ABCMdb

ABCC7 p.Ile336Lys

II-III (maturation defect, gating defect) <a href="https://www.ncbi.nlm.nih.gov/pubmed/26823392">Veit et al.</a>
admin on 2016-08-19 15:16:22

Publications

PMID: 10950058 [PubMed] Ockenga J et al: "Mutations of the cystic fibrosis gene, but not cationic trypsinogen gene, are associated with recurrent or chronic idiopathic pancreatitis."

No. Sentence Comment

8 Three patients (15.0%) had a cystic fibrosis (CF) mutation on one chromosome (⌬F508, I336K, Y1092X), which is known to cause phenotypical severe cystic fibrosis. Login to comment
10 In addition, two possibly predisposing CFTR variants (R75Q, 1716G3A) were detected on four patients, one of these being a compound heterozygous for the missense mutation I336K and R75Q. Login to comment
11 No other family member (maternal I336K; paternal R75Q; sister I1336K) developed pancreatitis. Login to comment
54 Finally, we tested all samples for the presence of mutations or variants R75Q, I336K, R347H, IVS8-5T (5T allele), 1716G3A, 2143delT, 2789ϩ5G3A, Y1092X, 3272-26A3G, D1152H, and CFTRdel2,3 (21kb) by PCR and restriction enzyme digestion with the respective enzymes (for mutation references, see http://www.genet. Login to comment
77 RESULTS CFTR Screening In 3/20 (15.0%, CI: 5.2-36.0%) patients a CFTR mutation (⌬F508, I336K, Y1092X) known to cause a phenotypical severe clinical course of cystic fibrosis was detected (p Ͻ 0.05 compared to expected frequency of 4%). Login to comment
78 In four patients two potentially predisposing variants, 1716G3A and R75Q, were also present, one of these being compound heterozygous for I336K and R75Q, whereas the other two carried only R75Q or 1716G3A. Login to comment
89 Characteristics of the Study Population Patient Gender CFTR Genotype PolyT Genotype Age at Study, Yr Age at Onset of Disease, Yr Inclusion Criteria Pseudomonas Antibody* Exocrine Insufficiency† Morphological Changes‡ S. K. F I336K/R75Q 7T/7T 34 26 CP 2.44 Yes Mild M. T. M Y1092X/wt 7T/7T 34 30 CP 1.06 Yes Moderate K. M. M R75Q/wt 7T/7T 24 19 RAP 0.46 No Mild L. A. F 1716G3A/wt 7T/7T 27 26 RAP 0.45 No Normal C. B. F ⌬F508/wt 7T/9T 40 38 CP 0.84 No Mild W. O. M 1716G3A/wt 7T/7T 31 29 RAP 0.86 No Normal L. M. F wt/wt 5T/7T 37 27 CP 1.25 Yes Moderate H. K. F wt/wt 7T/7T 27 20 CP 0.84 Yes Mild K. A. M wt/wt 7T/7T 24 19 CP 0.57 Yes Mild H. K. M wt/wt 7T/7T 23 19 CP 0.58 Yes Severe E. H. M wt/wt 7T/7T 25 20 RAP 1.36 No Normal M. K. F wt/wt 7T/7T 35 30 CP 0.55 No Moderate W. S. M wt/wt 7T/7T 19 19 RAP 0.58 No Normal L. D. F wt/wt 7T/7T 33 30 CP 1.07 Yes Severe S. Login to comment
104 Family Study of CFTR In the compound heterozygous patient S.K., we investigated the parents and the sister of this patient for the presence of the missense substitutions R75Q and I336K. Login to comment
106 DNA analysis determined the mutation I336K in patient S.K. and her sister; the mutation had been inherited from their mother. Login to comment
124 Results of Sweat Test, Intestinal Current Measurement Test, and Anamnestic Features of Patients With Idiopathic Recurrent Acute or Chronic Pancreatic Disease and an Abnormal CFTR Allele Patient CFTR Genotype PolyT Genotype Sweat Chloride (mmol/L) Intestinal Current Measurement (␮A/cm2 )* Anamnestic Features Known to be Associated With Atypical CF S. K. I336K/R75Q 7T/7T 26 50 Nasal polyps M. T. Y1092X/wt 7T/7T 42 27 K. M. R75Q/wt 7T/7T 61 31 L. A. Login to comment
136 Restriction enzyme analysis of exon 7 with SspI detected an atypical band at 410 bp (panel A), suggesting a heterozygosity for I336K. Login to comment
137 Further direct sequence analysis (panel B) showed an exchange of thymidin (T) to adenine (A) at position 1139, confirming the presence of mutation I336K (37). Login to comment
151 In addition, we detected the mutations I336K and Y1092X, which have not been described before, in patients with idiopathic pancreatitis. Login to comment
155 The missense substitution R75Q was found in two unrelated pancreatitis patients (10%), one of them compound heterozygous for R75Q/I336K. Login to comment
182 The fact that the paternal CFTR allele from our patient S.K. harboring the R75Q substitution is different from the paternal CFTR allele of her sister-who, like her mother, carries the I336K mutation without having developed pancreatitis-supports this theory. Login to comment

PMID: 10952679 [PubMed] Mall M et al: "Effect of genistein on native epithelial tissue from normal individuals and CF patients and on ion channels expressed in Xenopus oocytes."

No. Sentence Comment

30 In all CF patients from whom rectal biopsies were studied DNA analysis was carried out for the following CFTR mutations: DF508; R117H and S108F in exon 4; R347P, R347H, I336K and T338I in exon 7; S549N, G551D, R553X, G542X, Q552X, 1717-1 G?A in exon 11; W1282X and 3905insT in exon 20; N1303K in exon 21 and 3849+10kB C?T in intron 19. Login to comment

PMID: 11933191 [PubMed] Ravnik-Glavac M et al: "DHPLC screening of cystic fibrosis gene mutations."

No. Sentence Comment

42 The following mutations have been studied: exon 3: W57G, R74W, R75Q, G85E, 394delTT, 405+ 1G>A; exon 4: E92X, P99L, 441delA, 444delA, 457TAT>G, D110H, R117C, R117H, A120T, 541delC, 544delCA, Q151X, 621+1G>T, 662- 2A>C; exon 7: 1078delT, F331L, R334W, I336K, R347C, R347P, A349V, R352Q, 1221delCT; exon 10: S492F, Q493X, 1609delCA, deltaI507, deltaF508; exon 11: G542X, S549N, G551D, R553X, A559T, R560K, R560T; exon 13: K716X, Q685X, G628R, L719X; exon 17b: H1054D, G1061R, 3320ins5, R1066H, R1066L, R1070Q, 3359delCT, L1077P, H1085R, Y1092X; exon 19: R1162X, 3659delC, 3662delA, 3667del4, 3737delA, I1234V, S1235R, 3849G>A; exon 20: 3860ins31,S1255X,3898insC,3905insT,D1270N, W1282X, Q1291R; and exon 21: N1303H, N1303K, W1316X. Login to comment

PMID: 11938439 [PubMed] Audrezet MP et al: "Determination of the relative contribution of three genes-the cystic fibrosis transmembrane conductance regulator gene, the cationic trypsinogen gene, and the pancreatic secretory trypsin inhibitor gene-to the etiology of idiopathic chronic pancreatitis."

No. Sentence Comment

93 Thus, as in the case of the two previously reported compound heterozygotes, F508del/R117H4 and I336K/R75Q,32 none of our four compound heterozygotes could be described as carrying two `severe' CFTR mutations. Login to comment

PMID: 12151438 [PubMed] Wang Z et al: "Analysis by mass spectrometry of 100 cystic fibrosis gene mutations in 92 patients with congenital bilateral absence of the vas deferens."

No. Sentence Comment

20 Given the frequency of CF mutations, especially in the Caucasian population ( in 25), and the common request by CBAVD men to sire their own offspring by using surgical Table I. The 100 most common cystic fibrosis mutations listed by exon Mutationa Exonb Frequency (%)c G85E 3 0.1 394delTT 3 Swedish E60X 3 Belgium R75X 3 405ϩ1G→A Int 3 R117H 4 0.30 Y122X 4 French 457TAT→G 4 Austria I148T 4 Canada (French Canadian) 574delA 4 444delA 4 R117L 4 621ϩ1G→T Int 4 0.72 711ϩ1G→T Int 5 Ͼ0.1 712-1G→T Int 5 711ϩ5G→A Int 5 Italy (Caucasian) L206W 6a R347P 7 0.24 1078delT 7 Ͼ0.1 R334W 7 Ͼ0.1 1154InsTC 7 T338I 7 Italy R347H 7 Turkey Q359K/T360K 7 Israel (Georgian Jews) I336K 7 R352Q 7 G330X 7 S364P 7 A455E 9 0.20 I507 10 0.21 F508 10 66.02 1609delCA 10 Spain (Caucasian) V520F 10 Q493X 10 C524X 10 G480C 10 Q493R 10 1717-1G→A Int 10 0.58 R553X 11 0.73 G551D 11 1.64 G542X 11 2.42 R560T 11 Ͼ0.1 S549N 11 Q552X 11 Italy S549I 11 Israel (Arabs) A559T 11 African American R553G 11 R560K 11 1812-1G→A Int 11 A561E 12 E585X 12 Y563D 12 Y563N 12 1898ϩ1G→A Int 12 0.22 1898ϩ1G→C Int 12 2183AA→G 13 Italian 2184delA 13 Ͻ0.1 K710X 13 2143delT 13 Moscow (Russian) 2184InsA 13 1949del84 13 Spain (Spanish) 2176InsC 13 2043delG 13 2307insA 13 2789ϩ5G→A Int 14b Ͼ0.1 2869insG 15 S945L 15 Q890X 15 3120G→A 16 2067 Table I. continued Mutationa Exonb Frequency (%)c 3120ϩ1G→A Int 16 African American 3272-26A→G Int 17a R1066C 17b Portugal (Portugese) L1077P 17b R1070Q 17b Bulgarian W1089X 17b M1101K 17b Canada (Hutterite) R1070P 17b R1162X 19 0.29 3659delC 19 Ͼ0.1 3849G→A 19 3662delA 19 3791delC 19 3821delT 19 Russian Q1238X 19 S1235R 19 France, South S1196X 19 K1177R 19 3849ϩ10kbC→T Int 19 0.24 3849ϩ4A→G Int 19 W1282X 20 1.22 S1251N 20 Dutch, Belgian 3905insT 20 Swiss, Acadian, Amish G1244E 20 R1283M 20 Welsh W1282R 20 D1270N 20 S1255X 20 African American 4005ϩ1G→A Int 20 N1303K 21 1.34 W1316X 21 aMutations were chosen according to their frequencies (Cystic Fibrosis Genetic Analysis Consortium, 1994; Zielenski and Tsui, 1995; Estivill et al., 1997). Login to comment

PMID: 12404105 [PubMed] Schurmann M et al: "CFTR gene mutations in sarcoidosis."

No. Sentence Comment

30 A list of the corresponding mutations with detailed frequencies in the German population is given in ref. 12 Finally, we tested all 54 samples for the presence of I336K, Y1092X, 3272-26A?G and CFTRdel2,3 (21 kb) by PCR and restriction enzyme digestion with the respective enzymes (for mutation references, refer to the Cystic Fibrosis Genetic Analysis Consortium database). Login to comment

PMID: 14586256 [PubMed] Reboul MP et al: "Isolated idiopathic chronic pancreatitis associated with a compound heterozygosity for two mutations of the CFTR gene."

No. Sentence Comment

80 Patient CFTR no PolyT genotype Sex genotype Age (years) Sweat chloride (mmol/L) Anamnestic features known to be associated with atypical CF Reference 1 F508del/R117H 9T/7T M 45 29 CBAVD [4] 2 N1303K/R117H 9T/7T F n.a. 37 bronchiectasis, sinusitis, positive NPD [5] 3 R1162X/2789+5G>A 7T/7T F n.a. 108 chronic cough [5] 4 I336K/R75Q 7T/7T F 26 26 nasal polyposis [7] 5 F508del/L997F 9T/7T M 17 24 none [11] 6 3849+10kbC>T/3878delG 7T/7T M 14 n.a. none [11] 7 S1235R/L997F 5T/7T M 27 25 none [11] 8 F508del/R117H n.a. M 45 29 CBAVD, smooth P. aeruginosa [12] 9 F508del/I1027T n.a. F 32 59 none [12] 10 F508del/D1152H n.a. M 8 62 none [12] 11 F508del/D1152H n.a. F 15 32 none [12] 12 F508del/P574H n.a. F 26 81 sinus surgery, S. aureus, S. maltophilia [12] 13 F508del/3120G>A n.a. F 40 n.a. n.a. [12] 14 F508del/G1069R n.a. M 16 n.a. n.a. [12] 15 G542X/S1235R 7T/7T M 35 15 none [this study] n.a.: not available. Login to comment

PMID: 15880796 [PubMed] Kerem E et al: "Pharmacological induction of CFTR function in patients with cystic fibrosis: mutation-specific therapy."

No. Sentence Comment

58 C-D565G II DF508 D1507 S549R S549I S549N S549R S945D S945L H1054D G1061R L1065P R1066C R1066M L1077P H1085R N1303K G85E III G551D S492F V520F R553G R560T R560S Y569D IV R117H, R117C, R117P, R117L D1152H, L88S, G91R, E92K, Q98R, P205S, L206W, L227R, F311L, G314E, R334W, R334Q, I336K, T338I, L346P, R347C, R347H, R347L, R347P, L927P, R1070W, R1070Q V 3849 þ 10 kb C ! Login to comment

PMID: 16202790 [PubMed] Sontag MK et al: "Two-tiered immunoreactive trypsinogen-based newborn screening for cystic fibrosis in Colorado: screening efficacy and diagnostic outcomes."

No. Sentence Comment

86 The pancreatic sufficient mutations identified were 18981 5G>T, 278915G>A, A455E, G551S, G85E, I336K, P67L, R117C, R117H, R334W, R347P. Login to comment

PMID: 17914215 [PubMed] Van Biervliet S et al: "Serum zinc concentrations in cystic fibrosis patients aged above 4 years: a cross-sectional evaluation."

No. Sentence Comment

73 Table 1 Genotype of the 101 CF Patients: Details of the CF Mutations and Classification into Two Groups Genotype Groups Genotype No of Patients A ΔF508/ΔF508 47 ΔF508/E60X 1 ΔF508/G542X 7 ΔF508/N1303K 3 ΔF508/Q493X 1 ΔF508/1717-1G→A 1 ΔF508/Y1092X 1 ΔF508/394delTT 1 ΔF508/R785X 1 ΔF508/R553X 1 ΔF508/ΔI507 1 394delTT/394delTT 1 N1303K/N1303K 2 B ΔF508/3849+10kbC-T 1 ΔF508/306ΔTAGA 1 ΔF508/S1251N 8 ΔF508/L927P 1 G458V/1717-1G→A 1 ΔF508/I336K 2 G542X/622-2 A→C 1 ΔF508/G970R 3 ΔF508/3272-26A→G 2 ΔF508/R117H 2 ΔF508/2789+5G→A 2 1717-1G->A/S1251N 1 G542X/G970R 1 394delTT/Y913C 1 N1303K/deletion exon 19 1 Unidentified/unidentified 2 3600+2insTA/2005 del T 1 ΔF508/1898+1G→A 1 Deletion exon 2/del exon 2 1 There was no difference according to gender or age. Login to comment

PMID: 19318346 [PubMed] Goubau C et al: "Phenotypic characterisation of patients with intermediate sweat chloride values: towards validation of the European diagnostic algorithm for cystic fibrosis."

No. Sentence Comment

60 Table 2 CFTR mutations in the patient subgroups CF-PS CFTR dysfunction CF unlikely Genotype Subjects (n) Genotype Subjects (n) Genotype Subjects (n) F508del*/Not found 12 F508del*/3849+10 kb(C.T){ 11 Not found/Not found 39 Not found/Not found 10 F508del*/R117H{ 7 F508del*/Not found 4 F508del*/3849+10 kb(C.T){ 7 F508del*/Not found 7 IVS8-5T{/Not found 1 F508del*/R347P{ 5 Not found/Not found 5 S1235E/E528E 1 F508del*/R117H{ 4 F508del*/D1152H{ 4 No mutation analysis 1 F508del*/2789+5G.A{ 4 F508del*/IVS8-5T{ 4 Total 46 F508del*/S945L* 3 F508del*/S945L* 2 2789+5G.A{/Not found 3 W1282X*/IVS8-5T{ 2 F508del*/3272-26 A.G{ 2 F508del*/R1070W{ 1 F508del*/A455E{ 2 F508del*/L159S 1 F508del*/711+5G.A 2 F508del*/T1246I 1 F508del*/2789+5G.A 2 F508del*/L165S 1 G542X*/R334W{ 2 W1282X*/D1152H{ 1 F508del*/R334W{ 2 R1162X*/D1152H{ 1 R347P{/Not found 2 R347Hu/D1152H{ 1 F508del*/2116delCTAA 1 R553X*/R117H{ 1 F508del*/IVS8-5T{ 1 3659delC*/R117H{ 1 F508del*/D1152H{ 1 3849+10kb(C.T){/G551R 1 F508del*/711+3A.G 1 R1162X*/3849+10 kb(C.T){ 1 F508del*/L206W{ 1 2789+5G.A{/Not found 1 F508del*/I336K{ 1 G542X*/T854A 1 F508del*/G970D 1 R553X*/Q1463H 1 F508del*/L159S 1 S1235R/R668C 1 F508del*/R751L 1 2789+5G.A{/S977F 1 F508del*/E656X 1 No mutation analysis 1 F508del*/4015delA 1 Total 59 F508del*/Y913S 1 F508del*/L165S 1 F508del*/2143delT 1 G551D*/I336K{ 1 G551D*/3272-26A.G{ 1 G551D*/711+3A.G 1 R553X*/4005+2T.C 1 R553X*/E92K{ 1 G542X*/L206W{ 1 W1282X*/I336K 1 R1162X*/3849+10 kb(C.T){ 1 R1162X*/2789+5G.A{ 1 574delA*/3141del9 1 9890X/I105N 1 R334W{/R1070Q{ 1 3272-26A.G{/4218insT 1 3272-26A.G{/L165S 1 711+3A.G/G1244E 1 R352Q/1812-1G.A 1 F1052V/IVS8-5T{ 1 R74W/D1270N 1 1898-3G.A/1898-3G.A 1 1717-1G.A*/R334W{ 1 3659delC*/Not found 1 394delTT/Not found 1 R1162X*/Not found 1 R553X*/Not found 1 R117H{/Not found 1 G85E*/Not found 1 3849+10k(C.T){/Not found 1 Total 103 *Mutation class I, II or III. Login to comment

PMID: 20463155 [PubMed] Giraud S et al: "Geosmithia argillacea: an emerging pathogen in patients with cystic fibrosis."

No. Sentence Comment

108 Clinical characteristics of CF patients colonized by Geosmithia argillacea Patient Hospital location Sexa Age (yr) at CF diagnosis Relevant CFTR mutation Age (yr) at first isolation of Geosmithia argillacea A Angers F 14 F508del/C.622-248-4del20pb 23 B Angers M Birth F508del/F508del 8 C Giens F 2 F508del/F508del 7 D Giens M Birth F508del/F508del 6 E Giens M 20 F508del/E92K 36 F Giens M 4 F508del/F508del 17 G Rouen F Birth F508del/F508del 13 H Rouen F 14 F508del/I336K 48 Ib Giens M Birth F508del/F508del 12 a F, female; M, male. Login to comment

PMID: 19236881 [PubMed] Enquist K et al: "Membrane-integration characteristics of two ABC transporters, CFTR and P-glycoprotein."

No. Sentence Comment

113 For CFTR, we chose mutations located in TM1CFTR (F87L, G91R), TM3CFTR (P205S, L206W), TM4CFTR (C225R), TM5CFTR (DF311, G314E), TM6CFTR (R334L/W, I336K/R/D, I340N/S, L346P, R347L/H), TM8CFTR (S909I, S912L), TM9CFTR (I1005R, A1006E), TM10CFTR (Y1032N), and TM12CFTR (M1137R, ΔM1140, M1140K), or close to the TM region of TM1CFTR (R74W, L102R/P), TMF2CFTR (R117P/L, L137P), and TM11CFTR (M1101K/R). Login to comment
115 As seen in Supplementary Data Table S2, only a few of the tested mutations in the 19 residue long CFTR TM segments alter the insertion efficiency significantly: TM4CFTR (C225R) (decrease from 88% to 34%), TM6CFTR (I336K/R/D) (decrease from 55% to 34%, 36% and 35%, respectively), TM6CFTR (I340N/S) (decrease from 55% to 32% and 35%, respectively), TM6CFTR (L346P) (decrease from 55% to 14%,), and TM12CFTR (ΔM1140) (decrease from 34% to 7%). Login to comment
116 One mutation, TM6CFTR (R334L), increased the insertion efficiency from 55% to 85%, as expected for a charged-to-hydrophobic replacement. Login to comment
120 Mutations TM6VCFTR (I336K), TM6VCFTR (I340N), and TM6VCFTR (L346P) still caused a large decrease in membrane insertion (from 81% to 39%, 35% and 14%, respectively). Login to comment
121 Addition of flanking segments did not rescue the insertion of TMF6CFTR (I336K) or TMF6CFTR (L346P) (decrease from 87% to 52% and 21%, respectively), nor did the addition of TMF5CFTR and the intervening loop to TMF6CFTR (L346P) (decrease from 86% to 36%). Login to comment
133 In particular, neither TM1P-gp nor TM2P-gp have been found capable of independent integration into the lipid bilayer.37 Also, TM3P-gp has been found not to be able to re-initiate translocation.36,40 Both TM3CFTR and TM4CFTR have been found to exhibit weak signal-anchor activities, and the translocation of the second extra cellular loop of the protein was found to be efficient when both segments were present.34-36 Interestingly, very recent results show that the poorly inserting TM8CFTR stays close to the translocon for an extended period of time before integrating fully into the membrane, and that this retention depends on an acidic residue, Asp924, located near the center of the TM segment.64 Three of the non-conservative mutations in CFTR and P-gp that we have studied strongly reduce the insertion of a transmembrane helix even when flanking residues are included: TMF6CFTR (I336K), TMF6CFTR (L346P), and TMF1P-gp (L70P). Login to comment
109 For CFTR, we chose mutations located in TM1CFTR (F87L, G91R), TM3CFTR (P205S, L206W), TM4CFTR (C225R), TM5CFTR (DF311, G314E), TM6CFTR (R334L/W, I336K/R/D, I340N/S, L346P, R347L/H), TM8CFTR (S909I, S912L), TM9CFTR (I1005R, A1006E), TM10CFTR (Y1032N), and TM12CFTR (M1137R, ƊM1140, M1140K), or close to the TM region of TM1CFTR (R74W, L102R/P), TMF2CFTR (R117P/L, L137P), and TM11CFTR (M1101K/R). Login to comment
111 As seen in Supplementary Data Table S2, only a few of the tested mutations in the 19 residue long CFTR TM segments alter the insertion efficiency significantly: TM4CFTR (C225R) (decrease from 88% to 34%), TM6CFTR (I336K/R/D) (decrease from 55% to 34%, 36% and 35%, respectively), TM6CFTR (I340N/S) (decrease from 55% to 32% and 35%, respectively), TM6CFTR (L346P) (decrease from 55% to 14%,), and TM12CFTR (ƊM1140) (decrease from 34% to 7%). Login to comment
117 Addition of flanking segments did not rescue the insertion of TMF6CFTR (I336K) or TMF6CFTR (L346P) (decrease from 87% to 52% and 21%, respectively), nor did the addition of TMF5CFTR and the intervening loop to TMF6CFTR (L346P) (decrease from 86% to 36%). Login to comment
129 In particular, neither TM1P-gp nor TM2P-gp have been found capable of independent integration into the lipid bilayer.37 Also, TM3P-gp has been found not to be able to re-initiate translocation.36,40 Both TM3CFTR and TM4CFTR have been found to exhibit weak signal-anchor activities, and the translocation of the second extra cellular loop of the protein was found to be efficient when both segments were present.34-36 Interestingly, very recent results show that the poorly inserting TM8CFTR stays close to the translocon for an extended period of time before integrating fully into the membrane, and that this retention depends on an acidic residue, Asp924, located near the center of the TM segment.64 Three of the non-conservative mutations in CFTR and P-gp that we have studied strongly reduce the insertion of a transmembrane helix even when flanking residues are included: TMF6CFTR (I336K), TMF6CFTR (L346P), and TMF1P-gp (L70P). Login to comment

PMID: 22581207 [PubMed] Krulisova V et al: "Prospective and parallel assessments of cystic fibrosis newborn screening protocols in the Czech Republic: IRT/DNA/IRT versus IRT/PAP and IRT/PAP/DNA."

No. Sentence Comment

81 According to the protocol, this result indicated the sequencing of the Table 1 Parallel comparison of CF NBS protocols IRT/DNAa /IRT IRT/PAP IRT/PAP/DNAa Newborns screened (N) 106,522 106,522 106,522 IRT positives (N; %) 1,158 (1.09) 3,155 (2.96) 3,155 (2.96) PAP positives (N; %) - 260 (0.24) 260 (0.24) Median age (range) at the availability of DNA-testinga results (days) 36 (9-222b ) - 36 (9-222b ) 1 and/or 2 CF mutations detected (N; %) 76 (0.07) - 27 (0.03) Recalled newborns for repeated IRT examination (N; %) 47 (0.04) - - Positive CF NBS (N; %) 123 (0.12) 260 (0.24) 27 (0.03) Positive IRT in newborns recalled for repeated examination (N) 1 - - ST indicated (N; %) 77 (0.07) 260 (0.24) 27 (0.03) ST carried out (N; % of indicated ST) 72c (93.51) 204c (78.46) 24c (88.89) CF carriers (N) 55 - 12 Prevalence of CF carriers 1 in 21 - 1 in 22 Diagnosed CF patients (N) 19 16 15 False positives based on performed ST (N; % of all cases screened) 99d (0.09) 188 (0.18) 9 (0.01) Newborns with equivocal diagnosis [F508del/R117H-IVS-8 T(7) and ST<30 mmol/L; N] 2 - 0 False negatives (N) 2 5 6 Total of CF patients detected (N) 21e Median age (range) at diagnosis (days) 36 (9-57)e CF prevalence 1 in 5,072e Sensitivity (TP/TP+FN) 0.9048 0.7619 0.7142 Specificity (TN/TN+FP) 0.9991 0.9982 0.9999 PPV (TP/TP+FP) 0.1610 0.0784 0.625 N number, % of all cases screened, TP true positives, FN false negatives, TN true negatives, FP false positives, PPV positive predictive value, ST sweat test a CF-causing mutations covered by Elucigene assays ("legacy" nomenclature) with the CF-EU1Tm accounting for: p.Arg347Pro (R347P), c.2657+ 5G>A (2789+5G>A), c.2988+1G>A (3120+1G>A), c.579+1G>T (711+1G>T), p.Arg334Trp (R334W), p.Ile507del (I507del), p.Phe508del (F508del), c.3718-2477C>T (3849+10kbC>T), p.Phe316LeufsX12 (1078delT), p.Trp1282X (W1282X), p.Arg560Thr (R560T), p.Arg553X (R553X), p.Gly551Asp (G551D), p.Met1101Lys (M1101K), p.Gly542X (G542X), p.Leu1258PhefsX7 (3905insT), p.Ser1251Asn (S1251N), c.1585-1G>A (1717-1G>A), p.Arg117His (R117H), p.Asn1303Lys (N1303K), p.Gly85Glu (G85E), c.1766+1G>A (1898+1G>A), p.Lys684AsnfsX38 (2184delA), p.Asp1152His (D1152H), c.54-5940_273+10250del (CFTRdele2,3), p.Pro67Leu (P67L), p.Glu60X (E60X), p.Lys1177SerfsX15 (3659delC), c.489+1G>T (621+1G>T), p.Ala455Glu (A455E), p.Arg1162X (R1162X), p.Leu671X (2143delT), c.1210-12T[n] (IVS8-T(n) variant), including additional mutations in the CF-EU2Tm : p.Gln890X (Q890X), p.Tyr515X (1677delTA), p.Val520Phe (V520F), c.3140-26A>G (3272-26A>G), p.Leu88IlefsX22 (394delTT), p.Arg1066Cys (R1066C), p.Ile105SerfsX2 (444delA), p.Tyr1092X (C>A) (Y1092X(C>A)), p.Arg117Cys (R117C), p.Ser549Asn (S549N), p.Ser549ArgT>G (S549R T>G), p.Tyr122X (Y122X), p.Arg1158X (R1158X), p.Leu206Trp (L206W), c.1680-886A>G (1811+1.6kbA>G), p.Arg347His (R347H), p.Val739TyrfsX16 (2347delG) and p.Trp846X (W846X) b failed DNA isolation from DBS, including repetition of DNA-testing c deceased patient or non-compliance with referrals (five CF carriers in IRT/DNA/IRT, 56 newborns in IRT/PAP, three CF carriers in IRT/PAP/DNA) d comprising newborns with repeated IRT (47 newborns) e aggregate data from all protocols entire CFTR coding region in both newborns, and led to the identification of p.Ile336Lys (I336K) and p.Glu1104Lys (E1104K) mutations. Login to comment

PMID: 19208501 [PubMed] Balascakova M et al: "Pilot newborn screening project for cystic fibrosis in the Czech Republic: defining role of the delay in its symptomatic diagnosis and influence of ultrasound-based prenatal diagnosis on the incidence of the disease."

No. Sentence Comment

60 Sweat chloride concentration was positive (75 mM/L) in one newborn with the p.F508del mutation, where subsequent direct sequencing detected the p. I336K mutation [13], absent in the extended panel. Login to comment
57 Sweat chloride concentration was positive (75 mM/L) in one newborn with the p.F508del mutation, where subsequent direct sequencing detected the p. I336K mutation [13], absent in the extended panel. Login to comment

PMID: 16049310 [PubMed] Schrijver I et al: "Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations."

No. Sentence Comment

51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS. Login to comment
73 Genomic DNA Samples Used for Mutation Evaluation on the APEX Array Mutations validated with native DNA CFTRdel 2,3 (21 kb) 394delTT G85E R75X 574delA Y122X R117C R117H 621 ϩ 1GϾT 621 ϩ 3AϾG 711 ϩ 1GϾT I336K R334W R347P IVS8-5T IVS8-7T IVS8-9T A455E ⌬F508 ⌬I507 1677delTA 1717 - 1GϾA G542X G551D R553X R560T S549N 1898 ϩ 1GϾA 1898 ϩ 1GϾC 2183AAϾG 2043delG R668C 2143delT 2184delA 2184insA 2789 ϩ 5GϾA S945L 3120 ϩ 1GϾA I1005R 3272 - 26AϾG R1066C G1069R Y1092X (CϾA) 3500 - 2AϾT R1158X R1162X 3659delC S1235R 3849 ϩ 10 kb CϾT W1282X primer. Login to comment

PMID: 10923036 [PubMed] Claustres M et al: "Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France."

No. Sentence Comment

107 f 306insA, W79X, R117C, P205S, L227R, I336K, 1248+1G>A, 1609delCA, 1717-8G>A, S549R(T>G), S549N, 1812-1G>A, P574H, 2176insC, R709X, E827X, D836Y, 3007delG, L1065P, L1077P, H1085R, M1101K, 4021insT. Login to comment

PMID: 9429141 [PubMed] el-Harith EA et al: "Novel and characteristic CFTR mutations in Saudi Arab children with severe cystic fibrosis."

No. Sentence Comment

26 Deletions of two or more base pairs were screened for by electrophoresis using a native 12% polyacrylamide gel. The 20 common CFTR mutations that were screened for were AF508, AI507, 1677delTA, R347P, R347H, R553X, G551D, G542X, N1303K, 3849+1OKbC-8'T, R334W, I336K, 2789+5G-A, 1717-1G-A, 3272- 26A- G, Y1092X, 2143delT, W1282X, RI 17H, and the 5T allele. Login to comment

PMID: 9272157 [PubMed] Dork T et al: "Distinct spectrum of CFTR gene mutations in congenital absence of vas deferens."

No. Sentence Comment

43 This initial screening included the mutations ∆F508, G542X, R553X, G551D, N1303K, 1717-1 G→A, 3272-26 A→G, Y1092X, 2143delT, R347P, R347H, R334W, I336K, R117H, R117C, 2789+5 G→A, 3849+10kB C→T and the "5T" allele, the latter two splice variants being tested according to the instructions of Highsmith et al. (1994) and Chillón et al. (1995). Login to comment
83 The German CBAVD patient in our study was compound heterozygous for R334L and for the missense mutation I336K in the same exon. Login to comment
86 The V938G substitution was identified in two unrelated patients, one homozygote with unilateral ab- 368 Table 1A Frequency distribution and haplotypes of CFTR mutations in 106 CAVD patients Mutationa Nucleotide changesb Locationc Frequencyd Haplotypee Referencef 174delA deletion of A at 174 exon 1 1 D3 This study E56K G→A at 298 exon 3 1 B3 This study D58N G→A at 304 exon 3 1 C2 This study D110H G→A at 460 exon 4 2 C2 Dean et al. (1990) R117H G→A at 482 exon 4 24 B6 Dean et al. (1990) A120T G→A at 490 exon 4 1 n.p. Chillón et al. (1994) ̃L138 insertion of CTA after 546 exon 4 1 A2 This study L206W T→G at 749 exon 6a 1 B8 Claustres et al. (1993) M265R T→G at 926 exon 6b 1 A2 Schwarz et al. (pers. comm.) R297W C→T at 1021 exon 7 1 C2 This study 1078delT deletion of T at 1078 exon 7 1 C2 Claustres et al. (1992) R334W C→T at 1132 exon 7 1 B1 Gasparini et al. (1991) R334L G→T at 1133 exon 7 1 D3 This study I336K T→A at 1139 exon 7 1 A2 Cuppens et al. (1993) R347H G→A at 1172 exon 7 3 D1 Cremonesi et al. (1992) L375F A→C at 1257 exon 8 1 B3 Jézéquel et al. (1996) ∆F508 deletion of 3 bp between 1652-1655 exon 10 57 B1 Kerem et al. (1989) G542X G→T at 1756 exon 11 2 B1 Kerem et al. (1990) R553X C→T at 1789 exon 11 1 A4 Cutting et al. (1990) L568F G→T at 1836 exon 12 1 B3 This study 2184insA insertion of A at 2184 exon 13 1 D3 Dörk et al. (1994b) 2789+5 G→A G→A at 2789+5 intron 14b 4 D3 Highsmith et al. (1997) R933S A→T at 2931 exon 15 1 n.p. Login to comment
137 Complex alleles are indicated a One CF allele with R75X and 125G→C b One CBAVD allele with R75Q and R933S c One CBAVD allele with 5T and Q1352H d Two CF alleles with F508C and S1251N e One CF allele with 1716G→A and L619S f G576A and R668C were linked on two CBAVD and three CF alleles, whereas two additional CF alleles carried R668C together with the 3849+10kB C→T mutation (Dörk and Stuhrmann 1995) 371 Table 3 CFTR mutation genotypes in 106 males with CAVD Genotype PolyT Frequency Ethnic descent Diagnosis ∆F508/R117H 9/7 21 German, Austrian 20 CBAVD, 1 CUAVD ∆F508/5T 9/5 9 German, Austrian 8 CBAVD, 1 CUAVD ∆F508/F508C 9/7 3 German CBAVD ∆F508/R347H 9/9 2 German CBAVD ∆F508/1716 G→A 9/7 2 German CBAVD ∆F508/3272-26 A→G 9/7 2 German CBAVD ∆F508/E56K 9/7 1 German CBAVD ∆F508/M265R 9/7 1 German-Portuguese CBAVD ∆F508/R334W 9/9 1 German CBAVD ∆F508/T351S 9/9 1 German CBAVD ∆F508/L375F 9/7 1 Volga German CBAVD ∆F508/G576A & R668C 9/7 1 German CBAVD ∆F508/R933S 9/7 1 German CBAVD ∆F508/L997F 9/9 1 German CBAVD ∆F508/Y1032C 9/7 1 German CBAVD ∆F508/D1152H 9/7 1 German CBAVD ∆F508/K1351E 9/7 1 German CBAVD ∆F508/D1377H 9/7 1 Portuguese CBAVD ∆F508/L1388Q 9/7 1 German CBAVD ∆F508/unknown 9/7 4 German 3 CBAVD, 1 CUAVD 5T/5T 5/5 2 German CBAVD 5T/G542X 5/9 2 German, Turkish CBAVD 5T/D58N 5/7 1 Lebanese CBAVD 5T/̃L138 5/7 1 German-Polish CBAVD 5T/1078delT 5/7 1 German CBAVD 5T/R553X 5/7 1 German CBAVD 5T/2184insA 5/7 1 Turkish CBAVD 5T/D979A 5/7 1 Vietnamese CBAVD 5T/D1152H 5/7 1 Turkish CBAVD 5T/3659delC 5/7 1 German CBAVD 5T/S1235R 5/7 1 Greek CBAVD 5T/W1282X 5/7 1 German CBAVD 5T & Q1352H/ R297W & Q1352H 5/7 1 Vietnamese CBAVD 5T/unknown 5/7 1 German CBAVD R117H/L206W 7/9 1 German CBAVD R117H/2789+5 G→A 7/7 1 German CBAVD R117H/unknown 7/7 1 German CBAVD 2789+5 G→A/2789+5 G→A 7/7 1 Lebanese CBAVD 2789+5 G→A/L973F 7/7 1 German CBAVD V938G/V938G 7/7 1 Greek CBAVD V938G/174delA 7/7 1 German CBAVD D110H/D110H 7/7 1 Turkish CBAVD R334L/I336K 7/7 1 German CBAVD R347H/N1303K 9/9 1 German CBAVD L568F/D1152H 7/7 1 Turkish CBAVD 3272-26 A→G/V1153E 7/7 1 German CBAVD R75Q/unknown 7/7 1 German CBAVD A120T/unknown 9/7 1 German CBAVD 1716G→A/unknown 7/7 1 German CBAVD G576A & R668C/unknown 7/7 1 German CBAVD 2752-15 C→G/unknown 7/7 1 Iranian CBAVD Unknown/unknown 17 German, Turkish 7 CBAVD and 1 CUAVD without observed renal agenesis, 9 CBAVD with renal agenesis allele and the R297W mutation on a homozygous Q1352H background may then reduce CFTR function to a disease-causing level. Login to comment
145 Maldigestion 13 25 5T/D58N 184 99 55 - 14 34 5T/̃L138 177 80 53 - 15 33 5T/1078delT 187 87 56 Recurrent bronchitis 16 31 5T/G542X 181 85 79 - 17 31 5T/2184insA n.d. n.d. 60 Borderline pancreatic sufficiency 18 31 5T/D979A n.d. n.d. 55 Recurrent infections, FEVI 76% 19 29 5T/D1152H n.d. n.d. 57 - 20 32 5T/W1282X 180 76 n.d. Recurrent infections, nasal polyposis 21 37 5T/unknown 180 74 n.d. Nasal polyposis 22 28 D110H/D110H 175 80 n.d Asthma bronchiale, obstipation 23 33 R334L/I336K 170 65 n.d. Recurrent infections, nasal polyposis, maldigestion, salt depletion episodes 24 35 N1303K/R347H 167 77 93 - 25 30 V938G/174delA n.d. n.d. 42 - 26 29 V938G/V938G 197 115 n.d. Asthma bronchiale Fig.2 Spectrum of CFTR mutation genotypes in CF patients (left) and in patients with congenital absence of the vas deferens (right). Login to comment

PMID: 8947061 [PubMed] Hubert D et al: "Genotype-phenotype relationships in a cohort of adult cystic fibrosis patients."

No. Sentence Comment

77 - Genotype of the 110 CF patients: details of the CF mutations and classification into four groups Genotype Genotype Pts groups n 1 ∆F508/∆F508 48* 2 ∆F508/G542X 6 ∆F508/E827X 3† ∆F508/R553X 2 ∆F508/W1282X 2 ∆F508/E595X 1 ∆F508/E60X 1 ∆F508/W846X 1 ∆F508/1078delT 1 ∆F508/2143delT 1 ∆F508/2347delG 1 ∆F508/3659delC 1 ∆F508/4382delA 1 ∆F508/2183 AA→G 1 ∆F508/1717-1 G→A 1 ∆F508/1811+1.6 kb A→G 1 E595X/Y1092X 1 1717-1 G→A/1078delT 1 3 ∆F508/I336K 1 ∆F508/G27E 1 ∆F508/D192N 1 ∆F508//I980K 1 ∆F508/P205S 1 ∆F508/2789+5 G→A 1 ∆F508/3272-26 A→G 1 G542X/3849+10 kb C→T 2‡ G542X/2789+5 G→A 1 W361R/297-3 C→T 1 G551D/1717-1 G→A 1 N1303H/2183 AA→G 1 2789+5 G→A/2183 AA→G 1 R1070Q/D1152H 1 R1070Q/unidentified 1 S1251N/unidentified 1 4 ∆F508/unidentified 7 ∆I507/unidentified 2 1811+1.6 kb A→G/unidentified 1 1161delC/unidentified 1 unidentified/unidentified 8 *: two patients are brothers; †: three brothers; ‡: two sisters. Login to comment

PMID: 8844213 [PubMed] Morral N et al: "Haplotype analysis of 94 cystic fibrosis mutations with seven polymorphic CFTR DNA markers."

No. Sentence Comment

99 Mutations AF508, AI507, and I336K were found associated with haplotypes that should be the result of recombinations (Table 5). Login to comment
105 CFTR Haplotypes for Diallelic and Multiallelic DNA Markers for 94 CF Mutations" J44-GATT- 8CA-17BTA- No. of T854-TUB20 17BCA Mutation chromosomes % Normal Laboratory Reference 2-7-1-2 17-47-13 (55.4%) 17-46-13 17-45-13 17-34-13 17-32-13 17-31-14 17-31-13 17-29-14 17-28-13 16-48-13 16-46-14 16-46-13 16-45-13 16-44-13 16-35-13 16-33-13 16-32-13 16-31-14 16-31-13 16-30-13 16-29-13 16-26-13 16-25-13 16-24-13 14-31-13 1-7-2-1 17-7-17 (16.8%) R334W R334W 3860ins31 G1244E R1162X R1162X R1162X G91R MllOlK R347P R334W R117C E92K 3849+lOkbC+T 3293delA 1811+1.6kb A-tG 1811+1.6kb A-tG 2184insA P205S 3659delC G673X 11005R I336K W58S R347P W846X 405+1-A G178R 3905insT R1162X R347H 3100insA E60X 1078delT 4005+1-A K710X 1677delTA H199Y 3601-2AjG 3850-3T+G 3272-26A-tG 3850-1-A 1812-1-A R117H L1059X S492F Y1092X Y569H 3732delA C866Y 711+1G+T 711+1-T G85E 1949del84 2789+5-A H1085R W1282X R1066C 2043delG V456F 2 1 1 1 2 1 6 2 2 1 2 1 1 2 1 1 4 1 1 1 3 2 1 1 1 1 1 1 2 7 1 1 1 1 2 1 1 3 19 3 3 1 1 2 1 1 5 1 1 1 1 3 6 3 5 1 13 2 1 1 - 0.48 0.48 - - - 0.24 - - - 2.65 2.40 1.93 2.65 1.68 2.65 0.72 13.94 13.46 1.93 - 0.72 0.24 3.37 - b b fP fP fP t b,fb.fP h fb t h t h h fP fP b.h b h h b h h h h h fb fb,fP.t fP fP fP9t fP b t fPh b h fb b.fb,h fb*fP b,fP h h t h fb fb,fp,h.t fP fP fb t b.fP,t b,fb,h,t b f b h h fb b,fb.fP,h fP h h Gasparini et al. (1991b) Chilldn et al. (1993a) Devoto et al. (1991) Gasparini et al. (1991b) Dork et al. (1993a) Guillermit et al. (1993) Zielenski et al. (1993) Dean et al. (1990) Dork et al. (1994a) Nunes et al. (1993) Highsmith et al. (1994) Ghanem et al. (1994) Chilldn et al. (1995) Dork et al. (1994a) Dork et al. (1993a) Chilldn et al. (1993b) Kerem et al. (1990) Dork et al. (1994a) Dork et al. (1994a) Cuppenset al. (1993) Fanen et al. (1992) Maggio et al. (personal communication) Audrezet et al. (1993) Vidaud et al. (1990) Dork et al. (1993b) Zielenski et al. (1991a) Chilldn et al. (1994b) Malik et al. (personal communication) Cremonesi et at. Login to comment
106 (1992) Dork et al. (1994a) Malone et al. (personal communication) Claustreset al. (1992) Ferec et al. (1992) Fanen et al. (1992) lvaschenko et al. (1991) T. Dork (personal communication) Dean et al. (1990) Dork et al. (1994a) Ferec et al. (1992) Bozon et al. (1994) Costes et al. (personal communication) Fanen et al. (1992) Audrezet et al. (personal communication) Zielenski et al. (1991a) Zielenski et al. (1991a) Granell et al. (1992) Highsmith et al. (1990) Mercier et al. (1993b) Vidaud et al. (1990) Fanen et al. (1992) Fanen et al. (1992) Dork et al. (1994b) (continued) HAPLOTYPESFOR 94 CF MUTATIONS TABLE2. CFTR HaplotvpesforDiallelic and Multiallelic DNA Markers for 94 CF Mutations"(Continued) ~~ ~ J44-GAIT- 8CA-17BTA- No. of TSU-TUB20 17BCA Mutation chromosomes % Normal Laboratory Reference 1-6-1-2 (9.1%) 1-6-2-2 (8.9%) 1-7-1-2 (3.4%) 1-7-2-2 (2.6%) 2-7-1-1 (1.2%) 2-7-2-2 (0.7%) 17-7-16 16-7-18 16-7-17 15-7-17 24-31-13 23-52-13 23-34-13 23-33-14 23-33-13 23-32-13 23-31-13 23-30-13 23-21-19 23-18-13 22-35-13 22-31-13 22-30-13 21-31-13 19-33-13 18-45-13 18-37-13 18-35-13 17-57-11 17-55-13 17-55-11 17-54-11 17-53-11 17-52-11 17-51-11 17-33-13 16-46-13 16-45-13 16-44-13 16-42-13 16-35-13 16-30-13 16-30-13 16-7-17 16-21-19 L107% L1077P 24ldelAT L719X A1507 3849+10kbC-T 2184insA 2991de132 G551D 1154insTC V520F R560T 4114ATA+lT 3667de14 435insA Q414X C225R Q39X N1303K R1162X H199Y G542X G542X w1204x R347H G542X AF50gb N1303K 2143delT 3849f 10kbC-T N1303K 681delC R347H A455E N1303K A120T 621+1 h T 574delA 1221delCT F311L R560K R553X R533X R553X Q552X R553X Q552X R116W R553X 1898+5 h T 3272-26A-G 1717-1hA 1342-2A-C A1507 2869insG 2869insG E92X 4374+1 h T 2183AA-G R117H 1609delCA I336K W1063X 1 1 1 1 6 1 3 1 1 22 17 1 1 1 1 1 1 1 1 1 1 1 1 1 17 1 1 4 157 7 1 2 2 1 1 2 2 1 9 1 1 1 1 1 1 6 1 1 1 2 1 3 2 1 3 1 1 1 4 2 4 1 1 - - 10.33 1.45 - - 0.48 1.45 - 0.24 1.45 0.24 - - - - 0.24 0.48 - - - - - - 0.49 0.48 - 0.24 0.24 0.24 - - - - - 0.72 0.24 0.72 - t h fP h b.fb,fP h b,fp.t t h b.fb.fp,h,t b.fb.fp,h,t t t t h b h h fP h fP fb b fP b.fb,fP,h.t fP fb b,fP,t b.fb,fp,h,t b.fb,h h h h,t t fb t b b b.fb.t fP fb fb tb h fP h h t t b h t h b b h h b,fb,h fP.h b h fP fP Bozon et al. (1994) Fanen et al. (1992) Dork et al. (1994a) Kerem et al. (1990) Dork et al. (1994~) Cutting et al. (1990) Kerem et al. (1990) lannuui et d. Login to comment

PMID: 7520797 [PubMed] Cuppens H et al: "CFTR haplotype backgrounds on normal and mutant CFTR genes."

No. Sentence Comment

34 Distribution of alleles at 10 polymorphic loci Locus Allele Normal Mutant Mutations XV2c KM19 D9 1 2 1 2 1 2 58 (0.492) 60 (0.508) 84 (0.622) 51 (0.378) 78 (0.586) 55 (0.414) 146 (0.918) 13 (0.082) 19(0.109) 156 (0.891) 15 (0.085) 161 (0.915) 1001 + llC/T Tn 115 (0.927) R 9 (0.073) 5 7 (0.057) 7 102 (0.836) 9 13 (0.107) M470V C 62 (0.496) R 63 (0.504) 1898+15 2T/A C 84(0.641) R 47 (0.359) T854T Q1463Q D7S8 C 82 (0.636) R 47 (0.364) C 90 (0.692) R 40 (0.308) 1 38 (0.317) 2 82 (0.683) 33 (0.192) 139 (0.808) 0 (0.000) 32 (0.190) 136 (0.810) 156 (0.902) 17 (0.098) 163 (0.926) 13 (0.074) 162 (0.926) 13 (0.074) 162 (0.931) 12 (0.069) 91 (0.569) 69 (0.431) E60X, 622-2A-C, A455E, AF508 (98.3%), 1717-1G-A, G542X, 0.479 63.54 G628R(G-C)/S1235R,2183AA-G, G970R, W1282X, N1303K p<10~ G458V, AI5O7, AF508 (1.7%), 1898 + 1G-C, E73OX, 3272-26A-G, W1310X, 4218insT, UA, UB, UC I336K, W401X, 2T2ldelll, Y1092X, 3659delC, S1251N: not included (5%) E60X, 622-2A-C, W401X, G458V, AF5O8 (1.6%), 1898+ 1G-C, -0.541 90.63 G628R(G-Q/S1235R, E730X, G970R, 3272-26A-G (50.0%), p<10" Y1092X, 3659delC, S1251N, W1310X, UB, UTC A455E, AI507, AF5O8 (98.4%), 1717- 1G-A, G542X, 2183AA-G, 3272-26A-G (50.0%), W1282X, N13O3K, 4218insT, UA 1336K, 2721delU: not included (1%) E60X, 622-2A-C, W401X, G458V, 1898 +1G-C, E730X, G970R, -0.541 90.46 Y1092X, 3659delC, S1251N, W1310X, UB, UC p<10" A455E, AI507, AF508, 1717- 1G-A, G542X, G628R(G-Q/S1235R, 2183AA-G, 3272-26A-G, W1282X, N13O3K, 4218insT, UA I336K, 2721delll: not included (1%) E60X, 622-2A-C, I336K, W401X, G458V, AI507, 1717- 1G-A, -0.726 155.94 1898 + 1G-C, G628R(G-C)/S1235R, 2183AA-G, E730X, 2721delll, p< 10" G970R, 3272-26A-G, Y1092X, 3659delC, S1251N, W1282X, W1310X, 4218insT, UA, UB, UC A455E, AF5O8, G542X, N13O3K E60X, 622-2A-C, I336K, W401X, G458V, AI507, 1717-1G-A, 1898 + 1G-C, G628R(G-C)/S1235R, 2183AA-G, E730X, 2721delll, G970R, 3272-26A-G, Y1092X, 3659delC, S1251N, W1282X, W1310X, 4218insT, UA, UB, UC A455E, AF5O8, G542X, N13O3K A455E, AI5O7, AF508, 1717-1G-A, G542X, G628R(G-Q/S1235R, 2183AA-G, 3272-26A-G, W1282X, N13O3K, 4218insT, UA E60X, 622-2A-C, W401X, G458V, 1898 + 1G-C, E730X, G970R, Y1092X, 3659delC, S1251N, W1310X, UB, UC 1336K, midclll: not included (1%) E60X, 622-2A-C, W401X, A455E, G458V, AF508 (99.2%), G542X, 1898 + 1G-C, 2183AA-G, E730X, G970R, Y1092X, 3659delC, S1251N, N1303K, W1310X, UB, UC AI507, AF5O8 (0.8%), 1717-1G-A, G628R(G-Q/S1235R, 3272-26A-G, W1282X, 4218insT, UA I336K, 2721delU: not included (1%) E60X, 622-2A-C, W401X, A455E, G458V, AF508 (99.2%), G542X, 1898+1G-C, 2183AA-G, E730X, G970R, Y1092X, 3659delC,S1251N, N13O3K, W1310X, UB, UC AI507, AF508 (0.8%), 1717-1G-A, G628R(G-C)/S1235R, 3272-26A-G, W1282X, 4218insT, UA 1336K, midelll: not included (1%) E60X, 622-2A-C, W401X, A455E, G458V, AF5O8 (99.2%), G542X, G628R(G-Q/S1235R, 2183AA-G, E730X, G970R, Y1092X, 3659delC, S1251N,N1303K, W1310X, UC AI507, AF5O8 (0.8%), 1717-1G-A, 1898 + 1G-C, 3272-26A-G, W1282X, 4218insT 1336K, 2721del11. Login to comment
73 The I336K, W401X, 2721delll, Y1092X, 3659delC and S1251N mutations, contributing for 5% of all mutant CFTR genes, are not included. Login to comment

PMID: 7508414 [PubMed] Cuppens H et al: "Detection of 98.5% of the mutations in 200 Belgian cystic fibrosis alleles by reverse dot-blot and sequencing of the complete coding region and exon/intron junctions of the CFTR gene."

No. Sentence Comment

43 TABLE 1 Mutations (and Their Frequencies) Identified in This Study Predicted amino Mutation Nucleotide change~ acid change Location Frequencyb Reference E60X G --~ T at 310 (TAGATAGCT) Glu --~ Stop at 60 Malone et al. in (21); this study G --~ A at 482 (GAACACTCT) (8) A --~ C at 622-2 (TTTTCGACT) This study T --~ A at 1139 (AAAAAATTC) This study G --~ A at 1335 (TCTGAGAGG) This study C --~ A at 1496 (TTGGAGGTT) (14) G -~ T at 1505 (GCTGTATCC) (6) Deletion of ATC from 1651 (14); Schwarz et al. (TATC_TTTG) in (21) Deletion of CTT from 1653 145 (13) (TCAT_TGGT) G --~ A at 1717-1 (AATAAGACA) G --~ T at 1756 (TCTTTGAGA) G --~ C at 1898 + 1 (AAAGCTATG) G --~ C at 2014 (TTATCGGAC Deletion of A at 2184; A --~ G at 2183 (AAAAG CAAT) G --~ T at 2320 (TGATTAGCC Deletion of 11 nucleotides from 2721 (TGCT_TAGT) G --~ C at 3040 (AGCACGTAC A --~ G at 3272-26 (TGCAGTGTT) C --~ A at 3408 (TGTAACTGT) Deletion of C at 3659 (CCTA_CAAG) T --~ G at 3837 (TAAGGCCTG G --* A at 3884 (AAGAATACT G --~ A at 3978 (AGTGAAGGA' C --~ G at 4041 (AAAAGTTGG G -~ A at 4061 (CAGTAGAGT Insertion of T after 4218 (CAGTTAAGG) R117H 622-2A --~ C I336K W401X A455E G458V AI507 AF508 1717-1G -~ A G542X 1898+ 1G-~C G628R(G -~ C) 2184delA plus A -~ G at 2183 E730X 2721de111 G970R 3272-26A --~ G Y1092X 3659delc $1235R $1251N W1282X N1303K W1310X 4218insT Exon 3 2 (1.0%) Arg --~ His at 117 Exon 4 c 3' splice signal Intron 4 1 (0.5%) Ile -~ Lys at 336 Exon 7 1 (0.5%) Trp --~ Stop at 401 Exon 8 2 (1.0%) Ala --~ Glu at 455 Exon 9 2 (1.0%) Gly --* Val at 458 Exon 9 1 (0.5%) Deletion of Ile 507 Exon 10 1 (0.5%) Deletion of Phe 508 Exon 10 (72.5%) 3' splice signal Intron 10 5 (2.5%) Gly --* Stop at 542 Exon 11 11 (5.5%) 5' splice signal Intron 12 1 (0.5%) Gly -~ Arg at 628 Exon 13 1 (0.5%) Frameshift Exon 13 2 (1.0%) Glu --~ Stop at 730 Exon 13 1 (0.5%) Frameshift Exon 14a I (0.5%) Gly --~ Arg at 970 Exon 15 1 (0.5%) 5' splice signal? Login to comment
78 The second newly described missense mutation, I336K, is located in the first transmembrane domain and results in the substitution of a neutral amino acid by a basic one. Login to comment
80 It has been shown that mutagenesis of the neighboring amino acid 335 from a basic amino acid to an acidic amino acid (K335E) results in a CFTR protein with altered anion permeability sequence and conductivity sequence properties of the different halides (2). Login to comment
81 The I336K mutation will result in an extra positive charge in the neighborhood of the critical K335 amino acid. Login to comment
83 It could not be excluded that the I336K and 2721de111 mutations were present on a single allele in this individual, as no DNA of the parents was available. Login to comment
84 Subsequent to the identification of the I336K mutation in this individual, an A508/I336K patient with mild CF, who was diagnosed at the age of 12 years, has been iden- tiffed (T. DSrk, pers. Login to comment
87 The presence of the I336K and 2721de111 mutations on a single CFTR allele therefore seems unlikely. Login to comment
88 The I336K mutation further substantiates the observation that mutations in the first transmembrane regions result in a mild CF phenotype (8, 19). Login to comment
42 TABLE 1 Mutations (and Their Frequencies) Identified in This Study Predicted amino Mutation Nucleotide change~ acid change Location Frequencyb Reference E60X G --~ T at 310 (TAGATAGCT) Glu --~ Stop at 60 Malone et al. in (21); this study G --~ A at 482 (GAACACTCT) (8) A --~ C at 622-2 (TTTTCGACT) This study T --~ A at 1139 (AAAAAATTC) This study G --~ A at 1335 (TCTGAGAGG) This study C --~ A at 1496 (TTGGAGGTT) (14) G -~ T at 1505 (GCTGTATCC) (6) Deletion of ATC from 1651 (14); Schwarz et al. (TATC_TTTG) in (21) Deletion of CTT from 1653 145 (13) (TCAT_TGGT) G --~ A at 1717-1 (AATAAGACA) G --~ T at 1756 (TCTTTGAGA) G --~ C at 1898 + 1 (AAAGCTATG) G --~ C at 2014 (TTATCGGAC Deletion of A at 2184; A --~ G at 2183 (AAAAG CAAT) G --~ T at 2320 (TGATTAGCC Deletion of 11 nucleotides from 2721 (TGCT_TAGT) G --~ C at 3040 (AGCACGTAC A --~ G at 3272-26 (TGCAGTGTT) C --~ A at 3408 (TGTAACTGT) Deletion of C at 3659 (CCTA_CAAG) T --~ G at 3837 (TAAGGCCTG G --* A at 3884 (AAGAATACT G --~ A at 3978 (AGTGAAGGA' C --~ G at 4041 (AAAAGTTGG G -~ A at 4061 (CAGTAGAGT Insertion of T after 4218 (CAGTTAAGG) R117H 622-2A --~ C I336K W401X A455E G458V AI507 AF508 1717-1G -~ A G542X 1898+ 1G-~C G628R(G -~ C) 2184delA plus A -~ G at 2183 E730X 2721de111 G970R 3272-26A --~ G Y1092X 3659delc $1235R $1251N W1282X N1303K W1310X 4218insT Exon 3 2 (1.0%) Arg --~ His at 117 Exon 4 c 3' splice signal Intron 4 1 (0.5%) Ile -~ Lys at 336 Exon 7 1 (0.5%) Trp --~ Stop at 401 Exon 8 2 (1.0%) Ala --~ Glu at 455 Exon 9 2 (1.0%) Gly --* Val at 458 Exon 9 1 (0.5%) Deletion of Ile 507 Exon 10 1 (0.5%) Deletion of Phe 508 Exon 10 (72.5%) 3' splice signal Intron 10 5 (2.5%) Gly --* Stop at 542 Exon 11 11 (5.5%) 5' splice signal Intron 12 1 (0.5%) Gly -~ Arg at 628 Exon 13 1 (0.5%) Frameshift Exon 13 2 (1.0%) Glu --~ Stop at 730 Exon 13 1 (0.5%) Frameshift Exon 14a I (0.5%) Gly --~ Arg at 970 Exon 15 1 (0.5%) 5' splice signal? Login to comment
77 The second newly described missense mutation, I336K, is located in the first transmembrane domain and results in the substitution of a neutral amino acid by a basic one. Login to comment
82 It could not be excluded that the I336K and 2721de111 mutations were present on a single allele in this individual, as no DNA of the parents was available. Login to comment
86 The presence of the I336K and 2721de111 mutations on a single CFTR allele therefore seems unlikely. Login to comment

PMID: 7505690 [PubMed] Ferec C et al: "Genotype analysis of adult cystic fibrosis patients."

No. Sentence Comment

5 The other allele carried is: (i) a missense mutation located in exons coding for transmembrane region in five patients [R334W (1); I336K (2); R117H (1); H1054D (1)]; (ii) a splice mutation in two patients [2789 + 5G - A], (ill) an uncharacterised mutations In one patient. Login to comment
36 The I336K which results in a Lysine instead of an Isoleucine (Cassiman, personal communication), is found in two patients Figure 1. Login to comment
40 The I336K, introduces an Sspl restriction site in exon 7 and can, therefore, be detected by digestion with this enzyme. Login to comment
57 '*'* < GENOTYPE * • • ;i^>"; ' ' FUJ34W/G542X Exon 7/ Exon 11 Arginine •-> Tryptophan AF508/I336K Exon 10/Exon 7 Isoleucine ••> Lysine AF5O8/H1054O Exon 10/Exon 17b Histidine --> Aspartc Acid AF508 Unknown AF508 / 2789+5 G->A Exon 10/ Exon 14b Splice mutation AF508/2789+5 G->A Exon 10/ Exon 14b Splice mutation AF5O8/R117H Exon 10/Exon 4 Arginine -->Histidine AF508/O36K Exon 10/Exon 7 Isoteucine ••> Lysine SEX 4 M F M M F F F M DIAGNOSiS 13 13 27 17 39 32 30 17 PROFESSIONAL; . Login to comment
87 In this group two patients (a brother and a sister) compound heterozygotes for AF5O8 and I336K present with different phenotypes with regard to pancreatic status and pulmonary function, the male being PS and free of Pseudomonas Aeruginosa colonisation at 40 years old. Login to comment
91 Several different types of mutations have been found in this group, a splice mutation being present in two patients (2789+5 G - A in exon 14b), and missense mutations (R334W in exon 7, I336K in exon 7, Rl 17H in exon 4 and H1054D in exon 17b) present in the others. Login to comment

PMID: 23276700 [PubMed] Krenkova P et al: "Distribution of CFTR mutations in the Czech population: positive impact of integrated clinical and laboratory expertise, detection of novel/de novo alleles and relevance for related/derived populations."

No. Sentence Comment

85 The Elucigene CF-EU2v1ࡊ assay was shown to achieve sufficient mutation detection rates for multi-tier CF NBS (i.e. more than 85%), although the I336K and S945L, with frequency over 0.5% (Table 1), should also be included in the Czech national screening panel [1]. Login to comment
89 Mutations/HGVS nomenclature/ Mutations/traditional nomenclature, legacy name/ Czech Republic 2012 (this study) (N=1200) Slovakia 2010 (N=856) Eastern Hungary 2011 (N=80) Germany Bavaria 2002 (N=250) Austria Tyrol 1997 (N=126) Austria NorthEast, North- North 2002 (N=118) Poland (N=1726) c.1521_1523delCTT F508del 67.42 66.80 70.00 74.00 74,60 70.30 57.0 c.54-5940_273+10250del21 kb CFTRdele2,3/21kb 5.75 2.26 5.00 1.2* 2.6# NA 1.80 c.1652GNA G551D 2.91 b0.50 0.00 6.40 1.60 2.50 0.50 c.3909CNG N1303K 2.42 2.03 5.00 2.40 0.00 NA 1.80 c.1624GNT G542X 2.00 4.06 3.75 3.20 2.40 5.10 2.60 c.3718-2477CNT 3849+10kbCNT 1.67 4.28 0.00 NA 0.00 3.40 2.70 c.1766+1GNA 1898+1GNA 1.42 b0.50 0.00 NA 0.00 NA NA c.1040GNC R347P 0.92 1.10 1.25 0.80 1.60 2.50 NA c.2012delT 2143delT 0.92 1.10 0.00 NA 0.00 NA NA c.3140-26ANG 3272-26ANG 0.67 b0.50 0.00 NA 0.00 NA NA c.3846GNA W1282X 0.58 b0.50 0.00 NA 0.00 NA 0.70 c.1007TNA I336K 0.58 0.00 0.00 NA 0.00 NA NA c.1657CNT R553X 0.50 0.90 0.00 1.20 0.00 NA 1.90 c.2657+5GNA 2789+5GNA 0.50 0.00 0.00 NA 2.40 NA NA c.2834CNT S945L 0.50 0.00 0.00 NA 0.00 NA NA c.2052_2053insA 2184insA 0.42 1.58 5.00 NA 0.00 NA NA Legend: data for Slovakia [12], Eastern Hungary [14], Germany-Bavaria [13], Austria-Tyrol [18], Austria North East and North West [13], Poland and *[8], and # [16]. Login to comment

PMID: 23891399 [PubMed] Van Goor F et al: "Effect of ivacaftor on CFTR forms with missense mutations associated with defects in protein processing or function."

No. Sentence Comment

44 None M1V A46D E56K P67L R74W G85E E92K D110E D110H R117C R117H E193K L206W R334W I336K T338I S341P R347H R347P R352Q A455E L467P S492F F508del V520F A559T R560S R560T A561E Y569D D579G R668C L927P S945L S977F L997F F1052V H1054D K1060T L1065P R1066C R1066H R1066M A1067T R1070Q R1070W F1074L L1077P H1085R M1101K D1152H S1235R D1270N N1303K 0 100 200 300 400 500 600 * * * CFTR Mutation mRNA (% Normal CFTR) Fig. 1. Login to comment
64 Mutant CFTR form CFTR processing Mature/total % Normal CFTR Normal 0.89 &#b1; 0.01 100.0 &#b1; 18.5 G85E -0.05 &#b1; 0.04 -1.0 &#b1; 0.9 R560S 0.00 &#b1; 0.00 0.0 &#b1; 0.0 R1066C 0.02 &#b1; 0.01 0.0 &#b1; 0.0 S492F 0.00 &#b1; 0.00 0.1 &#b1; 0.1 R560T 0.01 &#b1; 0.01 0.2 &#b1; 0.1 V520F 0.05 &#b1; 0.03 0.3 &#b1; 0.2 M1101K 0.05 &#b1; 0.03 0.3 &#b1; 0.1 A561E 0.08 &#b1; 0.04 0.5 &#b1; 0.2 R1066M 0.02 &#b1; 0.02 0.5 &#b1; 0.4 N1303K 0.02 &#b1; 0.02 0.5 &#b1; 0.3 A559T 0.16 &#b1; 0.09 0.6 &#b1; 0.2 M1V 0.06 &#b1; 0.06 0.7 &#b1; 0.6 Y569D 0.11 &#b1; 0.04 0.6 &#b1; 0.2 R1066H 0.08 &#b1; 0.02a 0.7 &#b1; 0.2a L1065P 0.05 &#b1; 0.05 1.0 &#b1; 0.8 L467P 0.10 &#b1; 0.07 1.2 &#b1; 0.8 L1077P 0.08 &#b1; 0.04 1.5 &#b1; 0.6 A46D 0.21 &#b1; 0.08 1.9 &#b1; 0.5a E92K 0.06 &#b1; 0.05 1.9 &#b1; 1.3 H1054D 0.09 &#b1; 0.04 1.9 &#b1; 0.8 F508del 0.09 &#b1; 0.02a 2.3 &#b1; 0.5a H1085R 0.06 &#b1; 0.01a 3.0 &#b1; 0.7a I336K 0.42 &#b1; 0.05a 6.5 &#b1; 0.7a L206W 0.35 &#b1; 0.10a 6.8 &#b1; 1.7a F1074L 0.52 &#b1; 0.03a 10.9 &#b1; 0.6a A455E 0.26 &#b1; 0.10a 11.5 &#b1; 2.5a E56K 0.29 &#b1; 0.04a 12.2 &#b1; 1.5a R347P 0.48 &#b1; 0.04a 14.6 &#b1; 1.8a R1070W 0.61 &#b1; 0.04a 16.3 &#b1; 0.6a P67L 0.36 &#b1; 0.04a 28.4 &#b1; 6.8a R1070Q 0.90 &#b1; 0.01a 29.5 &#b1; 1.4a S977F 0.97 &#b1; 0.01a 37.3 &#b1; 2.4a A1067T 0.78 &#b1; 0.03a 38.6 &#b1; 6.1a D579G 0.72 &#b1; 0.02a 39.3 &#b1; 3.1a D1270N 1.00 &#b1; 0.00a,c 40.7 &#b1; 1.2a S945L 0.65 &#b1; 0.04a 42.4 &#b1; 8.9a L927P 0.89 &#b1; 0.01a,b 43.5 &#b1; 2.5a,b R117C 0.87 &#b1; 0.02a,b 49.1 &#b1; 2.9a,b T338I 0.93 &#b1; 0.03a,b 54.2 &#b1; 3.7a,b L997F 0.90 &#b1; 0.04a,b 59.8 &#b1; 10.4a,b D110H 0.97 &#b1; 0.01a,b 60.6 &#b1; 1.5a,b S341P 0.79 &#b1; 0.02a 65.0 &#b1; 4.9a,b R668C 0.94 &#b1; 0.03a,b 68.5 &#b1; 1.9a,b R74W 0.78 &#b1; 0.01a 69.0 &#b1; 2.7a,b D110E 0.92 &#b1; 0.05a,b 87.5 &#b1; 9.5a,b R334W 0.91 &#b1; 0.05a,b 97.6 &#b1; 10.0a,b K1060T 0.87 &#b1; 0.02a,b 109.9 &#b1; 28.0a,b R347H 0.96 &#b1; 0.02a,c 120.7 &#b1; 2.8a,b S1235R 0.96 &#b1; 0.00a,c 139.0 &#b1; 9.0a,b E193K 0.84 &#b1; 0.02a,b 143.0 &#b1; 17.1a,b R117H 0.86 &#b1; 0.01a,b 164.5 &#b1; 34.2a,b R352Q 0.98 &#b1; 0.01a,b 179.9 &#b1; 8.0a,c F1052V 0.90 &#b1; 0.01a,b 189.9 &#b1; 33.1a,b D1152H 0.96 &#b1; 0.02a,c 312.0 &#b1; 45.5a,b Notes to Table 1: Quantification of steady-state CFTR maturation expressed as the mean (&#b1;SEM; n = 5-9) ratio of mature CFTR to total CFTR (immature plus mature) or level of mature mutant CFTR relative to mature normal-CFTR (% normal CFTR) in FRT cells individually expressing CFTR mutations. Login to comment
74 Because the level of CFTR mRNA was similar across the panel of cell lines tested, the range in baseline activity and ivacaftor response likely reflects the severity of the functional defect and/or the 0 50 100 150 200 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L E56K P67L R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V Baseline With ivacaftor * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Chloride transport (% Normal) Mutant CFTR form 0 100 200 300 400 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L P67L E56K R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Mature CFTR (% Normal) Mutant CFTR form A B Fig. 2. Login to comment
82 Mutation Patientsa Chloride transport (bc;A/cm2 ) Chloride transport (% normal) EC50 Baseline With ivacaftor Baseline With ivacaftor Fold increase over baselineb Normal 204.5 &#b1; 33.3 301.3 &#b1; 33.8c 100.0 &#b1; 16.3 147.3 &#b1; 16.5c 1.5 266 &#b1; 42 G551D 1282 1.5 &#b1; 0.7 113.2 &#b1; 13.0c 1.0 &#b1; 0.5 55.3 &#b1; 6.3c 55.3 312 &#b1; 73 F1052V 12 177.3 &#b1; 13.7 410.2 &#b1; 11.3c 86.7 &#b1; 6.7 200.7 &#b1; 5.6c 2.3 177 &#b1; 14 S1235R ND 160.6 &#b1; 25.7 352.1 &#b1; 43.4c 78.5 &#b1; 12.6 172.2 &#b1; 21.2c 2.2 282 &#b1; 104 D1152H 185 117.3 &#b1; 23.0 282.7 &#b1; 46.9c 57.4 &#b1; 11.2 138.2 &#b1; 22.9c 2.4 178 &#b1; 67 D1270N 32 109.5 &#b1; 20.5 209.5 &#b1; 27.4c 53.6 &#b1; 10.0 102.4 &#b1; 13.4c 1.9 254 &#b1; 56 R668C 45 99.0 &#b1; 9.4 217.6 &#b1; 11.7c 48.4 &#b1; 4.6 106.4 &#b1; 5.7c 2.2 517 &#b1; 105 K1060T ND 89.0 &#b1; 9.8 236.4 &#b1; 20.3c 43.5 &#b1; 4.8 115.6 &#b1; 9.9c 2.7 131 &#b1; 73 R74W 25 86.8 &#b1; 26.9 199.1 &#b1; 16.8c 42.5 &#b1; 13.2 97.3 &#b1; 8.2c 2.3 162 &#b1; 17 R117H 739 67.2 &#b1; 13.3 274.1 &#b1; 32.2c 32.9 &#b1; 6.5 134.0 &#b1; 15.7c 4.1 151 &#b1; 14 E193K ND 62.2 &#b1; 9.8 379.1 &#b1; 1.1c 30.4 &#b1; 4.8 185.4 &#b1; 1.0c 6.1 240 &#b1; 20 A1067T ND 55.9 &#b1; 3.2 164.0 &#b1; 9.7c 27.3 &#b1; 1.6 80.2 &#b1; 4.7c 2.9 317 &#b1; 214 L997F 27 43.7 &#b1; 3.2 145.5 &#b1; 4.0c 21.4 &#b1; 1.6 71.2 &#b1; 2.0c 3.3 162 &#b1; 12 R1070Q 15 42.0 &#b1; 0.8 67.3 &#b1; 2.9c 20.6 &#b1; 0.4 32.9 &#b1; 1.4c 1.6 164 &#b1; 20 D110E ND 23.3 &#b1; 4.7 96.4 &#b1; 15.6c 11.4 &#b1; 2.3 47.1 &#b1; 7.6c 4.1 213 &#b1; 51 D579G 21 21.5 &#b1; 4.1 192.0 &#b1; 18.5c 10.5 &#b1; 2.0 93.9 &#b1; 9.0c 8.9 239 &#b1; 48 D110H 30 18.5 &#b1; 2.2 116.7 &#b1; 11.3c 9.1 &#b1; 1.1 57.1 &#b1; 5.5c 6.2 249 &#b1; 59 R1070W 13 16.6 &#b1; 2.6 102.1 &#b1; 3.1c 8.1 &#b1; 1.3 49.9 &#b1; 1.5c 6.2 158 &#b1; 48 P67L 53 16.0 &#b1; 6.7 88.7 &#b1; 15.7c 7.8 &#b1; 3.3 43.4 &#b1; 7.7c 5.6 195 &#b1; 40 E56K ND 15.8 &#b1; 3.1 63.6 &#b1; 4.4c 7.7 &#b1; 1.5 31.1 &#b1; 2.2c 4.0 123 &#b1; 33 F1074L ND 14.0 &#b1; 3.4 43.5 &#b1; 5.4c 6.9 &#b1; 1.6 21.3 &#b1; 2.6c 3.1 141 &#b1; 19 A455E 120 12.9 &#b1; 2.6 36.4 &#b1; 2.5c 6.3 &#b1; 1.2 17.8 &#b1; 1.2c 2.8 170 &#b1; 44 S945L 63 12.3 &#b1; 3.9 154.9 &#b1; 47.6c 6.0 &#b1; 1.9 75.8 &#b1; 23.3c 12.6 181 &#b1; 36 S977F 9 11.3 &#b1; 6.2 42.5 &#b1; 19.1c 5.5 &#b1; 3.0 20.8 &#b1; 9.3c 3.8 283 &#b1; 36 R347H 65 10.9 &#b1; 3.3 106.3 &#b1; 7.6c 5.3 &#b1; 1.6 52.0 &#b1; 3.7c 9.8 280 &#b1; 35 L206W 81 10.3 &#b1; 1.7 36.4 &#b1; 2.8c 5.0 &#b1; 0.8 17.8 &#b1; 1.4c 3.6 101 &#b1; 13 R117C 61 5.8 &#b1; 1.5 33.7 &#b1; 7.8c 2.9 &#b1; 0.7 16.5 &#b1; 3.8c 5.7 380 &#b1; 136 R352Q 46 5.5 &#b1; 1.0 84.5 &#b1; 7.8c 2.7 &#b1; 0.5 41.3 &#b1; 3.8c 15.2 287 &#b1; 75 R1066H 29 3.0 &#b1; 0.3 8.0 &#b1; 0.8c 1.5 &#b1; 0.1 3.9 &#b1; 0.4c 2.6 390 &#b1; 179 T338I 54 2.9 &#b1; 0.8 16.1 &#b1; 2.4c 1.4 &#b1; 0.4 7.9 &#b1; 1.2c 5.6 334 &#b1; 38 R334W 150 2.6 &#b1; 0.5 10.0 &#b1; 1.4c 1.3 &#b1; 0.2 4.9 &#b1; 0.7c 3.8 259 &#b1; 103 G85E 262 1.6 &#b1; 1.0 1.5 &#b1; 1.2 0.8 &#b1; 0.5 0.7 &#b1; 0.6 NS NS A46D ND 2.0 &#b1; 0.6 1.1 &#b1; 1.1 1.0 &#b1; 0.3 0.5 &#b1; 0.6 NS NS I336K 29 1.8 &#b1; 0.2 7.4 &#b1; 0.1c 0.9 &#b1; 0.1 3.6 &#b1; 0.1c 4 735 &#b1; 204 H1054D ND 1.7 &#b1; 0.3 8.7 &#b1; 0.3c 0.8 &#b1; 0.1 4.2 &#b1; 0.1c 5.3 187 &#b1; 20 F508del 29,018 0.8 &#b1; 0.6 12.1 &#b1; 1.7c 0.4 &#b1; 0.3 5.9 &#b1; 0.8c 14.8 129 &#b1; 38 M1V 9 0.7 &#b1; 1.4 6.5 &#b1; 1.9c 0.4 &#b1; 0.7 3.2 &#b1; 0.9c 8.0 183 &#b1; 85 E92K 14 0.6 &#b1; 0.2 4.3 &#b1; 0.8c 0.3 &#b1; 0.1 2.1 &#b1; 0.4c 7.0 198 &#b1; 46 V520F 58 0.4 &#b1; 0.2 0.5 &#b1; 0.2 0.2 &#b1; 0.1 0.2 &#b1; 0.1 NS NS H1085R ND 0.3 &#b1; 0.2 2.1 &#b1; 0.4 0.2 &#b1; 0.1 1.0 &#b1; 0.2 NS NS R560T 180 0.3 &#b1; 0.3 0.5 &#b1; 0.5 0.1 &#b1; 0.1 0.2 &#b1; 0.2 NS NS L927P 15 0.2 &#b1; 0.1 10.7 &#b1; 1.7c 0.1 &#b1; 0.1 5.2 &#b1; 0.8c 52.0 313 &#b1; 66 R560S ND 0.0 &#b1; 0.1 -0.2 &#b1; 0.2 0.0 &#b1; 0.0 -0.1 &#b1; 0.1 NS NS N1303K 1161 0.0 &#b1; 0.0 1.7 &#b1; 0.3 0.0 &#b1; 0.0 0.8 &#b1; 0.2 NS NS M1101K 79 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1077P 42 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066M ND 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066C 100 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1065P 25 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS Y569D 9 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS A561E ND 0.0 &#b1; 0.1 0.0 &#b1; 0.1 0.0 &#b1; 0.0 0.0 &#b1; 0.1 NS NS A559T 43 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S492F 16 0.0 &#b1; 0.0 1.7 &#b1; 1.2 0.0 &#b1; 0.0 0.8 &#b1; 0.6 NS NS L467P 16 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R347P 214 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S341P 9 0.0 &#b1; 0.0 0.2 &#b1; 0.2 0.0 &#b1; 0.0 0.1 &#b1; 0.1 NS NS a Number of individuals with the individual mutation in the CFTR-2 database (www.CFTR2.org). Login to comment
99 A small but significant response to ivacaftor was also observed in FRT cells expressing the severe processing mutations, M1V, H1054D, and I336K (Table 2; Fig. 2). Login to comment

PMID: 24586523 [PubMed] Zietkiewicz E et al: "CFTR mutations spectrum and the efficiency of molecular diagnostics in Polish cystic fibrosis patients."

No. Sentence Comment

71 Exon / intron (legacy) Exon / intron (Ensembl) Protein change SVM value cDNA (HGVS nomenclature) gDNA (cDNA +132 bp) Number of PL CF chromosomes Reference a Mutations in trans Pathogenic mutations 1 1 L15Ffs10X c.43delC 175delC 1 CFMDB 1717-1G.A 2 2 G27V 21.92 c.80G.T 212G.T 1 Novel F508del 2 2 S18RfsX16 c.54-5940_273 +10250del21kb exon2,3del21kb 66 IL19 various CF mutations i2 i2 IVS2_Donor c.164+1G.A 296+1G.A 3 CFMDB various CF mutations 3 3 G85E 22.61 c.254G.A 386G.A 1 IL17 unknown 3 3 E60X c.178G.T 310G.T 0 IL17 x 3 3 L88IfsX22 c.262_263delTT 394delTT 0 IL17 x 4 4 E92K 21.92 c.274G.A 406G.A 2 CFMDB c.164+1G.A; c.2051- 2AA.G 4 4 L101X c.302T.G 434T.G 1 CFMDB c.3717+12191C.T 4 4 K114IfsX5 c.341_353del13bp 473del13bp 1 Novel F508del 4 4 R117H 20.35 c.350G.A 482G.A 5 IL17 F508del; 2x unknown 4 4 R117C 22.07 c.349C.T 481C.T 2 CFMDB S1206X;1x unknown 4 4 L137_L138insT c.412_413insACT L138ins 1 CFMDB F508del 4 4 R153I 22.61 c.458G.T 590G.T 2 Novel F508del; c.3527delC i4 i4 IVS4_Donor c.489+1G.T 621+1G.T 5 IL17 F508del; c.489+1G.T 5 5 L165X c.494T.A 626T.A 1 Novel F508del i5 i5 IVS5_Donor c.579+1G.T 711+1G.T 0 IL19 x i5 i5 IVS5_Donor c.579+3A.G 711+3A.G 2 CFMDB 2,3del21kb; c.2052-3insA i5 i5 IVS5_Donor c.579+5G.A 711+5G.A 0 IL17 x 7 8 F311L 20.90 c.933C.G 965C.G 2 CFMDB 2x F508 7 8 G314R 20.58 c.940G.A 1072G.A 4 CFMDB various CF mutations 7 8 F316LfsX12 c.948delT 1078delT 1 IL17 unkown 7 8 R334W 22.41 c.1000C.T 1132C.T 6 IL17 various CF mutations 7 8 I336K 22.07 c.1007T.A 1139T.A 2 CFMDB 2,3de21kb; F508del 7 8 R347P 22.27 c.1040G.C 1172G.C 11 IL17 various CF mutations i7 i8 IVS8_Donor c.1116+2T.A 1248+2T.A 1 Novel Q1412X 9 10 A455E 22.61 c.1364C.A 1496C.A 0 IL17 x i9 i10 IVS10_Donor c.1392+1G.A 1524+1G.A 1 CFMDB c.3816-7delGT 10 11 S466X c.1397C.G 1529C.G 1 CFMDB G542X 10 11 I507del c.1519_1521delATC 1651delATC 2 IL19 F508del 10 11 F508del c.1521_1523delCTT 1654delCTT 805 IL19 various CF mutations i10 i11 IVS11_Acceptor c.1585-1G.A 1717-1G.A 27 IL19 various CF mutations 11 12 G542X c.1624G.T 1756G.T 25 IL19 various CF mutations 11 12 G551D 21.24 c.1624G.T 1756G.T 5 IL19 various CF mutations 11 12 Q552X c.1654C.T 1786C.T 0 IL19 x 11 12 R553X c.1657C.T 1789C.T 14 IL19 various CF mutations 11 12 R560T 21.92 c.1679G.C 1811G.C 0 IL19 x i12 i13 IVS13_Donor c.1766+1G.A 1898+1G.A 6 IL19 various CF mutations i12 i13 IVS13_Donor c.1766+1G.C 1898+1G.C 1 CFMDB F508del 13 14 H620P 21.73 c.1859A.C 1991A.C 1 CFMDB F508del 13 14 R668C//G576A 21.61//1.73 c.2002C.T//c.1727G.C 2134C.T// 1859G.C 5 b CFMDB// rs1800098 c.1585-1G.A; 4 unknown 13 14 L671X c.2012delT 2143delT 27 IL17 various CF mutations 13 14 K684SfsX38 c.2051_2052delAAinsG 2183AA.G 10 IL17 various CF mutations 13 14 K684NfsX38 c.2052delA 2184delA 0 IL17 x 13 14 Q685TfsX4 c.2052_2053insA 2184insA 15 CFMDB various CF mutationsc , 1 unknown Table 2. Cont. Exon / intron (legacy) Exon / intron (Ensembl) Protein change SVM value cDNA (HGVS nomenclature) gDNA (cDNA +132 bp) Number of PL CF chromosomes Reference a Mutations in trans 13 14 L732X c.2195T.G 2327T.G 1 CFMDB F508del 14A 15 R851X c.2551C.T 2683C.T 3 CFMDB various CF mutations 14A 15 I864SfsX28 c.2589_2599del11bp 2721del11bp 2 CFMDB F508del; 2,3del21kb i14B i16 IVS16_Donor c.2657+2_2657+3insA 2789+2insA 1 CFMDB F508del i14B i16 IVS16_Donor c.2657+5G.A 2789+5G.A 0 IL17 unkown 15 17 Y919C 21.02 c.2756A.G 2888A.G 1 CFMDB unknown 15 17 H939HfsX27 c.2817_2820delTACTC 2949delTACTC 1 Novel unkown i15 i17 IVS17_Donor c.2908+3A.C 3040+3A.C 1 Novel F508del i16 i18 IVS18_Donor c.2988+1G.A 3120+1G.A 0 IL19 x 17A 19 I1023_V1024del c.3067_3072delATAGTG 3199del6 0 IL19 x i17A i19 IVS19 c.3140-26A.G 3272-26A.G 9 IL19 various CF mutations 17B 20 L1065R 21.90 c.3194T.G 3326T.G 1 CFMDB F508del 17B 20 Y1092X c.3276C.A 3408C.A 1 CFMDB R334W i18 i21 IVS21_Donor c.3468+2_3468+3insT 3600+2insT 11 CFMDB various CF mutationsd , 1 unknown 18 21 E1126EfsX7 c.3376_3379delGAAG 3508delGAAG 1 Novel F508del 19 22 R1158X c.3472C.T 3604C.T 2 CFMDB F508del; R553X 19 22 R1162X c.3484C.T 3616C.T 1 IL17 F508del 19 22 L1177SfsX15 c.3528delC 3659delC 4 IL17 various CF mutations 19 22 S1206X c.3617C.A 3749C.A 1 CFMDB R117C i19 i22 IVS22 c.3717+12191C.T 3849+10kbC.T 58 IL17 various CF mutations 20 23 G1244R 22.62 c.3730G.C 3862G.C 1 CFMDB F508del 20 23 S1251N 22.28 c.3752G.A 3884G.A 0 IL19 x 20 23 L1258FfsX7 c.3773_3774insT 3905insT 0 IL19 x 20 23 V1272VfsX28 c.3816_3817delGT 3944delGT 1 CFMDB c.1392+1G.A 20 23 W1282X c.3846G.A 3978G.A 9 IL19 various CF mutations 21 24 N1303K 22.62 c.3909C.G 4041C.G 18 IL19 various CF mutations 22 25 V1327X c.3979delG 4111delG 1 Novel F508del 22 25 S1347PfsX13 c.4035_4038dupCCTA c.4167dupCCTA 1 CFMDB 2,3del21kb 23 26 Q1382X c.4144C.T 4276C.T 1 CFMDB F508del 23 26 Q1412X c.4234C.T 4366C.T 2 CFMDB F508del; c.1116+2T.A i23 i26 IVS26_Donor c.4242+1G.T 4374+1G.T 1 CFMDB F508del Sequence changes of uncertain pathogenic effect, tentatively counted as mutations 6A 6 E217G 0.30 c.650A.G 782A.G 1 CFMDB; rs1219109046 unknown 7 8 R352Q 20.01 c.1055G.A 1187G.A 1 CFMDB; rs121908753 F508del 7 8 Q359R 0.33 c.1076A.G 1208A.G 1 CFMDB F508del i8 i9 IVS9 c.1210-12T5_1210- 34_35 (TG)12 1332-12Tn_- 34TGm 6 CFMDB F508del; 3x unknown i8 i9 IVS9 c.1210-12T5_1210- 34_35 (TG)13 1332-12Tn_- 34TGm 2 CFMDB 2143delT; 1x unknown i8 i9 IVS9 c.1210-12T8 1332-12Tn 1 Novel unknown 10 11 I506V 20.21 c.1516A.G 1648A.G 1 CFMDB; rs1800091 unknown 12 13 V562L 0.79 c.1684G.C 1816G.C 1 CFMDB; rs1800097 unknown 13 14 G723V 0.44 c.2168G.T 2300G.T 1 CFMDB; rs200531709 unknown 15 17 D924N 0.03 c.2770G.A 2902G.A 1 CFMDB; rs201759207 unknown patient with F508del on another allele) was not supported by the SVM value (+0.35); the patient was PS and had ambiguous chloride values (45, 64 and 83 mmol/L). Login to comment
137 Mutations a Poland Czechs Slovakia c Germany Lithuania W. Ukraine E. Hungary Romania c Bulgaria Serbia Greece Number of chromosomes 1476 1200 856 700 98 264 80 256 208 352 874 F508del 54.54 b 67.42 d 66.80 d 72.00 d 52.0 54.17 70.00 56.3 65.38 d 72.28 d 53.40 exon2,3del21kb (l.n.CFTRdele2,3_21kb) 4.47 5.75 2.26 1.2 f 2.0 4.17 5.00 1.6 NA 0 e 0.34 e c.3717+12191C.T (l.n.3849+10kbC.T) 3.93 1.67 e 4.28 1.00 e NA 0.76 0 0.4 e 1.44 0 e 0.11 e c.2012delT (l.n.2143delT) 1.83 0.92 1.10 0.71 0 1.14 0 0 e 0 0 e 0 e c.1585-1G.A (l.n.1717-1G.A) 1.83 0.33 e NA 0.86 0 0.38 1.25 0.4 0 0 e 0 e G542X 1.69 2.00 4.06 d 1.43 0 2.65 3.75 3.9 3.37 2.57 3.90 d R347P 1.57 0.92 1.10 1.57 0 0 1.25 NA 1.44 0 e 0.11 e N1303K 1.22 2.42 2.03 2.29 2.0 4.92 d 5.00 0.8 6.73 d 0 2.63 c.2052-2053insA (l.n.2184insA) 1.02 0.42 1.58 0.57 0 7.20 d 5.00 d 0 0.48 0.28 0 e R553X 0.95 0.50 0.90 2.29 4.2 d 0.38 0 NA 0 0 0 c.3468+223insT (l.n.3600+2insT) 0.75 0.25 NA 0 e 0 NA 0 NA 0 0 0 e c.2051-2052AA.G (l.n.2183AA.G) 0.68 0.08 NA 0.57 0 0.38 0 0.8 0 0 1.38 W1282X 0.61 0.58 0.50 0.71 1.0 2.27 0 2.3 d 0.96 0 0.67 c.3140-26A.G (l.n.3272-26A.G) 0.61 0.67 0.50 0.86 0 0.76 0 0.4 0 0 0.81 l.n.IVS8 T 5 _TG 12-13 0.54 NA NA NA 0 NA NA NA NA 0 NA R334W 0.41 0.25 NA 0.29 0 0.76 0 0.4 0 0.28 0.81 c.1766+1G.A (l.n.1898+1G.A) 0.41 1.42 d 0.50 0 0 1.14 0 NA 0 0 0.11 c.489+1G.T (l.n.621+1G.T) 0.34 0.42 NA 0.14 0 0.76 0 0.8 0 2.86 d 5.72 d R117H 0.34 NA NA 0.29 0 0 0 0.4 0 0 0.23 G551D 0.34 2.91 d 0.50 1.00 0 0 0 0 0 0 0.34 G314R 0.37 0 NA 0 0 0 0 NA 0 0 0 R668C 0.34 0 NA 0 0 0 0 NA 0 0 0 c.3528delC (l.n.3659delC) 0.27 0.17 NA 0.57 0 0 0 NA 0 0 0 c.164+1G.A (l.n.296+1G.A) 0.20 0.08 NA 0 0 0 0 NA 0 0 0 R851X 0.20 0.08 NA 0 0 0 0 NA 0 0 0 I336K 0.14 0.58 NA 0.45 0 0 0 NA 0 0 0 R1158X 0.14 0.08 NA 0 0 0 0 NA 0 0 1.03 E92K 0.14 0.08 NA 0 0 0.38 0 NA 0 0 0 R153I 0.14 0 NA 0 0 0 0 NA 0 0 0 c.579+3A.G (l.n.711+3A.G) 0.14 0.17 NA 0 0 0 0 NA 0 0 0.69 c.2589-2599del11bp (l.n.2721- 31del11bp) 0.14 0.08 NA 0 0 0.38 0 NA 0 0 0 I507del 0.14 0.08 NA 0.15 0 0 0 0 0 0.28 0.69 R117C 0.14 0.08 NA 0.15 0 0 0 NA 0 0 0.23 of mutation panels [20]), listed in Table 4, were compared to those reported for several Central and Southeastern European countries [21-29]. Login to comment

PMID: 25033378 [PubMed] LaRusch J et al: "Mechanisms of CFTR functional variants that impair regulated bicarbonate permeation and increase risk for pancreatitis but not for cystic fibrosis."

No. Sentence Comment

269 67 SNPs (125GtoC, 1716G.A, 1717-1G.A, 1898+1G.A, 2183AA.G, 2184delA, 2789+5G.A, 3120+1G.A, 3659delC, 3849+10kbC.T, 621+ 1G.T, 711+5G.A, A455E, D110H, D1152H, D1270N, D443Y, D579G, F1052V, F1074L, F508C, F508del, G1069R, G1244E, G1349D, G178R, G542X, G551D, G551S, I1131L/V, I148T, I336K/T, I507del, I807M, IVS8T5, K1180T, L1065P, L967S, L997F, M1V, M470V, M952I, M952T, N1303K, P67L, Q1463Q, R1070Q, R1162X, R117C, R117H, R170H, R258G, R297Q, R31C, R352Q, R553X, R668C, R74W, R75Q, S1235R, S1255P, S485R, S977F, T338I, T854T, V201M, W1282X) were multiplexed into 6 wells; 14 SNPs (S492F, S945L, R74Q, R560T, R1162L, G85E, I1027T, R334W, R347P, G576A, 711+1G.T, 1001+11C.T, P1290P, 3199del6) were ascertained separately via TaqMan Gene Expression Assays, with repeat confirmation of all positive results. Login to comment

PMID: 25287046 [PubMed] Mornon JP et al: "Full-open and closed CFTR channels, with lateral tunnels from the cytoplasm and an alternative position of the F508 region, as revealed by molecular dynamics."

No. Sentence Comment

346 First, almost all CF-causing mutations involving residues located in the MSD transmembrane segments are encountered in MSD1 and generally concern positions lining the pore (G85E, E92K, D110H, P205S, R334W, I336K, T338I, S341P, R347H/R347P, and R352Q) (Fig. 7a). Login to comment

PMID: 25674778 [PubMed] Baker MW et al: "Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study."

No. Sentence Comment

15 Correspondence: Mei W. Baker (mwbaker@wisc.edu) Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study Mei W. Baker, MD1,2 , Anne E. Atkins, MPH2 , Suzanne K. Cordovado, PhD3 , Miyono Hendrix, MS3 , Marie C. Earley, PhD3 and Philip M. Farrell, MD, PhD1,4 Table 1ߒ CF-causing or varying consequences mutations in the MiSeqDx IUO Cystic Fibrosis System c.1521_1523delCTT (F508del) c.2875delG (3007delG) c.54-5940_273ߙ+ߙ10250del21kb (CFTRdele2,3) c.3909C>G (N1303K) c.3752G>A (S1251N) Mutations that cause CF when combined with another CF-causing mutation c.1624G>T (G542X) c.2988ߙ+ߙ1G>A (3120ߙ+ߙ1G->A) c.3964-78_4242ߙ+ߙ577del (CFTRdele22,23) c.613C>T (P205S) c.1021T>C (S341P) c.948delT (1078delT) c.2988G>A (3120G->A) c.328G>C (D110H) c.200C>T (P67L) c.1397C>A (S466X(C>A)) c.1022_1023insTC (1154insTC) c.2989-1G>A (3121-1G->A) c.3310G>T (E1104X) c.3937C>T (Q1313X) c.1397C>G (S466X(C>G)) c.1081delT (1213delT) c.3140-26A>G (3272-26A->G) c.1753G>T (E585X) c.658C>T (Q220X) c.1466C>A (S489X) c.1116ߙ+ߙ1G>A (1248ߙ+ߙ1G->A) c.3528delC (3659delC) c.178G>T (E60X) c.115C>T (Q39X) c.1475C>T (S492F) c.1127_1128insA (1259insA) c.3659delC (3791delC) c.2464G>T (E822X) c.1477C>T (Q493X) c.1646G>A (S549N) c.1209ߙ+ߙ1G>A (1341ߙ+ߙ1G->A) c.3717ߙ+ߙ12191C>T (3849ߙ+ߙ10kbC->T) c.2491G>T (E831X) c.1573C>T (Q525X) c.1645A>C (S549R) c.1329_1330insAGAT (1461ins4) c.3744delA (3876delA) c.274G>A (E92K) c.1654C>T (Q552X) c.1647T>G (S549R) c.1393-1G>A (1525-1G->A) c.3773_3774insT (3905insT) c.274G>T (E92X) c.2668C>T (Q890X) c.2834C>T (S945L) c.1418delG (1548delG) c.262_263delTT (394delTT) c.3731G>A (G1244E) c.292C>T (Q98X) c.1013C>T (T338I) c.1545_1546delTA (1677delTA) c.3873ߙ+ߙ1G>A (4005ߙ+ߙ1G->A) c.532G>A (G178R) c.3196C>T (R1066C) c.1558G>T (V520F) c.1585-1G>A (1717-1G->A) c.3884_3885insT (4016insT) c.988G>T (G330X) c.3197G>A (R1066H) c.3266G>A (W1089X) c.1585-8G>A (1717-8G->A) c.273ߙ+ߙ1G>A (405ߙ+ߙ1G->A) c.1652G>A (G551D) c.3472C>T (R1158X) c.3611G>A (W1204X) c.1679ߙ+ߙ1.6kbA>G (1811ߙ+ߙ1.6kbA->G) c.274-1G>A (406-1G->A) c.254G>A (G85E) c.3484C>T (R1162X) c.3612G>A (W1204X) c.1680-1G>A (1812-1G->A) c.4077_4080delTGTTinsAA (4209TGTT->AA) c.2908G>C (G970R) c.349C>T (R117C) c.3846G>A (W1282X) c.1766ߙ+ߙ1G>A (1898ߙ+ߙ1G->A) c.4251delA (4382delA) c.595C>T (H199Y) c.1000C>T (R334W) c.1202G>A (W401X) c.1766ߙ+ߙ3A>G (1898ߙ+ߙ 3A->G) c.325_327delTATinsG (457TAT->G) c.1007T>A (I336K) c.1040G>A (R347H) c.1203G>A (W401X) c.2012delT (2143delT) c.442delA (574delA) c.1519_1521delATC (I507del) c.1040G>C (R347P) c.2537G>A (W846X) c.2051_2052delAAinsG (2183AA->G) c.489ߙ+ߙ1G>T (621ߙ+ߙ 1G->T) c.2128A>T (K710X) c.1055G>A (R352Q) c.3276C>A (Y1092X (C>A)) c.2052delA (2184delA) c.531delT (663delT) c.3194T>C (L1065P) c.1657C>T (R553X) c.3276C>G (Y1092X (C>G)) c.2052_2053insA (2184insA) c.579ߙ+ߙ1G>T (711ߙ+ߙ 1G->T) c.3230T>C (L1077P) c.1679G>A (R560K) c.366T>A (Y122X) c.2175_2176insA (2307insA) c.579ߙ+ߙ3A>G (711ߙ+ߙ 3A->G) c.617T>G (L206W) c.1679G>C (R560T) - c.2215delG (2347delG) c.579ߙ+ߙ5G>A (711ߙ+ߙ 5G->A) c.1400T>C (L467P) c.2125C>T (R709X) - c.2453delT (2585delT) c.580-1G>T (712-1G->T) c.2195T>G (L732X) c.223C>T (R75X) - c.2490ߙ+ߙ1G>A (2622ߙ+ߙ1G->A) c.720_741delAGGGAG AATGATGATGAAGTAC (852del22) c.2780T>C (L927P) c.2290C>T (R764X) - c.2583delT (2711delT) c.1364C>A (A455E) c.3302T>A (M1101K) c.2551C>T (R851X) - c.2657ߙ+ߙ5G>A (2789ߙ+ߙ5G->A) c.1675G>A (A559T) c.1A>G (M1V) c.3587C>G (S1196X) - Mutations/variants that were validated in this study are in bold. CF, cystic fibrosis. Table 1ߒ Continued on next page reduce carrier detection and potentially improve the positive predictive value (PPV), the NBS goals of equity and the highest possible sensitivity become more difficult to achieve. Login to comment

PMID: 26014425 [PubMed] Girardet A et al: "The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus."

No. Sentence Comment

79 (unknown) Q39X c.115C4T p.Gln39* P67L c.200C4T p.Pro67Leu R75X c.223C4T p.Arg75* 405+1G4A c.273+1G4A 406-1G4A c.274-1G4A E92X c.274G4T p.Glu92* E92K c.274G4A p.Glu92Lys Q98X c.292C4T p.Gln98* 457TAT4G c.325_327delTATinsG p.Tyr109Glyfs*4 D110H c.328G4C p.Asp110His R117C c.349C4T p.Arg117Cys Y122X c.366 T4A p.Tyr122* 574delA c.442delA p.Ile148Leufs*5 444delA c.313delA p.Ile105Serfs*2 663delT c.531delT p.Ile177Metfs*12 G178R c.532G4A p.Gly178Arg 711+3 A4G c.579+3 A4G 711+5G4A c.579+5G4A 712-1G4T c.580-1G4T H199Y c.595C4T p.His199Tyr P205S c.613C4T p.Pro205Ser L206W c.617 T4G p.Leu206Trp Q220X c.658C4T p.Gln220* 852del22 c.720_741delAGGGAGAAT GATGATGAAGTAC p.Gly241Glufs*13 1078delT c.948delT p.Phe316Leufs*12 G330X c.988G4T p.Gly330* Table 1 (Continued ) HGVS nomenclature Legacy name cDNA nucleotide name Protein name R334W c.1000C4T p.Arg334Trp I336K c.1007 T4A p.Ile336Lys T338I c.1013C4T p.Thr338Ile 1154insTC c.1021_1022dupTC p.Phe342Hisfs*28 S341P c.1021 T4C p.Ser341Pro R347H c.1040G4A p.Arg347His 1213delT c.1081delT p.Trp361Glyfs*8 1248+1G4A c.1116+1G4A 1259insA c.1130dupA p.Gln378Alafs*4 W401X(TAG) c.1202G4A p.Trp401* W401X(TGA) c.1203G4A p.Trp401* 1341+1G4A c.1209+1G4A 1461ins4 c.1329_1330insAGAT p.Ile444Argfs*3 1525-1G4A c.1393-1G4A S466X c.1397C4A or c.1397C4G p.Ser466* L467P c.1400 T4C p.Leu467Pro S489X c.1466C4A p.Ser489* S492F c.1475C4T p.Ser492Phe 1677delTA c.1545_1546delTA p.Tyr515* V520F c.1558G4T p.Val520Phe 1717-1G4A c.1585-1G4A 1717-8G4A c.1585-8G4A S549R c.1645 A4C p.Ser549Arg S549N c.1646G4A p.Ser549Asn S549R c.1647 T4G p.Ser549Arg Q552X c.1654C4T p.Gln552* A559T c.1675G4A p.Ala559Thr 1811+1.6kbA4G c.1680-886 A4G 1812-1G4A c.1680-1G4A R560K c.1679G4A p.Arg560Lys E585X c.1753G4T p.Glu585* 1898+3 A4G c.1766+3 A4G 2143delT c.2012delT p.Leu671* 2184insA c.2052_2053insA p.Gln685Thrfs*4 2184delA c.2052delA p.Lys684Asnfs*38 R709X c.2125C4T p.Arg709* K710X c.2128 A4T p.Lys710* 2307insA c.2175dupA p.Glu726Argfs*4 L732X c.2195 T4G p.Leu732* 2347delG c.2215delG p.Val739Tyrfs*16 R764X c.2290C4T p.Arg764* 2585delT c.2453delT p.Leu818Trpfs*3 E822X c.2464G4T p.Glu822* 2622+1G4A c.2490+1G4A E831X c.2491G4T p.Glu831* W846X c.2537G4A p.Trp846* W846X (2670TGG4TGA) c.2538G4A p.Trp846* R851X c.2551C4T p.Arg851* 2711delT c.2583delT p.Phe861Leufs*3 S945L c.2834C4T p.Ser945Leu 2789+2insA c.2657+2_2657+3insA Q890X c.2668C4T p.Gln890* L927P c.2780 T4C p.Leu927Pro 3007delG c.2875delG p.Ala959Hisfs*9 G970R c.2908G4C p.Gly970Arg 3120G4A c.2988G4A function variants that cause CF disease when paired together; (ii) variants that retain residual CFTR function and are compatible with milder phenotypes such as CFTR-RD; (iii) variants with no clinical consequences; and (iv) variants of unproven or uncertain clinical relevance. Login to comment

PMID: 26229102 [PubMed] Corradi V et al: "Cystic Fibrosis Transmembrane Conductance Regulator (CFTR): CLOSED AND OPEN STATE CHANNEL MODELS."

No. Sentence Comment

139 In addition, I336K and T338I are known among CFTR disease-causing mutations (82, 83). Login to comment