delG (2347delG) c.579ߙ+ߙ5G>A (711ߙ+ߙ 5G->A) c.1400T>C (L467P) c.2125C>T (R709X) - c.2453delT (2585delT) c.580-1G>T (712-1G->T) c.2195T>G (L732X) c.223C>T (R75X) - c.2490ߙ+ߙ1G>A (2622ߙ+ߙ1G->A) c.720_741delAGGGAG AATGATGATGAAGTAC (852del22) c.2780T>C (L927P) c.2290C>T (R764X) - c.2583delT (2711delT) c.1364C>A (A455E) c.3302T>A (M1101K) c.2551C>T (R851X) - c.2657ߙ+ߙ5G>A (2789ߙ+ߙ5G->A) c.1675G>A (A559T) c.1A>G (M1V) c.3587C>G (S1196X) - Mutations/variants that were validated in this study are in bold. CF, cystic fibrosis. Table 1ߒ Continued on next page reduce carrier detection and potentially improve the positive predictive value (PPV), the NBS goals of equity and the highest possible sensitivity become more difficult to achieve. Login to comment

[hide] The improvement of the best practice guidelines fo... Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99. Girardet A, Viart V, Plaza S, Daina G, De Rycke M, Des Georges M, Fiorentino F, Harton G, Ishmukhametova A, Navarro J, Raynal C, Renwick P, Saguet F, Schwarz M, SenGupta S, Tzetis M, Roux AF, Claustres M
The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus.
Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99., [PMID:26014425]

Abstract [show]
Cystic fibrosis (CF) is one of the most common indications for preimplantation genetic diagnosis (PGD) for single gene disorders, giving couples the opportunity to conceive unaffected children without having to consider termination of pregnancy. However, there are no available standardized protocols, so that each center has to develop its own diagnostic strategies and procedures. Furthermore, reproductive decisions are complicated by the diversity of disease-causing variants in the CFTR (cystic fibrosis transmembrane conductance regulator) gene and the complexity of correlations between genotypes and associated phenotypes, so that attitudes and practices toward the risks for future offspring can vary greatly between countries. On behalf of the EuroGentest Network, eighteen experts in PGD and/or molecular diagnosis of CF from seven countries attended a workshop held in Montpellier, France, on 14 December 2011. Building on the best practice guidelines for amplification-based PGD established by ESHRE (European Society of Human Reproduction and Embryology), the goal of this meeting was to formulate specific guidelines for CF-PGD in order to contribute to a better harmonization of practices across Europe. Different topics were covered including variant nomenclature, inclusion criteria, genetic counseling, PGD strategy and reporting of results. The recommendations are summarized here, and updated information on the clinical significance of CFTR variants and associated phenotypes is presented.European Journal of Human Genetics advance online publication, 27 May 2015; doi:10.1038/ejhg.2015.99.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
79 (unknown) Q39X c.115C4T p.Gln39* P67L c.200C4T p.Pro67Leu R75X c.223C4T p.Arg75* 405+1G4A c.273+1G4A 406-1G4A c.274-1G4A E92X c.274G4T p.Glu92* E92K c.274G4A p.Glu92Lys Q98X c.292C4T p.Gln98* 457TAT4G c.325_327delTATinsG p.Tyr109Glyfs*4 D110H c.328G4C p.Asp110His R117C c.349C4T p.Arg117Cys Y122X c.366 T4A p.Tyr122* 574delA c.442delA p.Ile148Leufs*5 444delA c.313delA p.Ile105Serfs*2 663delT c.531delT p.Ile177Metfs*12 G178R c.532G4A p.Gly178Arg 711+3 A4G c.579+3 A4G 711+5G4A c.579+5G4A 712-1G4T c.580-1G4T H199Y c.595C4T p.His199Tyr P205S c.613C4T p.Pro205Ser L206W c.617 T4G p.Leu206Trp Q220X c.658C4T p.Gln220* 852del22 c.720_741delAGGGAGAAT GATGATGAAGTAC p.Gly241Glufs*13 1078delT c.948delT p.Phe316Leufs*12 G330X c.988G4T p.Gly330* Table 1 (Continued ) HGVS nomenclature Legacy name cDNA nucleotide name Protein name R334W c.1000C4T p.Arg334Trp I336K c.1007 T4A p.Ile336Lys T338I c.1013C4T p.Thr338Ile 1154insTC c.1021_1022dupTC p.Phe342Hisfs*28 S341P c.1021 T4C p.Ser341Pro R347H c.1040G4A p.Arg347His 1213delT c.1081delT p.Trp361Glyfs*8 1248+1G4A c.1116+1G4A 1259insA c.1130dupA p.Gln378Alafs*4 W401X(TAG) c.1202G4A p.Trp401* W401X(TGA) c.1203G4A p.Trp401* 1341+1G4A c.1209+1G4A 1461ins4 c.1329_1330insAGAT p.Ile444Argfs*3 1525-1G4A c.1393-1G4A S466X c.1397C4A or c.1397C4G p.Ser466* L467P c.1400 T4C p.Leu467Pro S489X c.1466C4A p.Ser489* S492F c.1475C4T p.Ser492Phe 1677delTA c.1545_1546delTA p.Tyr515* V520F c.1558G4T p.Val520Phe 1717-1G4A c.1585-1G4A 1717-8G4A c.1585-8G4A S549R c.1645 A4C p.Ser549Arg S549N c.1646G4A p.Ser549Asn S549R c.1647 T4G p.Ser549Arg Q552X c.1654C4T p.Gln552* A559T c.1675G4A p.Ala559Thr 1811+1.6kbA4G c.1680-886 A4G 1812-1G4A c.1680-1G4A R560K c.1679G4A p.Arg560Lys E585X c.1753G4T p.Glu585* 1898+3 A4G c.1766+3 A4G 2143delT c.2012delT p.Leu671* 2184insA c.2052_2053insA p.Gln685Thrfs*4 2184delA c.2052delA p.Lys684Asnfs*38 R709X c.2125C4T p.Arg709* K710X c.2128 A4T p.Lys710* 2307insA c.2175dupA p.Glu726Argfs*4 L732X c.2195 T4G p.Leu732* 2347delG c.2215delG p.Val739Tyrfs*16 R764X c.2290C4T p.Arg764* 2585delT c.2453delT p.Leu818Trpfs*3 E822X c.2464G4T p.Glu822* 2622+1G4A c.2490+1G4A E831X c.2491G4T p.Glu831* W846X c.2537G4A p.Trp846* W846X (2670TGG4TGA) c.2538G4A p.Trp846* R851X c.2551C4T p.Arg851* 2711delT c.2583delT p.Phe861Leufs*3 S945L c.2834C4T p.Ser945Leu 2789+2insA c.2657+2_2657+3insA Q890X c.2668C4T p.Gln890* L927P c.2780 T4C p.Leu927Pro 3007delG c.2875delG p.Ala959Hisfs*9 G970R c.2908G4C p.Gly970Arg 3120G4A c.2988G4A function variants that cause CF disease when paired together; (ii) variants that retain residual CFTR function and are compatible with milder phenotypes such as CFTR-RD; (iii) variants with no clinical consequences; and (iv) variants of unproven or uncertain clinical relevance. Login to comment

[hide] Cystic Fibrosis Transmembrane Conductance Regulato... J Biol Chem. 2015 Sep 18;290(38):22891-906. doi: 10.1074/jbc.M115.665125. Epub 2015 Jul 30. Corradi V, Vergani P, Tieleman DP
Cystic Fibrosis Transmembrane Conductance Regulator (CFTR): CLOSED AND OPEN STATE CHANNEL MODELS.
J Biol Chem. 2015 Sep 18;290(38):22891-906. doi: 10.1074/jbc.M115.665125. Epub 2015 Jul 30., [PMID:26229102]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) is a member of the ATP-binding cassette (ABC) transporter superfamily. CFTR controls the flow of anions through the apical membrane of epithelia. Dysfunctional CFTR causes the common lethal genetic disease cystic fibrosis. Transitions between open and closed states of CFTR are regulated by ATP binding and hydrolysis on the cytosolic nucleotide binding domains, which are coupled with the transmembrane (TM) domains forming the pathway for anion permeation. Lack of structural data hampers a global understanding of CFTR and thus the development of "rational" approaches directly targeting defective CFTR. In this work, we explored possible conformational states of the CFTR gating cycle by means of homology modeling. As templates, we used structures of homologous ABC transporters, namely TM(287-288), ABC-B10, McjD, and Sav1866. In the light of published experimental results, structural analysis of the transmembrane cavity suggests that the TM(287-288)-based CFTR model could correspond to a commonly occupied closed state, whereas the McjD-based model could represent an open state. The models capture the important role played by Phe-337 as a filter/gating residue and provide structural information on the conformational transition from closed to open channel.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
139 In addition, I336K and T338I are known among CFTR disease-causing mutations (82, 83). Login to comment