ABCMdb

ABCC7 p.Tyr563Asn

ClinVar:	c.1687T>A , p.Tyr563Asn D , Pathogenic c.1687T>G , p.Tyr563Asp ? , not provided
CF databases:	c.1687T>C , p.Tyr563His (CFTR1) D , c.1687T>A , p.Tyr563Asn (CFTR1) ? , This mutation is found in a single family with 2 PS patients, but the mutation in the other chromosome is unknown. c.1687T>G , p.Tyr563Asp (CFTR1) ? , The Y563D mutation was detected on one African-American CF chromosome of 50 screened. It was not detected on any of 208 normal African-American chromosomes by ASO analysis. The patient is a 9 year old pancreatic insufficient male with mild lung disease. c.1688A>G , p.Tyr563Cys (CFTR1) ? , The above mutation was detected by SSCP and identified by direct sequencing. The mutation destroys an AccI site which was used for confirmation.
Predicted by SNAP2:	A: D (95%), C: D (95%), D: D (95%), E: D (95%), F: D (95%), G: D (95%), H: D (95%), I: D (95%), K: D (95%), L: D (91%), M: D (95%), N: D (75%), P: D (95%), Q: D (95%), R: D (95%), S: D (95%), T: D (95%), V: D (95%), W: D (95%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Cystic fibrosis mutations lead to carboxyl-termina... J Biol Chem. 2000 Jun 30;275(26):19577-84. Van Oene M, Lukacs GL, Rommens JM
Cystic fibrosis mutations lead to carboxyl-terminal fragments that highlight an early biogenesis step of the cystic fibrosis transmembrane conductance regulator.
J Biol Chem. 2000 Jun 30;275(26):19577-84., 2000-06-30 [PMID:10764788]

Abstract [show]
Inefficient delivery of the cystic fibrosis transmembrane conductance regulator (CFTR) to the surface of cells contributes to disease in the majority of cystic fibrosis patients. Analysis of cystic fibrosis-associated missense mutations in the first nucleotide binding domain (NBD1), including A455E, S549R, Y563N, and P574H, revealed reduced levels of mature CFTR with elevated levels of carboxyl-terminal polypeptide fragments of 105 and 90 kDa. These fragments appear early in biogenesis and degrade rapidly in four distinct cell types tested including the bronchial epithelial IB3-1 cell line. They were detected at highest levels with CFTRA455E where the 105-kDa fragment accounted for 40% of newly synthesized polypeptide but for only 20 and 7% of nascent wild type and mutant DeltaF508 proteins, respectively. The bands represent core- and unglycosylated forms of the same CFTR fragment supporting that precursor forms are correctly inserted into the membrane of the endoplasmic reticulum. Proteolytic cleavage would be predicted to occur on the cytosolic face of the endoplasmic reticulum within the NBD1-R domain segment, but pharmacological testing did not support involvement of the 26 S proteasome. The examined missense mutations in NBD1 manifest differently than the major mutant, DeltaF508, and highlight a critical conformational aspect of biogenesis of CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1 Analysis of cystic fibrosis-associated missense mutations in the first nucleotide binding domain (NBD1), including A455E, S549R, Y563N, and P574H, revealed reduced levels of mature CFTR with elevated levels of carboxyl-terminal polypeptide fragments of 105 and 90 kDa. Login to comment
41 EXPERIMENTAL PROCEDURES Construction of CFTR Expression Plasmids-The CFTR mutants A455E, S549R, P574H, and Y563N were generated from pBQ6.2 (34) as described previously (35). Login to comment
84 Analysis of the S549R mutant showed measurable but intermediate levels of band C, whereas A455E, Y563N, and P574H mutants showed markedly reduced levels using both tagged and untagged CFTR. Login to comment
238 The A455E, Y563N, and P574H mutations do appear to be able to achieve at least nominal levels of chloride conduction at the cell surface based both on the presenting phenotype in CF patients (54) and on single channel and whole cell current measurements (55) in heterologous expression systems. Login to comment
239 In contrast to the Y563N and P574H mutations, where low levels of mature band C forms were detectable with long exposure and/or long label incorporation times in HEK293 cells (data not shown), fully glycosylated protein could not be detected for A455E using our assay systems. Login to comment

[hide] Analysis by mass spectrometry of 100 cystic fibros... Hum Reprod. 2002 Aug;17(8):2066-72. Wang Z, Milunsky J, Yamin M, Maher T, Oates R, Milunsky A
Analysis by mass spectrometry of 100 cystic fibrosis gene mutations in 92 patients with congenital bilateral absence of the vas deferens.
Hum Reprod. 2002 Aug;17(8):2066-72., [PMID:12151438]

Abstract [show]
BACKGROUND: Limited mutation analysis for congenital bilateral absence of the vas deferens (CBAVD) has revealed only a minority of men in whom two distinct mutations were detected. We aimed to determine whether a more extensive mutation analysis would be of benefit in genetic counselling and prenatal diagnosis. METHODS: We studied a cohort of 92 men with CBAVD using mass spectrometry and primer oligonucleotide base extension to analyse an approximately hierarchical set of the most common 100 CF mutations. RESULTS: Analysis of 100 CF mutations identified 33/92 (35.9%) patients with two mutations and 29/92 (31.5%) with one mutation, compound heterozygosity accounting for 94% (31/33) of those with two mutations. This panel detected 12.0% more CBAVD men with at least one mutation and identified a second mutation in >50% of those considered to be heterozygotes under the two routine 25 mutation panel analyses. CONCLUSION: Compound heterozygosity of severe/mild mutations accounted for the vast majority of the CBAVD patients with two mutations, and underscores the value of a more extensive CF mutation panel for men with CBAVD. The CF100 panel enables higher carrier detection rates especially for men with CBAVD, their partners, partners of known CF carriers, and those with 'mild' CF with rarer mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 Given the frequency of CF mutations, especially in the Caucasian population ( in 25), and the common request by CBAVD men to sire their own offspring by using surgical Table I. The 100 most common cystic fibrosis mutations listed by exon Mutationa Exonb Frequency (%)c G85E 3 0.1 394delTT 3 Swedish E60X 3 Belgium R75X 3 405ϩ1G→A Int 3 R117H 4 0.30 Y122X 4 French 457TAT→G 4 Austria I148T 4 Canada (French Canadian) 574delA 4 444delA 4 R117L 4 621ϩ1G→T Int 4 0.72 711ϩ1G→T Int 5 Ͼ0.1 712-1G→T Int 5 711ϩ5G→A Int 5 Italy (Caucasian) L206W 6a R347P 7 0.24 1078delT 7 Ͼ0.1 R334W 7 Ͼ0.1 1154InsTC 7 T338I 7 Italy R347H 7 Turkey Q359K/T360K 7 Israel (Georgian Jews) I336K 7 R352Q 7 G330X 7 S364P 7 A455E 9 0.20 I507 10 0.21 F508 10 66.02 1609delCA 10 Spain (Caucasian) V520F 10 Q493X 10 C524X 10 G480C 10 Q493R 10 1717-1G→A Int 10 0.58 R553X 11 0.73 G551D 11 1.64 G542X 11 2.42 R560T 11 Ͼ0.1 S549N 11 Q552X 11 Italy S549I 11 Israel (Arabs) A559T 11 African American R553G 11 R560K 11 1812-1G→A Int 11 A561E 12 E585X 12 Y563D 12 Y563N 12 1898ϩ1G→A Int 12 0.22 1898ϩ1G→C Int 12 2183AA→G 13 Italian 2184delA 13 Ͻ0.1 K710X 13 2143delT 13 Moscow (Russian) 2184InsA 13 1949del84 13 Spain (Spanish) 2176InsC 13 2043delG 13 2307insA 13 2789ϩ5G→A Int 14b Ͼ0.1 2869insG 15 S945L 15 Q890X 15 3120G→A 16 2067 Table I. continued Mutationa Exonb Frequency (%)c 3120ϩ1G→A Int 16 African American 3272-26A→G Int 17a R1066C 17b Portugal (Portugese) L1077P 17b R1070Q 17b Bulgarian W1089X 17b M1101K 17b Canada (Hutterite) R1070P 17b R1162X 19 0.29 3659delC 19 Ͼ0.1 3849G→A 19 3662delA 19 3791delC 19 3821delT 19 Russian Q1238X 19 S1235R 19 France, South S1196X 19 K1177R 19 3849ϩ10kbC→T Int 19 0.24 3849ϩ4A→G Int 19 W1282X 20 1.22 S1251N 20 Dutch, Belgian 3905insT 20 Swiss, Acadian, Amish G1244E 20 R1283M 20 Welsh W1282R 20 D1270N 20 S1255X 20 African American 4005ϩ1G→A Int 20 N1303K 21 1.34 W1316X 21 aMutations were chosen according to their frequencies (Cystic Fibrosis Genetic Analysis Consortium, 1994; Zielenski and Tsui, 1995; Estivill et al., 1997). Login to comment

[hide] Comparison of the CFTR mutation spectrum in three ... Hum Mutat. 2003 Jul;22(1):105. Scotet V, Barton DE, Watson JB, Audrezet MP, McDevitt T, McQuaid S, Shortt C, De Braekeleer M, Ferec C, Le Marechal C
Comparison of the CFTR mutation spectrum in three cohorts of patients of Celtic origin from Brittany (France) and Ireland.
Hum Mutat. 2003 Jul;22(1):105., [PMID:12815607]

Abstract [show]
This study aims to compare the spectrum of the mutations identified in the gene responsible for cystic fibrosis in three cohorts of patients of Celtic origin from Brittany and Ireland. It included 389 patients from Brittany, 631 from Dublin and 139 from Cork. The CFTR gene analysis relied on the detection of the most common mutations, followed by a complete gene scanning using DGGE or D-HPLC. High mutation detection rates were obtained in each cohort: 99.6%, 96.8%, and 96.0% respectively. A high frequency of the c.1652_1655 del3 mutation (F508del: 74.8% to 81.3%) and of the "Celtic" mutation (c.1784G>A (G551D): 3.7% to 9.7%) was observed in each population. Apart from this, the mutation spectrums differed. In Brittany, the most common abnormalities were: c.1078delT (3.6%), c.4041C>G (N1303K: 1.4%), c.2670G>A (W846X(2): 1.0%) and c.1717-1G>A (1.0%), whereas in the cohort of Dublin, the main mutations were: c.482G>A (R117H: 3.0%), c.1811G>C (R560T: 2.4%) and c.621+1G>T (1.7%). Finally, in the Cork area, only the c.482G>A mutation (R117H) reached a frequency of 1%. Two previously-unreported mutations were identified in the Dublin cohort: c.2623-2A>G and c.3446T>G (M1105R). This collaborative study highlights the similarities of the CFTR alleles in the Breton and Irish populations, but also the disparities that exist between these populations, despite their common origin. Each population has its own history, with its mixture of founder effects and genetic drifts, which are at the origin of the current mutation distribution. The molecular study of the CFTR gene provides new tools for retracing European populations' histories.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 Spectrum of the CFTR Mutations Identified in the Cohorts from Brittany, Dublin Centre, and Cork Area Nucleotide Amino acid change * change Exon Number Frequency Number Frequency Number Frequency 211delG 2 1 0.1% 310G>T E60X 3 5 0.6% 4 0.3% 347C>A A72D 3 1 0.1% 368G>A W79X 3 1 0.1% 386G>A G85E 3 2 0.3% 3 0.2% 403G>A G91R 3 2 0.3% 482G>A R117H 4 4 0.5% 38 3.0% 4 1.4% 498T>A Y122X 4 1 0.1% 574delA 4 1 0.1% 577G>A G149R 4 1 0.1% 621+1G>T int 4 5 0.6% 21 1.7% 790C>T Q220X 6a 1 0.1% 875+1G>C int 6a 1 0.4% 905delG 6b 1 0.1% 1065C>G F311L 7 2 0.3% 1078delT 7 28 3.6% 1132C>T R334W 7 1 0.1% 1172G>A R347H 7 5 0.6% 1172G>T R347L 7 1 0.1% 1172G>C R347P 7 1 0.1% 1187G>A R352Q 7 3 0.2% 2 0.7% 1208A>G Q359R 7 1 0.1% 1154insTC 7 2 0.2% 1221delCT 7 2 0.3% 1248+1G>A int 7 1 0.1% 1249-27delTA int 7 1 0.4% 1334G>A W401X 8 1 0.1% 1461ins4 9 5 0.4% 1471delA 9 2 0.2% 1607C>T S492F 10 2 0.3% 1609C>T Q493X 10 1 0.1% 1648_1653delATC I507del 10 3 0.4% 10 0.8% 1 0.4% 1652_1655del 3 bp F508del 10 582 74.8% 966 76.5% 226 81.3% 1690G>T V520F 10 4 0.3% 1717-1G>A int 10 8 1.0% 9 0.7% 1756G>T G542X 11 5 0.6% 8 0.6% 1779T>G S549R 11 1 0.1% 1784G>A G551D 11 29 3.7% 82 6.5% 27 9.7% 1789C>G R553G 11 1 0.1% 1789C>T R553X 11 3 0.4% 1 0.1% 1806delA 11 1 0.1% 1811G>A R560K 11 2 0.3% 1811G>C R560T 11 30 2.4% 2 0.7% 1819T>A Y563N 12 1 0.1% 1853C>A P574H 12 1 0.1% 1898+1G>A int 12 1 0.1% 2184delA 13 1 0.1% 1 0.1% 2184insA 13 1 0.1% 2622+1G>A int 13 1 0.1% 2 0.2% 2622+1G>T int 13 1 0.1% 2623-2A>G ** int 13 1 0.1% 2670G>A W846X2 14a 8 1.0% 2752-1G>T int 14a 1 0.1% 2752-26A>G int 14a 2 0.2% 2789+5G>A int 14b 6 0.8% 2966C>T S945L 15 2 0.3% 3007delG 15 4 0.3% 3040G>C G970R 15 1 0.1% 3062C>T S977F 16 1 0.1% 3120+1G>A int 16 1 0.1% 3272-26A>G int 17a 4 0.5% 2 0.2% 2 0.7% 3320dupli(CTATG) 17b 1 0.1% 3329G>A R1066H 17b 1 0.1% 3340C>T R1070W 17b 1 0.1% 3408C>A Y1092X 17b 7 0.9% 3442G>T E1104X 17b 1 0.1% 3446T>G ** M1105R 17b 1 0.1% 3586G>C D1152H 18 1 0.1% 3601-17T>C + 1367delC int 18 + 9 1 0.1% 3616C>T R1162X 19 1 0.1% 2 0.2% 3659delC 19 2 0.2% 3832A>G I1234V 19 2 0.3% 3849+4A>G int 19 1 0.1% 3849+10kbC>T int 19 3 0.2% 3877G>A G1249R 20 1 0.1% 3884G>A S1251N 20 1 0.1% 3898insC 20 1 0.1% 3905insT 20 2 0.3% 3978G>A W1282X 20 3 0.4% 4005+1G>A int 20 6 0.8% 4016insT 21 1 0.1% 4041C>G N1303K 21 11 1.4% 5 0.4% 4136T>C L1335P 22 1 0.1% 1 0.4% 4279insA 23 1 0.1% Unidentified Unidentified - 3 0.4% 41 3.2% 11 4.0% Total 778 100.0% 1262 100.0% 278 100.0% * All nucleotide changes correspond to cDNA numbering. Login to comment

[hide] Relation of sweat chloride concentration to severi... Pediatr Pulmonol. 2004 Sep;38(3):204-9. Davis PB, Schluchter MD, Konstan MW
Relation of sweat chloride concentration to severity of lung disease in cystic fibrosis.
Pediatr Pulmonol. 2004 Sep;38(3):204-9., [PMID:15274098]

Abstract [show]
In cystic fibrosis (CF), sweat chloride concentration has been proposed as an index of CFTR function for testing systemic drugs designed to activate mutant CFTR. This suggestion arises from the assumption that greater residual CFTR function should lead to a lower sweat chloride concentration, as well as protection against severe lung disease. This logic gives rise to the hypothesis that the lower the sweat chloride concentration, the less severe the lung disease. In order to test this hypothesis, we studied 230 patients homozygous for the DeltaF508 allele, and 34 patients with at least one allele associated with pancreatic sufficiency, born since January 1, 1955, who have pulmonary function data and sweat chloride concentrations recorded in our CF center database, and no culture positive for B. cepacia. We calculated a severity index for pulmonary disease, using an approach which takes into account all available pulmonary function data as well as the patient's current age and survival status. Patients with alleles associated with pancreatic sufficiency had significantly better survival (P = 0.0083), lower sweat chloride concentration (81.4 +/- 23.8 vs. 103.2 +/- 14.2 mEq/l, P < 0.0001), slower rate of decline of FEV(1) % predicted (-0.75 +/- 0.34 vs. -2.34 +/- 0.17% predicted per year), and a better severity index than patients homozygous for the DeltaF508 allele (median 73rd percentile vs. median 55th percentile, P = 0.0004). However, the sweat chloride concentration did not correlate with the severity index, either in the population as a whole, or in the population of patients with alleles associated with pancreatic sufficiency, who are thought to have some residual CFTR function. These data suggest that, by itself, sweat chloride concentration does not necessarily predict a milder pulmonary course in patients with cystic fibrosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
27 T; G91R; E92K; P205S; G551S; Y563N; and P574H.23,24 Note that there are 36 mild alleles in 34 subjects, because two subjects had both the 3848 þ 10 kb C ! Login to comment

[hide] Nucleotide binding domains of human CFTR: a struct... Cell Mol Life Sci. 2005 Sep;62(18):2112-23. Eudes R, Lehn P, Ferec C, Mornon JP, Callebaut I
Nucleotide binding domains of human CFTR: a structural classification of critical residues and disease-causing mutations.
Cell Mol Life Sci. 2005 Sep;62(18):2112-23., [PMID:16132229]

Abstract [show]
Defective function of the cystic fibrosis (CF) transmembrane conductance regulator (CFTR) causes CF, the most frequent lethal inherited disease among the Caucasian population. The structure of this chloride ion channel includes two nucleotide-binding domains (NBDs), whose ATPase activity controls channel gating. Recently, the experimental structures of mouse and human CFTR NBD1 and our model of the human CFTR NBD1/NBD2 heterodimer have provided new insights into specific structural features of the CFTR NBD dimer. In the present work, we provide a structural classification of CF-causing mutations which may complement the existing functional classification. Our analysis also identified amino acid residues which may play a critical role in interdomain interaction and are located at the NBD1-NBD2 interface or on the surface of the dimer. In particular, a cluster of aromatic amino acids, which includes F508 and straddles the two NBDs, might be directly involved in the interaction of the NBD1/NBD2 heterodimer with the channel-forming membrane-spanning domains.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
227 Missense mutations affecting Y563 (Y563N, Y563D, Y563C) have been reported, reduced levels of mature CFTR being observed for Y563N [40]. Login to comment

[hide] Correctors promote folding of the CFTR in the endo... Biochem J. 2008 Jul 1;413(1):29-36. Loo TW, Bartlett MC, Clarke DM
Correctors promote folding of the CFTR in the endoplasmic reticulum.
Biochem J. 2008 Jul 1;413(1):29-36., 2008-07-01 [PMID:18361776]

Abstract [show]
Cystic fibrosis (CF) is most commonly caused by deletion of a residue (DeltaF508) in the CFTR (cystic fibrosis transmembrane conductance regulator) protein. The misfolded mutant protein is retained in the ER (endoplasmic reticulum) and is not trafficked to the cell surface (misprocessed mutant). Corrector molecules such as corr-2b or corr-4a are small molecules that increase the amount of functional CFTR at the cell surface. Correctors may function by stabilizing CFTR at the cell surface or by promoting folding in the ER. To test whether correctors promoted folding of CFTR in the ER, we constructed double-cysteine CFTR mutants that would be retained in the ER and only undergo cross-linking when the protein folds into a native structure. The mature form, but not the immature forms, of M348C(TM6)/T1142C(TM12) (where TM is transmembrane segment), T351C(TM6)/T1142C(TM12) and W356C(TM6)/W1145C(TM12) mutants were efficiently cross-linked. Mutations to the COPII (coatamer protein II) exit motif (Y(563)KDAD(567)) were then made in the cross-linkable cysteine mutants to prevent the mutant proteins from leaving the ER. Membranes were prepared from the mutants expressed in the absence or presence of correctors and subjected to disulfide cross-linking analysis. The presence of correctors promoted folding of the mutants as the efficiency of cross-linking increased from approx. 2-5% to 22-35%. The results suggest that correctors interact with CFTR in the ER to promote folding of the protein into a native structure.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
49 The COPII exit motif (Y563 KDAD567 ) was disrupted by introducing the Y563N or D565A/D567A changes into wild-type CFTR [21] or into the double-cysteine mutants. Login to comment
50 The F508 mutation was also introduced into the Y563N double-cysteine mutants. Login to comment
63 Cell-surface labelling of CFTR Wild-type CFTR or COPII exit motif mutant Y563N or D565A/ D567A was transiently expressed in HEK-293 cells. Login to comment
145 Tyr563 , Asp565 and Asp567 in the exit motif are evolutionarily Figure 5 Effect of COPII mutations on cross-linking of cysteine mutants (A) Whole-cell SDS extracts of HEK-293 cells expressing wild-type CFTR and wild-type CFTR containing Y563N or D565A/D567A mutation were subjected to immunoblot analysis. Login to comment
146 (B) HEK293 cells expressing wild-type CFTR or wild-type CFTR containing Y563N or D565A/D567A mutant were surface-labelled with sulfo-NHS-SS-biotin. Login to comment
148 (C) M348C(TM6)/T1142C(TM12)/Y563N, T351C(TM6)/T1142C(TM12)/Y563N or W356C(TM6)/W1145C(TM12)/Y563N mutant in the cysteine-less/V510A CFTR background was expressed in the absence (-) or presence (+) of 15 μM corr-4a. Login to comment
151 (D) Membranes were prepared from HEK-293 cells expressing M348C(TM6)/T1142C(TM12)/Y563N, T351C(TM6)/T1142C(TM12)/Y563N or W356C(TM6)/W1145C(TM12)/Y563N mutant in the cysteine-less/V510A background that were grown in the absence (-) or presence (+) 15 μM corr-4a. Login to comment
152 Samples were then treated with 0.025 mM M8M [M348C(TM6)/T1142C(TM12)/Y563N, W356C(TM6)/W1145C(TM12)/Y563N] or 0.2 mM M8M [T351C(TM6)/T1142C(TM12)/Y563N] for 10 min at 20◦C. The reactions were stopped by addition of SDS sample buffer containing 50 mM EDTA with (+) or without (-) 20 mM dithiothreitol (+DTT). Login to comment
158 Accordingly, we introduced the Y563N or D565A/D567A mutations in the COPII exit motif of wild-type CFTR. Login to comment
161 Cells expressing wild-type CFTR or Y563N or D565A/D567A mutant were treated with sulfo-NHS-SS-biotin, and then lysed with detergent. Login to comment
166 The Y563N mutation was then introduced into M348C(TM6)/T1142C(TM12), T351C(TM6)/T1142C(TM12) or W356C(TM6)/W1145C(TM12) mutant in the cysteine-less/V510A background. Login to comment
167 The mutants were each expressed in HEK-293 cells to test whether the Y563N mutation would block maturation when they were expressed in the absence or presence of corr-4a. Login to comment
171 Membranes were then prepared from cells transfected with M348C(TM6)/T1142C(TM12), T351C(TM6)/T1142C(TM12) or W356C(TM6)/W1145C(TM12) mutant cDNA in the cysteine-less/V510A/Y563N background and grown in the presence or absence of corr-4a. Login to comment
178 To confirm that the corrector was modulating folding in the ER, we expressed wild-type CFTR and T351C(TM6)/T1142C- (TM12)/Y563N/cysteine-less/V510A mutant in the absence or presence of brefeldin A before cross-linking with M8M cross-linker. Login to comment
182 Cross-linking of T351C(TM6)/ T1142C(TM12)/Y563N/cysteine-less/V510A mutant expressed in the presence of brefeldin A with or without corr-4a showed that there was more cross-linked product when corr-4a was present (Figure 6B). Login to comment
186 To test whether corr-4a promoted folding of the F508 mutant in the ER, the F508 mutation was introduced into Figure 6 Effect of brefeldin A on maturation of wild-type CFTR and cross-linking analysis of T351C(TM6)/T1142C(TM12)/Y563N/cysteine-less/V510A mutant HEK-293 cells were transfected with wild-type or T351C(TM6)/T1142C(TM12)/Y563N/cysteineless/V510A mutant CFTR cDNAs. Login to comment
189 (B) After 16 h, the medium in cells expressing T351C(TM6)/T1142C(TM12)/Y563N/cysteine-less/V510A mutant was replaced with fresh medium containing 10 μg/ml brefeldin A with (+) or without (-) 15 μM corr-4a. Login to comment
193 the double-cysteine mutants M348C(TM6)/T1142C-(TM12), T351C(TM6)/T1142C(TM12) and W356C(TM6)/W1145C- (TM12) in the Y563N/cysteine-less/V510A CFTR background. Login to comment
196 Expression in the presence of corr-4a, however, increased the yield of cross-linked product of F508/M348C(TM6)/T1142C(TM12)/Y563N/cysteine-less/ V510A, F508/T351C(TM6)/T1142C(TM12)/Y563N/cysteine-less/V510Aand F508/W356C(TM6)/W1145C(TM12)/Y563N/ cysteine-less/V510A mutants to 5, 11 and 10% respectively (Figure 7). Login to comment
207 The presence Figure 7 Effects of F508 mutation on cross-linking of COPII cysteine mutants HEK-293 cells expressing CFTR F508/M348C(TM6)/T1142C(TM12)/Y563N/cysteine-less/V510A, F508/T351C(TM6)/T1142C(TM12)/Y563N/cysteine-less/V510A or F508/ W356C(TM6)/W1145C(TM12)/Y563N/cysteine-less/V510A mutant were grown in the absence (-) or presence (+) of 15 μM corr-4a. Membranes were prepared, and cross-linking with M8M cross-linker was performed. Login to comment

[hide] Do common in silico tools predict the clinical con... Clin Genet. 2010 May;77(5):464-73. Epub 2009 Jan 6. Dorfman R, Nalpathamkalam T, Taylor C, Gonska T, Keenan K, Yuan XW, Corey M, Tsui LC, Zielenski J, Durie P
Do common in silico tools predict the clinical consequences of amino-acid substitutions in the CFTR gene?
Clin Genet. 2010 May;77(5):464-73. Epub 2009 Jan 6., [PMID:20059485]

Abstract [show]
Computational methods are used to predict the molecular consequences of amino-acid substitutions on the basis of evolutionary conservation or protein structure, but their utility in clinical diagnosis or prediction of disease outcome has not been well validated. We evaluated three popular computer programs, namely, PANTHER, SIFT and PolyPhen, by comparing the predicted clinical outcomes for a group of known CFTR missense mutations against the diagnosis of cystic fibrosis (CF) and clinical manifestations in cohorts of subjects with CF-disease and CFTR-related disorders carrying these mutations. Owing to poor specificity, none of tools reliably distinguished between individual mutations that confer CF disease from mutations found in subjects with a CFTR-related disorder or no disease. Prediction scores for CFTR mutations derived from PANTHER showed a significant overall statistical correlation with the spectrum of disease severity associated with mutations in the CFTR gene. In contrast, PolyPhen- and SIFT-derived scores only showed significant differences between CF-causing and non-CF variants. Current computational methods are not recommended for establishing or excluding a CF diagnosis, notably as a newborn screening strategy or in patients with equivocal test results.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 Mutations in the CFTR gene grouped by clinical category Cystic fibrosis CFTR-related disease No disease T338I D614G L320V V920L L90S M470V H199R S1251N I203M G550R P111A I148T Q1291H R560K L1388Q L183I R170H I1027T S549R D443Y P499A L1414S T908N R668C S549N A455E E1401K Q151K G27E I1234L Y563N R347P C866R S1118C P1290S R75Q A559T V520F P841R M469V E1401G P67L G85E S50Y E1409K R933G G458V G178R Y1032C R248T I980K G85V V392G L973P L137H T351S R334W I444S V938G R792G R560T R555G L1339F D1305E P574H V1240G T1053I D58G G551D L1335P I918M F994C S945L L558S F1337V R810G D1152H G1247R P574S R766M D579G W1098R H949R F200I R352Q L1077P K1351E M244K L206W M1101K D1154G L375F N1303K R1066C E528D D110Y R347H R1070Q A800G P1021S S549K A1364V V392A damaging` (is supposed to affect protein function or structure) and 'probably damaging` (high confidence of affecting protein function or structure). Login to comment

[hide] Estimating the age of CFTR mutations predominantly... J Cyst Fibros. 2008 Mar;7(2):168-73. Epub 2007 Sep 6. Fichou Y, Genin E, Le Marechal C, Audrezet MP, Scotet V, Ferec C
Estimating the age of CFTR mutations predominantly found in Brittany (Western France).
J Cyst Fibros. 2008 Mar;7(2):168-73. Epub 2007 Sep 6., [PMID:17825628]

Abstract [show]
BACKGROUND: Disparities in the spectrum of mutations within the cystic fibrosis (CF) transmembrane conductance regulator (CFTR) gene are commonly observed in populations from different ethnical and/or geographical origins. The occurrence of CF in Brittany (western France) is one of the highest in populations from Caucasian origin (<1/2000 in specific areas). The W846X(2), 1078delT and G551D mutations, as well as the I1027T polymorphism in cis with the DeltaF508 mutation (currently referred to as p.F508del) are particularly frequent in this area. We investigated the age of the respective variants in the region of interest. METHODS: Several polymorphic markers surrounding the CFTR gene were genotyped. Allele frequencies as well as mutation rates and other parameters were used to calculate the respective age of the most recent common ancestors in the region of interest by a previously employed, simple likelihood-based method. RESULTS: Following haplotype reconstruction and simulation, the ages were estimated to be approximately 600, 1000, 1200 and 600 years, respectively (with a 95% confidence interval). CONCLUSIONS: These datings thus provide historical insights in the context of understanding population migrations. They also underline the usefulness of this method for estimating the age of rare mutations with a limited number of carriers.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Primers amplifying the regions of interest were designed with PrimerQuestSM from Table 1 Genotypes of CF patients W846X2 1078delT G551D Mutation in trans Number Mutation in trans Number Mutation in trans Number ΔF508 6 ΔF508 21 ΔF508 18 R117C 1 1078delTa 2 E60K 1 ΔI507 1 4005+1GNA 2 W79X 1 Y563N 1 L610S 1 C225X 1 1078delTb 1 W846X2 b 1 F311L 1 621+1GNT 1 R1066H 1 R347H 1 2789+5GNA 1 1221delCT 1 G542X 1 3849+4ANG 1 1717-1GNA 1 G551D 1 3659delC 1 R553G 1 S942F 1 Y1092X 1 621+1GNT 1 2789+5GNA 1 4006-1GNA 1 Unidentified 1 Total 13 Total 31 Total 32 a One particular case: in this individual, the two chromosomes 7 are identical by descent. Login to comment

[hide] Genotyping microarray for the detection of more th... J Mol Diagn. 2005 Aug;7(3):375-87. Schrijver I, Oitmaa E, Metspalu A, Gardner P
Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations.
J Mol Diagn. 2005 Aug;7(3):375-87., [PMID:16049310]

Abstract [show]
Cystic fibrosis (CF), which is due to mutations in the cystic fibrosis transmembrane conductance regulator gene, is a common life-shortening disease. Although CF occurs with the highest incidence in Caucasians, it also occurs in other ethnicities with variable frequency. Recent national guidelines suggest that all couples contemplating pregnancy should be informed of molecular screening for CF carrier status for purposes of genetic counseling. Commercially available CF carrier screening panels offer a limited panel of mutations, however, making them insufficiently sensitive for certain groups within an ethnically diverse population. This discrepancy is even more pronounced when such carrier screening panels are used for diagnostic purposes. By means of arrayed primer extension technology, we have designed a genotyping microarray with 204 probe sites for CF transmembrane conductance regulator gene mutation detection. The arrayed primer extension array, based on a platform technology for disease detection with multiple applications, is a robust, cost-effective, and easily modifiable assay suitable for CF carrier screening and disease detection.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS. Login to comment

[hide] Diagnostic testing by CFTR gene mutation analysis ... J Mol Diagn. 2005 May;7(2):289-99. Schrijver I, Ramalingam S, Sankaran R, Swanson S, Dunlop CL, Keiles S, Moss RB, Oehlert J, Gardner P, Wassman ER, Kammesheidt A
Diagnostic testing by CFTR gene mutation analysis in a large group of Hispanics: novel mutations and assessment of a population-specific mutation spectrum.
J Mol Diagn. 2005 May;7(2):289-99., [PMID:15858154]

Abstract [show]
Characterization of CFTR mutations in the U.S. Hispanic population is vital to early diagnosis, genetic counseling, patient-specific treatment, and the understanding of cystic fibrosis (CF) pathogenesis. The mutation spectrum in Hispanics, however, remains poorly defined. A group of 257 self-identified Hispanics with clinical manifestations consistent with CF were studied by temporal temperature gradient electrophoresis and/or DNA sequencing. A total of 183 mutations were identified, including 14 different amino acid-changing novel variants. A significant proportion (78/85) of the different mutations identified would not have been detected by the ACMG/ACOG-recommended 25-mutation screening panel. Over one third of the mutations (27/85) occurred with a relative frequency >1%, which illustrates that the identified mutations are not all rare. This is supported by a comparison with other large CFTR studies. These results underscore the disparity in mutation identification between Caucasians and Hispanics and show utility for comprehensive diagnostic CFTR mutation analysis in this population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
103 Table 1. Continued Mutations in 257 patients Allele counts of each mutation % of variant alleles (183) % of all alleles tested (514) R1070W 1 0.55 0.19 R1158X 1 0.55 0.19 R1438W 1 0.55 0.19 R334W 2 1.09 0.39 R352W 1 0.55 0.19 R553X 2 1.09 0.39 R668C 2 1.09 0.39 R74W 3 1.64 0.58 R75X 3 1.64 0.58 S1235R 2 1.09 0.39 S492F 2 1.09 0.39 S549N 1 0.55 0.19 S573CS573C 1 0.55 0.19 S945L 1 0.55 0.19 T351S 1 0.55 0.19 T501A 2 1.09 0.39 T604ST604S 1 0.55 0.19 V11I 1 0.55 0.19 V201 mol/L 1 0.55 0.19 V232D 2 1.09 0.39 V754 mol/L 1 0.55 0.19 W1089X 2 1.09 0.39 W1098C 1 0.55 0.19 W1204X 4 2.19 0.78 Y563N 1 0.55 0.19 Y913XY913X 1 0.55 0.19 85 different mutations 183 100.00 35.60 Novel variants are in boldface, mutations on the ACMG/ACOG panel are italicized. Login to comment
187 CFTR Sequence Variants Identified in Five Comprehensive CFTR Studies in US Hispanics CFTR mutations Alleles Relative mutation frequency (%) (of 317) deltaF508 123 38.80 3876delA 15 4.70 G542X 12 3.80 406 - 1GϾA 8 2.50 3849 ϩ 10kbCϾT 5 1.60 R75X 4 1.30 935delA 4 1.30 S549N 4 1.30 W1204X 4 1.30 R334W 4 1.30 2055del9ϾA 3 1 R74W 3 1 H199Y 3 1 L206W 3 1 663delT 3 1 3120 ϩ 1GϾA 3 1 L997F 3 1 I1027T 3 1 R1066C 3 1 W1089X 3 1 D1270N 3 1 2105del13insAGAAA 3 1 Q98R 2 Ͻ1 E116K 2 Ͻ1 I148T 2 Ͻ1 R668C 2 Ͻ1 P205S 2 Ͻ1 V232D 2 Ͻ1 S492F 2 Ͻ1 T501A 2 Ͻ1 1949del84 2 Ͻ1 Q890X 2 Ͻ1 3271delGG 2 Ͻ1 3272 - 26AϾG 2 Ͻ1 G1244E 2 Ͻ1 D1445N 2 Ͻ1 R553X 2 Ͻ1 E588V 2 Ͻ1 1717 - 8GϾA 2 Ͻ1 A1009T 2 Ͻ1 S1235R 2 Ͻ1 G85E 1 Ͻ1 296 ϩ 28AϾG 1 Ͻ1 406 - 6TϾC 1 Ͻ1 V11I 1 Ͻ1 Q179K 1 Ͻ1 V201 mol/L 1 Ͻ1 874insTACA 1 Ͻ1 I285F 1 Ͻ1 deltaF311 1 Ͻ1 F311L 1 Ͻ1 L320V 1 Ͻ1 T351S 1 Ͻ1 R352W 1 Ͻ1 1248 ϩ 1GϾA 1 Ͻ1 1249 - 29delAT 1 Ͻ1 1288insTA 1 Ͻ1 1341 ϩ 80GϾA 1 Ͻ1 1429del7 1 Ͻ1 1525 - 42GϾA 1 Ͻ1 P439S 1 Ͻ1 1717 - 1GϾA 1 Ͻ1 1811 ϩ 1GϾA 1 Ͻ1 deltaI507 1 Ͻ1 G551D 1 Ͻ1 A559T 1 Ͻ1 Y563N 1 Ͻ1 (Table continues) In this study, we used temporal temperature gradient gel electrophoresis (TTGE) and direct DNA sequencing to increase the sensitivity of mutation detection in U.S. Hispanics, and to determine whether additional mutations are recurrent. Login to comment

[hide] Spectrum of CFTR mutations in cystic fibrosis and ... Hum Mutat. 2000;16(2):143-56. Claustres M, Guittard C, Bozon D, Chevalier F, Verlingue C, Ferec C, Girodon E, Cazeneuve C, Bienvenu T, Lalau G, Dumur V, Feldmann D, Bieth E, Blayau M, Clavel C, Creveaux I, Malinge MC, Monnier N, Malzac P, Mittre H, Chomel JC, Bonnefont JP, Iron A, Chery M, Georges MD
Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France.
Hum Mutat. 2000;16(2):143-56., [PMID:10923036]

Abstract [show]
We have collated the results of cystic fibrosis (CF) mutation analysis conducted in 19 laboratories in France. We have analyzed 7, 420 CF alleles, demonstrating a total of 310 different mutations including 24 not reported previously, accounting for 93.56% of CF genes. The most common were F508del (67.18%; range 61-80), G542X (2.86%; range 1-6.7%), N1303K (2.10%; range 0.75-4.6%), and 1717-1G>A (1.31%; range 0-2.8%). Only 11 mutations had relative frequencies >0. 4%, 140 mutations were found on a small number of CF alleles (from 29 to two), and 154 were unique. These data show a clear geographical and/or ethnic variation in the distribution of the most common CF mutations. This spectrum of CF mutations, the largest ever reported in one country, has generated 481 different genotypes. We also investigated a cohort of 800 French men with congenital bilateral absence of the vas deferens (CBAVD) and identified a total of 137 different CFTR mutations. Screening for the most common CF defects in addition to assessment for IVS8-5T allowed us to detect two mutations in 47.63% and one in 24.63% of CBAVD patients. In a subset of 327 CBAVD men who were more extensively investigated through the scanning of coding/flanking sequences, 516 of 654 (78. 90%) alleles were identified, with 15.90% and 70.95% of patients carrying one or two mutations, respectively, and only 13.15% without any detectable CFTR abnormality. The distribution of genotypes, classified according to the expected effect of their mutations on CFTR protein, clearly differed between both populations. CF patients had two severe mutations (87.77%) or one severe and one mild/variable mutation (11.33%), whereas CBAVD men had either a severe and a mild/variable (87.89%) or two mild/variable (11.57%) mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
109 h M1K, K14X, W19X, 211delG, G27E, R31C, 237insA, 241delAT, Q39X, 244delTA, 296+2T>C, 297-3C>T, W57X+F87L, 306delTAGA, P67L, A72D, 347delC, R75Q, 359insT, 394delT, 405+4A>G, Q98R, 457TAT>G, R117H+5T, R117H+I1027T, R117L, R117P, H139R, A141D, M152V, N186K, D192N, D192del, E193X, 711+1G>A, 711+3A>G, 712-1G>T, L206F, W216X, C225R, Q237E, G241R, 852del22, 876-14del12, 905delG, 993del5, E292K, Y304X, F311del, 1161delC, R347L, R352Q, W361R, 1215delG, S364P, S434X, D443Y, S466X, C491R, T501A, I506T, F508C, I507del+F508C, F508del+L467F, 1774delCT, R553G, 1802delC, 1806delA, A559E, Y563N, 1833delT, Y569C, Y569H, Y569X, G576X, G576A, T582I, 1898+3A>G+186-13C>G, 1918delGC, R600G, L610S, G628R, 2043delG, 2118del4, E664X, 2174insA, Q689X, K698R, K716X, L732X, 2347delG, 2372del8, R764X, 2423delG, S776X, 2634insT, 2640delT, C866Y, 2752-1G>T, W882X, Y913C, V920M, 2896insAG, H939D, H939R, D979V, D985H, D993Y, 3120G>A, I1005R, 3195del6, 3293delA, 3320ins5, W1063X, A1067T, 3359delCT, T1086I, W1089X, Y1092X+S1235R, W1098X, E1104X, R1128X, 3532AC>GTA, 3548TCAT>G, M1140del, 3600G>A, R1162L, 3667ins4, 3732delA+K1200E, S1206X, 3791delC, S1235R+5T, Q1238R, Q1238X, 3849+4A>G, T1246I, 3869insG, S1255P, R1283K, F1286S, 4005+1G>T, 4006-8T>A, 4015delA, N1303H, N1303I, 4172delGC, 4218insT, 4326delTC, Q1382X, 4375-1C>T, 4382delA, D1445N, CF40kbdel4-10, Cfdel17b. Login to comment

[hide] Modeling of nucleotide binding domains of ABC tran... J Bioenerg Biomembr. 1997 Oct;29(5):503-24. Bianchet MA, Ko YH, Amzel LM, Pedersen PL
Modeling of nucleotide binding domains of ABC transporter proteins based on a F1-ATPase/recA topology: structural model of the nucleotide binding domains of the cystic fibrosis transmembrane conductance regulator (CFTR).
J Bioenerg Biomembr. 1997 Oct;29(5):503-24., [PMID:9511935]

Abstract [show]
Members of the ABC transporter superfamily contain two nucleotide binding domains. To date, the three dimensional structure of no member of this super-family has been elucidated. To gain structural insight, the known structures of several other nucleotides binding proteins can be used as a framework for modeling these domains. We have modeled both nucleotide binding domains of the protein CFTR (Cystic Fibrosis Transmembrane Conductance Regulator) using the two similar domains of mitochondrial F1-ATPase. The models obtained, provide useful insights into the putative functions of these domains and their possible interaction as well as a rationale for the basis of Cystic Fibrosis causing mutations. First, the two nucleotide binding domains (folds) of CFTR are each predicted to span a 240-250 amino acid sequence rather than the 150-160 amino acid sequence originally proposed. Second, the first nucleotide binding fold, is predicted to catalyze significant rates of ATP hydrolysis as a catalytic base (E504) resides near the y phosphate of ATP. This prediction has been verified experimentally [Ko, Y.H., and Pedersen, P.L. (1995) J. Biol. Chem. 268, 24330-24338], providing support for the model. In contrast, the second nucleotide binding fold is predicted at best to be a weak ATPase as the glutamic acid residue is replaced with a glutamine. Third, F508, which when deleted causes approximately 70% of all cases of cystic fibrosis, is predicted to lie in a cleft near the nucleotide binding pocket. All other disease causing mutations within the two nucleotide binding domains of CFTR either reside near the Walker A and Walker B consensus motifs in the heart of the nucleotide binding pocket, or in the C motif which lies outside but near the nucleotide binding pocket. Finally, the two nucleotide binding domains of CFTR are predicted to interact, and in one of the two predicted orientations, F508 resides near the interface. This is the first report where both nucleotide binding domains of an ABC transporter and their putative domain-domain interactions have been modeled in three dimensions. The methods and the template used in this work can be used to analyze the structures and function of the nucleotide binding domains of all other members of the ABC transporter super-family.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
360 The CFTR NBD1 model that results (Fig. 6) gathers the disease causing mutations in three different clusters: (1) mutations affecting the nucleotide binding pocket and the putative general base: A455E, G458V, E504Q AI507 AF508 P574H; (2) mutations in motif C which are probably related to an interaction with region D: S549[R,N,I] G551[S,D], R553Q; and (3) mutations within or near motif B, L558S, A559T, R560T, Y563N and mutations S492F and G480C. Login to comment

[hide] Mutation characterization of CFTR gene in 206 Nort... Hum Mutat. 1996;8(4):340-7. Hughes DJ, Hill AJ, Macek M Jr, Redmond AO, Nevin NC, Graham CA
Mutation characterization of CFTR gene in 206 Northern Irish CF families: thirty mutations, including two novel, account for approximately 94% of CF chromosomes.
Hum Mutat. 1996;8(4):340-7., [PMID:8956039]

Abstract [show]
A variety of mutation detection techniques, including restriction endonuclease digestion, allele specific oligonucleotides, and automated fluorescent sequencing, were used in the identification of 15 CFTR mutations representing 86.7% of CF chromosomes in 206 Northern Irish cystic fibrosis (CF) families. A systematic analysis of the 27 exons and intron/exon boundaries of the CFTR gene was performed using denaturing gradient gel electrophoresis (DGGE) in an attempt to characterise the 55 unknown CF mutations in 51 patients. Twenty different mutations were detected by DGGE on 30 chromosomes accounting for a further 7.3% of CF alleles. Fifteen of these mutations had not previously been found in Northern Ireland, and two are novel, M1I(G > T) and V562L. In total, 30 CFTR mutations account for 93.9% of the 412 Northern Irish CF chromosomes tested. The three major CF mutations in Northern Ireland are delta F508, G551D, and R117H with respective frequencies of 68.0%, 5.1%, and 4.1%. The efficacy of the DGGE technique was proven by the detection of 77 out of 77 control variants from all the CFTR exons. DGGE is a highly efficient and sensitive method for mutation screening especially in large genes where the mutation spectrum is known to be heterogeneous.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 35%) PAGE (278) Kerem et al.. 1989AF508 G551D R117H R560T G542X 621+1G>T A1507 E60X 3659delC R553X 3120G>A 1l54insTC 2789+5G>A N1303K MlI(G>T) QW P67L 557delT 711+3A>G L206W R297Q V520F V562L Y563N Y917C R1162X 3849G>A 3849 +10kbC>T 3850-1GBA W1282X 280 21 17 12 9 9 7 3 2 1 68.0 5.1 4.1 2.9 2.2 2.2 1.7 0.7 0.5 0.24 17-32-13 (38;27%j 17-31-13(24,17%) 16-07-17 16-30-13 plus14 rare haplotypes (29) 16-07-17 23-33-13 (4) 22-31-13 (2) 21-31-13 17-07-17 (5) 16-31-13 16-35-13 17-58-13 17-35-13 16-07-17 17-07-17 23-29-13 (1) 23-31-13 (1) 16-07-17 16-31-13 16-07-17 15-29-13 16-33-13 16-07-17 17-07-17 16-07-17 16-07-17 16-30-13 16-32-17 17-31-13 16-31-14 16-46-13 16-30-14 17-07-17 DGGE(2) ' RD ASO's (11) DGGE(6) RD AR (8) DGGE (1) RD PAGE (5) DGGE (2) SEQ SEQ (2) DGGE (1) RD DGGE DGGE DGGE SEQ DGGE DGGE DGGE SEQ DGGE DGGE SEQ DGGE DGGE DGGE DGGE DGGE SEQ RD DGGE DGGE Cutting et al.. 1990 Dean et al.. 1990 Kerem et al., 1990 Kerem et al.. 1990 Zielenski et al., 1991 Kerem et al.. 1990 Malone et al., CFGAC Kerem et al., 1990 Cutting et al., 1990 Zielenski et al., CFGAC lannuzzi et al., 1991 Highsmith et al., 1990 Osborne et al., 1991 this study Savov et al., 1994 Hamosh et al., CFGAC Graham et al., 1992 Petreska et al., CFGAC Claustres et al., 1993 Graham et al., 1991 Jones et al.. 1992 this study Kerem et al.. 1990 Edkins & Creegan, CFGAC Gasparini et al., 1991 Cutting et al.. 1992 Highsmith et al., 1994 Audriizet et al., 1993 Vidaud et al., 1990 "Numbers in parentheses after the microsatellite haplotypes refer to the number of alleles haplotyped when not all of the available chromosomeswere typed. Login to comment
78 R560T, 1811+1G>C V562L, Y563N, 1898+lG>T 2143delT E827X R709X, K716X R764X E831X, W846X1,2711delT 2789+5G>A Y917C S977P. Login to comment

[hide] Fluorescent multiplex microsatellites used to defi... Hum Mutat. 1996;8(3):229-35. Hughes D, Wallace A, Taylor J, Tassabehji M, McMahon R, Hill A, Nevin N, Graham C
Fluorescent multiplex microsatellites used to define haplotypes associated with 75 CFTR mutations from the UK on 437 CF chromosomes.
Hum Mutat. 1996;8(3):229-35., [PMID:8889582]

Abstract [show]
The cystic fibrosis (CF) transmembrane conductance regulator (CFTR) gene contains three highly informative microsatellites: IVS8CA, IVS17bTA, and IVS17bCA. Their analysis improves prenatal/ carrier diagnosis and generates haplotypes from CF chromosomes that are strongly associated with specific mutations. Microsatellite haplotypes were defined for 75 CFTR mutations carried on 437 CF chromosomes (220 for delta F508, 217 for other mutations) from Northern Ireland and three English regions: the North-West, East Anglia, and the South. Fluorescently labelled microsatellites were amplified in a triplex PCR reaction and typed using an ABI 373A fluorescent fragment analyser. These mutations cover all the common and most of the rare CF defects found in the UK, and their corresponding haplotypes and geographic region are tabulated here. Ancient mutations, delta F508, G542X, N1303K, were associated with several related haplotypes due to slippage during replication, whereas other common mutations were associated with the one respective haplotype (e.g., G551D and R560T with 16-7-17, R117H with 16-30-13, 621 + 1G > T with 21-31-13, 3659delC with 16-35-13). This simple, fast, and automated method for fluorescent typing of these haplotypes will help to direct mutation screening for uncharacterised CF chromosomes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 CF 8CA-17bTA-17bCA Mutation chromosomes % Normal Laboratoryb Reference' HaplotVpe 1)15-29-13 557delT Nl Graham et al.. 1992 21 16-07-17 MU (G>T) 3) 16-24-13 4) 16-25-13 5) 16-29-13 6) 16-30-13 7) 16-30-14 8) 16-31-13 9) 16-31-14 10) 16-32-13 12) 16-33-13 13) 16-34-13 14) 16-35-13 11)16-32-17 15)1645-13 16) 1646-13 17) 1646-14 19) 17-07-17 18)16-53-13 20)17-29-14 21) 17-31-13 22) 17-32-13 23) 17-35-13 24) 17-51-11 25) 17-55-13 27) 17-58-13 28) 21-31-13 29) 22-31-13 31)23-22-17 26) 17-56-13 30) 22-33-13 32) 23-29-13 33)23-31-13 34)23-32-13 35)23-33-13 36)23-34-13 37) 23-36-13 38)24-22-17 39) 24-31-13 182delT P67L R75X L206W 1154insTC 146linsAGAT Q493x V520F 1717-1G>A G551D R560T V562L R709X S1196X L1254X R1283M G85E 2184insA 711+lG>T 3495delA 4279insA SlOR L88S R117C R117H G178R 1717-1G>A Y563N W1098R G1123R 3850- 1G>A E6OX %%deIT 1138insG R34P 2183AA>G 2184delA R1158X 1078delT R1162X 3849G>A Q141W R347P Y917C G2iX 711+3A>G 441delA 3130de115 3659delC 1898+1G>A R709X 2711delT R1158X E92K 3849+lOkbC>T 2118delAACT 4048insCC 296+1 2 T S Q22OX R297Q A1507 2789+5G>A 3120+1G>A W128W 1811+lG>C AF508 E831X R116W AF508 W846X1 3120G>A R785X R553X R553X R553X 621+1G>T G542X G542X Y1182X N1303K AF508 G54W 3041delG 1525-1G>A N1303K G542X G542X G542X 394delTT R709X N1303K 1 1 1 2 1 1 4 2 3 4 2 26 8 1 1 1 1 1 8 1 1 1 1 1 1 1 19 1 2 1 1 1 1 7 1 1 2 1 1 2 1 1 1 1 1 1 1 1 2 1 1 7 4 1 2 1 1 2 1 1 4 Asian 1 2 1Asian 5 4 i Afro-Caribbean 5 1 42 (19%) 1 1 57 (26%) 1 2 1 1 1 2 12 2 11.4 0.4 4.9 16.3 1.1 3.8 1.9 10.6 2.3 1.5 2.3 1.5 2.7 4.5 0.4 0.8 0.8 0.4 0.8 0.4 1 2 1 7 1 1 1Asian 1 1.5 0.8 0.8 NI G NI, M M NI NI. Login to comment

[hide] Screening Young syndrome patients for CFTR mutatio... Am J Respir Crit Care Med. 1995 Oct;152(4 Pt 1):1353-7. Friedman KJ, Teichtahl H, De Kretser DM, Temple-Smith P, Southwick GJ, Silverman LM, Highsmith WE Jr, Boucher RC, Knowles MR
Screening Young syndrome patients for CFTR mutations.
Am J Respir Crit Care Med. 1995 Oct;152(4 Pt 1):1353-7., [PMID:7551394]

Abstract [show]
Young syndrome is characterized by obstructive azoospermia associated with chronic sinobronchial disease of an infectious nature, but normal sweat-gland and pancreatic function as well as normal nasal potential differences. Congenital bilateral absence of the vas deferens (CBAVD) in some patients arises from mutations within the cystic fibrosis (CF) transmembrane regulator (CFTR) gene. Because of some similarities between Young syndrome, CF, and CBAVD, we evaluated 13 patients with Young syndrome, including screening for more than 30 different mutations within the CFTR gene. The mean age of the patients was 43 yr (range, 32 to 50 yr), and all were of northern European extraction. The sweat chloride concentration was normal in all patients (mean = 29 mEq/L; range, 8 to 43 mEq/L). Most had intermittent bronchial and sinus infections, but none was chronically colonized with Staphylococcus aureus or Pseudomonas aeruginosa. The FEV1 was normal or only mildly reduced in most patients (mean = 74%; range, 48 to 100% predicted). Of 26 Young syndrome chromosomes, we identified one with the recognized CF mutation delta F508. The incidence of CFTR mutations (1 in 26) did not differ significantly from the expected carrier frequency in this population. In summary, it is unlikely that the typical Young syndrome patient has a clinical disease associated with CFTR mutation on both alleles.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
78 Of the 13 Young syndrome patients, we identified one (Patient 5) who was het- CBAVD Dl152H D1270N G576A* R75Q* P67L Rl17H 3849 + 10 KB C > T G551S Rl17H Pancreatic Sufficient, Moderate Pulmonary Symptoms, Normal Sweat Chloride Concentrations Pancreatic Sufficient, Moderate Pulmonary Symptoms R347P 2789 + 5 G > A R334W G85E R347H R347L Rl17H G91R A455E S945L Y563N Q1291H R297Q R352Q L1065P 3850-3 T > G F1286S 3849 + 10 KB C > T TABLE 1 CFTR MUTATION SCREENING PANEL Severe M508 G551D R553X N1303K W1282X G542X 1717-1 G > A ~1507 R560T 3659deiC 621 + 1 G > T S549N TABLE 2 CLINICAL FEATURES OF YOUNG SYNDROME PATIENTS Patient Age Sweat CI- FEV, Paranasal Sputum No. Login to comment

[hide] Independent origins of cystic fibrosis mutations R... Am J Hum Genet. 1994 Nov;55(5):890-8. Morral N, Llevadot R, Casals T, Gasparini P, Macek M Jr, Dork T, Estivill X
Independent origins of cystic fibrosis mutations R334W, R347P, R1162X, and 3849 + 10kbC-->T provide evidence of mutation recurrence in the CFTR gene.
Am J Hum Genet. 1994 Nov;55(5):890-8., [PMID:7526685]

Abstract [show]
Microsatellite analysis of chromosomes carrying particular cystic fibrosis mutations has shown different haplotypes in four cases: R334W, R347P, R1162X, and 3849 + 10kbC-->T. To investigate the possibility of recurrence of these mutations, analysis of intra- and extragenic markers flanking these mutations has been performed. Recurrence is the most plausible explanation, as it becomes necessary to postulate either double recombinations or single recombinations in conjunction with slippage at one or more microsatellite loci, to explain the combination of mutations and microsatellites if the mutations arose only once. Also in support of recurrence, mutations R334W, R347P, R1162X, and 3849 + 10kbC-->T involve CpG dinucleotides, which are known to have an increased mutation rate. Although only 15.7% of point mutations in the coding sequence of CFTR have occurred at CpG dinucleotides, approximately half of these CpG sites have mutated at least once. Specific nucleotide positions of the coding region of CFTR, distinct from CpG sequences, also seem to have a higher mutation rate, and so it is possible that the mutations observed are recurrent. G-->A transitions are the most common change found in those positions involved in more than one mutational event in CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
112 CT................... 3863: G--oA .................. G-.T ................... 3980: G-jA .................. G--)T.................... 4374+1: G-A .................. G--oT.................... L88S L88X L88X G. Malone, personal communication Savov et al. 1994b Macek et al. 1992 406-1G--.C Bonizzato et al. 1992 406-1G- T T. Bienvenu, personal communication E92K Nunes et al. 1993 E92X Will et al. 1994 S549N Cutting et al. 1990 S5491 Kerem et al. 1990 R560K Ferec et al. 1992 R560T Kerem et al. 1990 Y563D A. Hamosh, personal communication Y563N Kerem et al. 1990 1898+1CG-.A Strong et al. 1992 1898+1GC-.C Cuppens et al. 1993 1898+3A-)C W. Lissens, personal communication 1898+3A--4G Cremonesi et al. 1992 G628R G628R 2183AA- G 2184delA 2184insA M1101K M1101R 3667del4 3667ins4 3791delC T12201 G1244E G1244V R1283K R1283M Fanen et al. 1992 Cuppens et al. 1993 Bozon et al. 1994 Dork et al., in press N. Kilin, personal communication Zielenski et al. 1993 Mercier et al. 1993 Chillon et al. 1994a Sangiuolo et al. 1993 M. Macek, Jr., personal communication Ghanem et al. 1994 Devoto et al. 1991 Savov et al. 1994a Chevalier et al., in press Cheadle et al. 1992 4374+1G-*A Fanen et al. 1992 4374+1G--iT Dork et al. 1993 of the most common allele. Login to comment

[hide] Mutation analysis in 600 French cystic fibrosis pa... J Med Genet. 1994 Jul;31(7):541-4. Chevalier-Porst F, Bonardot AM, Gilly R, Chazalette JP, Mathieu M, Bozon D
Mutation analysis in 600 French cystic fibrosis patients.
J Med Genet. 1994 Jul;31(7):541-4., [PMID:7525963]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) gene of 600 unrelated cystic fibrosis (CF) patients living in France (excluding Brittany) was screened for 105 different mutations. This analysis resulted in the identification of 86% of the CF alleles and complete genotyping of 76% of the patients. The most frequent mutations in this population after delta F508 (69% of the CF chromosomes) are G542X (3.3%), N1303K (1.8%), W1282X (1.5%), 1717-1G-->A (1.3%), 2184delA + 2183 A-->G (0.9%), and R553X (0.8%).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
21 Among the 104 other CFTR mutations tested on the 373 non-AF508 CF chromosomes, none of the following 58 mutations were found: G91R, 435 insA, 444delA, D11OH, 556delA, 557delT, R297Q, 1154insTC, R347L, R352Q, Q359K/T360K, 1221delCT, G480C, Q493R, V520F, C524X, 1706dell7, S549R (A-C), S549N, S549I, G551S, 1784delG, Q552X, L558S, A559T, R560T, R560K, Y563N, P574H, 2307insA, 2522insC, 2556insAT, E827X, Q890X, Y913C, 2991de132 (Dork et al, personal communication), L967S, 3320ins5, 3359delCT, H1085R, R1158X, 3662delA, 3667del4, 3667ins4, 3732delA, 3737delA, W1204X, 3750delAG, I 1234V, Q1238X, 3850- 3T-+G, 3860ins31, S1255X, 3898insC, D1270N, R1283M, F1286S, 4005 + I G-A. Forty-six other mutations were found on at Distribution of CFTR mutations found in our sample ofpopulation (1200 CF chromosomes) Mutations tested No of CF chromosomes Haplotypes Method with the mutation XV2C-KM19 (% of total CF alleles) Exon 3: G85E 4 (033) 3C HinfI/ASO394delTT 2 2B PAGEExon 4: R117H 1 B ASOY122X 2 2C MseI/sequenceI148T 1 B ASO621+IG-J* 1 B MseIIASOExon 5: 711+1G--T 8(07) 8A ASOExon 7: AF311 1 C PAGE/sequencelO78delT 5 (0-42) 5C PAGE/ASOR334W 5 (0-42) 2A,2C,ID MspIlASOR347P 5 (042) 5A CfoI/NcoIR347H 1 Cfol/sequenceExon 9: A455E 1 B ASOExon 10: S492F I C DdeI/sequenceQ493X 1 D ASOl609deICA 1 C PAGE/Ddel/sequenceA1507 3 (025) 3D PAGE/ASOAF508 827 (69) 794B,30D,2C,IA PAGEl677delTA 1 A PAGE/sequenceExon I11: 1717-IG--.A 16(1-3) 14B Modified primers + AvaIIG542X 40 (3-3) 29B,5D,2A Modified primers + BstNiS549R(T--*G) 2 2B ASOG551D 3 (025) 3B HincII/Sau3AR553X 10(0-8) 6A,1B,2C,ID Hincll/sequenceExon 12: 1898+IG--A 1 C ASO1898+ IG-C 2 IC ASOExon 13: l9l8deIGC 1 A PAGE/sequence1949de184 I C PAGE/sequenceG628R(G-+A) 2 2A Sequence2118de14 I c PAGE/sequence2143de1T 1 B PAGE/modified primers2184de1A+2183A--*G 11 (0-9) lIB PAGE/ASO2184de1A 1 ASOK710X 3 (025) IC XmnI2372de18 1 B PAGE/sequenceExon 15: S945L 1 C TaqlExon 17b:L1065P I MnlIL1077P 1 A ASOY1092X 3 (025) 2C,IA Rsal/ASOExon 19: RI1162X 6 (0-5) 5C,IA DdeI/ASO3659delC 3 (025) 3C ASOExon 20: G1244E 2 2A MboIIS1251N 2 2C RsaI3905insT 4 (0-33) 4C PAGE/ASOW1282X 18 (105) 15B,1D MnlI/ASOR1283K 1 C Mnll/sequenceExon 21: N1303K 22 (1-8) 18B,lA,ID Modified primers+BstNI 47 mutations 1031 (85 9) least one CF chromosome (table): 21 of them are very rare as they were found on only one CF chromosome in our population. Login to comment

[hide] Sensitivity of single-strand conformation polymorp... Hum Mol Genet. 1994 May;3(5):801-7. Ravnik-Glavac M, Glavac D, Dean M
Sensitivity of single-strand conformation polymorphism and heteroduplex method for mutation detection in the cystic fibrosis gene.
Hum Mol Genet. 1994 May;3(5):801-7., [PMID:7521710]

Abstract [show]
The gene responsible for cystic fibrosis (CF) contains 27 coding exons and more than 300 independent mutations have been identified. An efficient and optimized strategy is required to identify additional mutations and/or to screen patient samples for the presence of known mutations. We have tested several different conditions for performing single-stranded conformation polymorphism (SSCP) analysis in order to determine the efficiency of the method and to identify the optimum conditions for mutation detection. Each exon and corresponding exon boundaries were amplified. A panel of 134 known CF mutations were used to test the efficiency of detection of mutations. The SSCP conditions were varied by altering the percentage and cross-linking of the acrylamide, employing MDE (an acrylamide substitute), and by adding sucrose and glycerol. The presence of heteroduplexes could be detected on most gels and in some cases contributed to the ability to distinguish certain mutations. Each analysis condition detected 75-98% of the mutations, and all of the mutations could be detected by at least one condition. Therefore, an optimized SSCP analysis can be used to efficiently screen for mutations in a large gene.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
121 1078delT (35), L327R (Ravnik-Glavac a al., unpublished), R334W (36), D36K (31), R347L (26), R347P (14), A349V (26), R352Q (30), 1221delCT (34); Exon 8: W401X (31), 1342-1G-C (25); Exon 9: G458V (37), 1525 -1G-A (38); Exon 10: S492F (34), Q493X (39), 1609delCA (40,17), deltaI507 (39,41), deltaF5O8 (3), 1717-1G-A (39,42); Exon 11: G542X (39), S549N, G551D, R553X (43), R553Q (44), A559T (43), R560K (Fine et al., pers. comm.), R560T (39); Exon 12: Y563N (39), 1833delT (Schwartz et al., pers. comm.), P574H (39), 1898 + 1G-C (31), 1898+3A-G (Ferrari et al., pers. comm.); Exon 13: G628R(G-C) (31), Q685X (Firec et al., pers. comm.), K716X (26), L719X (Dork etal., pers. comm.), 2522insC (15), 2556insAT (45), E827X (34); Exon 14a: E831X (Ffrec et al., pers. comm.), R851X (29), 2721delll (31), C866Y (Audrezet et al., pers. comm.); Exon 14b: 2789+5G-A (Highsmith et al., pers. comm.); Exon 15: 2907denT (21), 2991del32 (Dark and TQmmler, pers. comm.), G970R (31); Exon 16: S977P, 3100insA (D6rk et al., pers. comm.); Exon 17a: I1005R (Dork and TQmmler, pers. comm.), 3272-1G-A (46); Exon 17b: H1054D (F6rec et al., pers. comm.), G1061R (Fdrec et al., pers. comm.), 332Oins5, R1066H, A1067T (34), R1066L (Fe"rec etal., pers. comm.), R1070Q (46), E1104X (Zielenski el al., pers. comm.), 3359delCT (46), L1077P (Bozon « a/., pers. comm.), H1085R (46), Y1092X (Bozon etal., pers. comm.), W1098R, M1101K (Zielenski et al., pers. comm.); Exon 18: D1152H (Highsmith et al., pers. comm.); Exon 19:R1162X (36), 3659delC (39), 3662delA (25), 3667del4 (Chillon et al., pers. comm.), 3737ddA (35), 3821ddT (15), I1234V (35), S1235R (31), Q1238X (26), 3849G-A (25), 385O-3T-G (38); Exon20:3860ins31 (Chillon etal., pers. comm.), S1255X (47), 3898insC (26), 3905insT (Malik et al., pers. comm.), D127ON (48), W1282X (49), Q1291R (Dork et al., pers. comm.), Exon 21: N1303H (35), N13O3K (50), W1316X (43); Exon 22: 11328L/4116delA (Dork and TQmmler, pers. comm.), E1371X (25); Exon 23: 4374+ 1G-T (38); Exon 24: 4382delA (Claustres et al., pers. comm.). Login to comment

[hide] Analysis of the CFTR gene confirms the high geneti... Hum Genet. 1994 Apr;93(4):447-51. Chillon M, Casals T, Gimenez J, Ramos MD, Palacio A, Morral N, Estivill X, Nunes V
Analysis of the CFTR gene confirms the high genetic heterogeneity of the Spanish population: 43 mutations account for only 78% of CF chromosomes.
Hum Genet. 1994 Apr;93(4):447-51., [PMID:7513293]

Abstract [show]
We have analysed 972 unrelated Spanish cystic fibrosis patients for 70 known mutations. Analysis was performed on exons 1, 2, 3, 4, 5, 6a, 6b, 7, 10, 11, 12, 13, 14a, 14b, 15, 16, 17b, 18, 19, 20 and 21 of the cystic fibrosis transmembrane regulator gene using single strand conformation polymorphism analysis and denaturing gradient gel electrophoresis. The major mutation delta F508 accounts for 50.6% of CF chromosomes, whereas another 42 mutations account for 27.6% of CF chromosomes, with 21.8% of Spanish CF chromosomes remaining uncharacterized. At present, we have identified 36 mutations that have frequency of less than 1% and that are spread over 15 different exons. This indicates that, in the Spanish population, with the exception of delta F508 (50.6%) and G542X (8%), the mutations are not concentrated in a few exons of the gene nor are there any predominating mutations. This high degree of genetic heterogeneity is mainly a result of the different ethnic groups that have populated Spain and of the maintenance of separated population sets (Basques, Arab-Andalusian, Mediterranean, Canarian and Gallician). The high proportion of CF chromosomes still unidentified (21.8%) together with association analysis with intragenic markers suggest that at least 100 different mutations causing CF are present in our population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 At present, we have not detected any Spanish CF chromosomes bearing any of the following mutations: 394delTA, Y122X, 556delA, 852de122, R347P, $492F, 1677delTA, V520F, Q552X, R553X, L559S, R560K, R560T, Y563N, P564H, 2043delG, 3320ins5, R1066H, A1067T, H1085R, 3732delA, 3737delA, I1234V, S1255P, 3898insC, Q1291H or 4005+ 1G---~A. Login to comment

[hide] Genetic determinants of airways' colonisation with... Lancet. 1993 Jan 23;341(8839):189-93. Kubesch P, Dork T, Wulbrand U, Kalin N, Neumann T, Wulf B, Geerlings H, Weissbrodt H, von der Hardt H, Tummler B
Genetic determinants of airways' colonisation with Pseudomonas aeruginosa in cystic fibrosis.
Lancet. 1993 Jan 23;341(8839):189-93., [PMID:7678316]

Abstract [show]
Exocrine pancreatic insufficiency and lung infection with Pseudomonas aeruginosa are major features of cystic fibrosis (CF). This monogenic disease is caused by mutations in the CF transmembrane conductance regulator (CFTR) gene. 267 children and adolescents with CF who were regularly seen at the same centre were assessed for an association of the CFTR mutation genotype with exocrine pancreatic function and the age of onset of chronic colonisation with P aeruginosa. The major mutation delta F508 accounted for 74% of CF alleles; 33 further CFTR mutations had been detected on the CF chromosomes of the study population by June, 1992. With the exception of delta F508/R347P compound heterozygotes, patients of the same mutation genotype were either pancreas insufficient (PI) or pancreas sufficient (PS). The age-specific colonisation rates with P aeruginosa were significantly lower in PS than in PI patients. The missense and splice site mutations that are "mild" CF alleles with respect to exocrine pancreatic function were also "low risk" alleles for the acquisition of P aeruginosa. On the other hand, the proportion of P aeruginosa-positive patients increased most rapidly in the PI delta F508 compound heterozygotes who were carrying a termination mutation in the nucleotide binding fold-encoding exons. Pancreatic status and the risk of chronic airways' colonisation with P aeruginosa are predisposed by the CFTR mutation genotype and can be differentiated by the type and location of the mutations in the CFTR gene.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
71 The NBF gene mutations in the study population were all severe disease alleles with respect to pancreatic function, and none of the rare PS alleles G551S, Y563N, P574H was detected.4,25 Hence, our findings do not necessarily imply that a NBF mutation should a priori be considered a "high risk" allele but rather that the more common "severe" disease alleles cluster in the NBF. Login to comment

[hide] Analysis of four diverse population groups indicat... Am J Hum Genet. 1992 Jun;50(6):1185-94. Cutting GR, Curristin SM, Nash E, Rosenstein BJ, Lerer I, Abeliovich D, Hill A, Graham C
Analysis of four diverse population groups indicates that a subset of cystic fibrosis mutations occur in common among Caucasians.
Am J Hum Genet. 1992 Jun;50(6):1185-94., [PMID:1376017]

Abstract [show]
To determine the nature and frequency of non-delta F508 cystic fibrosis (CF) mutations among diverse populations, we have sequenced exons 9-12 and 19-23 of the CF transmembrane conductance regulator (CFTR) gene from 128 CF chromosomes (39 U.S. Caucasian, 27 African-American, 42 Northern Irish, and 20 Israeli chromosomes). These regions were chosen because they encode the two putative ATP-binding folds of CFTR, domains which appear to have functional significance. In addition, CFTR exons 1 and 2 were analyzed in the American patients. Mutations were found on 49 of the 128 CF chromosomes. Nineteen different mutations were observed; six were novel, while the remaining 13 had been reported previously by our group or by other investigators. Six of nine different mutations found in African-American patients were unique to that population. However, the vast majority of the mutations found in U.S. Caucasians (eight of nine), Northern Irish (four of five), and Israelis (three of three) also occurred in other Caucasian groups. The preponderance of previously reported mutations in these three groups suggested that a subset of the non-delta F508 mutations occur in common among Caucasians. A survey of mutation frequencies in other Caucasian groups confirmed this observation. Unfortunately, this subset accounts for less than half of non-delta F508 CF mutations in most groups. These data suggest that screening for delta F508 and this select group of mutations will efficiently and economically maximize the number of CF mutations identified in Caucasian groups. However, it will be difficult to detect more than 90% of mutant CFTR alleles except in ethnically and geographically discrete populations where CF is the result of founder effect.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
66 The first patient had a missense mutation, tyrosine to asparagine at codon 563, on the other chromosome (Kerem et al. 1990). Login to comment

[hide] Genetic determination of exocrine pancreatic funct... Am J Hum Genet. 1992 Jun;50(6):1178-84. Kristidis P, Bozon D, Corey M, Markiewicz D, Rommens J, Tsui LC, Durie P
Genetic determination of exocrine pancreatic function in cystic fibrosis.
Am J Hum Genet. 1992 Jun;50(6):1178-84., [PMID:1376016]

Abstract [show]
We showed elsewhere that the pancreatic function status of cystic fibrosis (CF) patients could be correlated to mutations in the CF transmembrane conductance regulator (CFTR) gene. Although the majority of CF mutations--including the most common, delta F508--strongly correlated with pancreatic insufficiency (PI), approximately 10% of the mutant alleles may confer pancreatic sufficiency (PS). To extend this observation, genomic DNA of 538 CF patients with well-documented pancreatic function status were analyzed for a series of known mutations in their CFTR genes. Only 20 of the 25 mutations tested were found in this population. They accounted for 84% of the CF chromosomes, with delta F508 being the most frequent (71%), and the other mutations accounted for less than 5% each. A total of 30 different, complete genotypes could be determined in 394 (73%) of the patients. The data showed that each genotype was associated only with PI or only with PS, but not with both. This result is thus consistent with the hypothesis that PI and PS in CF are predisposed by the genotype at the CFTR locus; the PS phenotype occurs in patients who have one or two mild CFTR mutations, such as R117H, R334W, R347P, A455E, and P574H, whereas the PI phenotype occurs in patients with two severe alleles, such as delta F508, delta I507, Q493X, G542X, R553X, W1282X, 621 + 1G----T, 1717-1G----A, 556delA, 3659delC, I148T, G480C, V520F, G551D, and R560T.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 Intron 10: 1717-1G-'A Exon 11: G542X .......... S549R ........... G551D .......... R553X .......... R560T .......... Exon 12: Y563N .......... P574H .......... Exon 19: 3659delC ....... Exon 20: W1282X ....... Exon 21: N1303K ..... G460-C A deletion G482-'A A deletion T575-C 621 + 1G-T C1132-T C1172- G C1496-A G1505-'T G1570-T C1609-T 3-bp deletion 3-bp deletion G1690-T G1717-1-A G1756-T T1779-G G1784- A C1789-T G1811-C T1819- A C1853- A C deletion G3978-A C4041-G Asp 110-His Frameshift Arg 117-His Frameshift Ile 148-Thr Splice mutation Arg 334-Trp Arg 347-Pro Ala 455- Glu Gly 458-'Val Gly480-Cys Gln 493- stop del of Ile 507 del of Phe 508 Val 520-Phe Splice mutation Gly 542- stop Ser 549-'Arg Gly 551-WAsp Arg 553- stop Arg 560- Thr Tyr 563- Asn Pro 574-His Frameshift Trp 1282-stop Asn 1303-Lys Dean et al. 1990 White et al. 1991 Dean et al. 1990 Zielenski et al. 1991a F. Rininsland, D. Bozon, and L.-C. Tsui, unpublished data Zielenski et al. 1991a Gasparini et al. 1991 Dean et al. 1990 Kerem et al. 1990b Cuppens et al. 1990 Strong et al. 1991 Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1989b Jones et al. 1991 Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1990b Cutting et al. 1990 Cutting et al. 1990 Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1990b Vidaud et al. 1990 Osborne et al. 1990 PI or PS, but not with both. Login to comment
66 As shown in table 3, meconium ileus Table 2 1181 Table 3 Frequency of 25 CF Mutations in Chromosomes of the Toronto Study Population Mutation AF508 ...... G551D...... G542X...... 621 +1G-'T N1303K..... W1282X..... R1 17H...... 1717-1G-~A R560T...... A1507 ...... R553X...... V52OF ...... R334W ..... A455E...... I148T ...... Q493X...... P574H...... R347P ...... SS6delA ..... 3659delC .... G480C...... 444delA ..... D110H...... G458V...... S549R ...... Y563N...... Login to comment

[hide] Simultaneous screening for 11 mutations in the cys... Mol Cell Probes. 1992 Feb;6(1):33-9. Cuppens H, Buyse I, Baens M, Marynen P, Cassiman JJ
Simultaneous screening for 11 mutations in the cystic fibrosis transmembrane conductance regulator gene by multiplex amplification and reverse dot-blot.
Mol Cell Probes. 1992 Feb;6(1):33-9., [PMID:1372093]

Abstract [show]
An assay is described in which 11 mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene can be screened simultaneously. Six different exons of the CFTR gene are amplified in a single multiplex amplification. Biotinylated dUTP is incorporated into the different fragments during the amplification process. A sample of this mixture is then hybridized to 21 different poly-dT tailed oligonucleotide probes which are bound to a nylon membrane. In order to screen the different mutations in a single step hybridization, the length of the different oligonucleotides and the amount used in the assay were optimized. The detection is performed by binding avidin-alkaline phosphatase to the biotin, followed by a chemiluminescent reaction. By means of this fast and sensitive assay, about 85% of all the cystic fibrosis mutations in the Belgian population can be detected.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
19 Frequency of 31 mutations in the CFTR gene in 194 Belgian CF chromosomes The 51255X, W1316X ;5 S549N, G551D, R553X, A559T;6 D110H, R117H, R347P;' Q493X, S5491, S549R(T-+G), R560T, Y563N, P574H ;9 W846X, Y913C;10 2556insAT;" R334W;" S549R(A-+C);'6 444delA, 3821deIT;" 621 +1G-*T18 mutations were not present in this random sample of the Belgian CF population . Login to comment