ABCC7 p.Tyr563Asn
[switch to full view]Comments [show]
None has been submitted yet.
PMID: 10764788
[PubMed]
Van Oene M et al: "Cystic fibrosis mutations lead to carboxyl-terminal fragments that highlight an early biogenesis step of the cystic fibrosis transmembrane conductance regulator."
No.
Sentence
Comment
1
Analysis of cystic fibrosis-associated missense mutations in the first nucleotide binding domain (NBD1), including A455E, S549R, Y563N, and P574H, revealed reduced levels of mature CFTR with elevated levels of carboxyl-terminal polypeptide fragments of 105 and 90 kDa.
X
ABCC7 p.Tyr563Asn 10764788:1:129
status: NEW41 EXPERIMENTAL PROCEDURES Construction of CFTR Expression Plasmids-The CFTR mutants A455E, S549R, P574H, and Y563N were generated from pBQ6.2 (34) as described previously (35).
X
ABCC7 p.Tyr563Asn 10764788:41:107
status: NEW84 Analysis of the S549R mutant showed measurable but intermediate levels of band C, whereas A455E, Y563N, and P574H mutants showed markedly reduced levels using both tagged and untagged CFTR.
X
ABCC7 p.Tyr563Asn 10764788:84:98
status: NEW238 The A455E, Y563N, and P574H mutations do appear to be able to achieve at least nominal levels of chloride conduction at the cell surface based both on the presenting phenotype in CF patients (54) and on single channel and whole cell current measurements (55) in heterologous expression systems.
X
ABCC7 p.Tyr563Asn 10764788:238:11
status: NEW239 In contrast to the Y563N and P574H mutations, where low levels of mature band C forms were detectable with long exposure and/or long label incorporation times in HEK293 cells (data not shown), fully glycosylated protein could not be detected for A455E using our assay systems.
X
ABCC7 p.Tyr563Asn 10764788:239:19
status: NEW
PMID: 12151438
[PubMed]
Wang Z et al: "Analysis by mass spectrometry of 100 cystic fibrosis gene mutations in 92 patients with congenital bilateral absence of the vas deferens."
No.
Sentence
Comment
20
Given the frequency of CF mutations, especially in the Caucasian population ( in 25), and the common request by CBAVD men to sire their own offspring by using surgical Table I. The 100 most common cystic fibrosis mutations listed by exon Mutationa Exonb Frequency (%)c G85E 3 0.1 394delTT 3 Swedish E60X 3 Belgium R75X 3 405ϩ1G→A Int 3 R117H 4 0.30 Y122X 4 French 457TAT→G 4 Austria I148T 4 Canada (French Canadian) 574delA 4 444delA 4 R117L 4 621ϩ1G→T Int 4 0.72 711ϩ1G→T Int 5 Ͼ0.1 712-1G→T Int 5 711ϩ5G→A Int 5 Italy (Caucasian) L206W 6a R347P 7 0.24 1078delT 7 Ͼ0.1 R334W 7 Ͼ0.1 1154InsTC 7 T338I 7 Italy R347H 7 Turkey Q359K/T360K 7 Israel (Georgian Jews) I336K 7 R352Q 7 G330X 7 S364P 7 A455E 9 0.20 I507 10 0.21 F508 10 66.02 1609delCA 10 Spain (Caucasian) V520F 10 Q493X 10 C524X 10 G480C 10 Q493R 10 1717-1G→A Int 10 0.58 R553X 11 0.73 G551D 11 1.64 G542X 11 2.42 R560T 11 Ͼ0.1 S549N 11 Q552X 11 Italy S549I 11 Israel (Arabs) A559T 11 African American R553G 11 R560K 11 1812-1G→A Int 11 A561E 12 E585X 12 Y563D 12 Y563N 12 1898ϩ1G→A Int 12 0.22 1898ϩ1G→C Int 12 2183AA→G 13 Italian 2184delA 13 Ͻ0.1 K710X 13 2143delT 13 Moscow (Russian) 2184InsA 13 1949del84 13 Spain (Spanish) 2176InsC 13 2043delG 13 2307insA 13 2789ϩ5G→A Int 14b Ͼ0.1 2869insG 15 S945L 15 Q890X 15 3120G→A 16 2067 Table I. continued Mutationa Exonb Frequency (%)c 3120ϩ1G→A Int 16 African American 3272-26A→G Int 17a R1066C 17b Portugal (Portugese) L1077P 17b R1070Q 17b Bulgarian W1089X 17b M1101K 17b Canada (Hutterite) R1070P 17b R1162X 19 0.29 3659delC 19 Ͼ0.1 3849G→A 19 3662delA 19 3791delC 19 3821delT 19 Russian Q1238X 19 S1235R 19 France, South S1196X 19 K1177R 19 3849ϩ10kbC→T Int 19 0.24 3849ϩ4A→G Int 19 W1282X 20 1.22 S1251N 20 Dutch, Belgian 3905insT 20 Swiss, Acadian, Amish G1244E 20 R1283M 20 Welsh W1282R 20 D1270N 20 S1255X 20 African American 4005ϩ1G→A Int 20 N1303K 21 1.34 W1316X 21 aMutations were chosen according to their frequencies (Cystic Fibrosis Genetic Analysis Consortium, 1994; Zielenski and Tsui, 1995; Estivill et al., 1997).
X
ABCC7 p.Tyr563Asn 12151438:20:1129
status: NEW
PMID: 12815607
[PubMed]
Scotet V et al: "Comparison of the CFTR mutation spectrum in three cohorts of patients of Celtic origin from Brittany (France) and Ireland."
No.
Sentence
Comment
64
Spectrum of the CFTR Mutations Identified in the Cohorts from Brittany, Dublin Centre, and Cork Area Nucleotide Amino acid change * change Exon Number Frequency Number Frequency Number Frequency 211delG 2 1 0.1% 310G>T E60X 3 5 0.6% 4 0.3% 347C>A A72D 3 1 0.1% 368G>A W79X 3 1 0.1% 386G>A G85E 3 2 0.3% 3 0.2% 403G>A G91R 3 2 0.3% 482G>A R117H 4 4 0.5% 38 3.0% 4 1.4% 498T>A Y122X 4 1 0.1% 574delA 4 1 0.1% 577G>A G149R 4 1 0.1% 621+1G>T int 4 5 0.6% 21 1.7% 790C>T Q220X 6a 1 0.1% 875+1G>C int 6a 1 0.4% 905delG 6b 1 0.1% 1065C>G F311L 7 2 0.3% 1078delT 7 28 3.6% 1132C>T R334W 7 1 0.1% 1172G>A R347H 7 5 0.6% 1172G>T R347L 7 1 0.1% 1172G>C R347P 7 1 0.1% 1187G>A R352Q 7 3 0.2% 2 0.7% 1208A>G Q359R 7 1 0.1% 1154insTC 7 2 0.2% 1221delCT 7 2 0.3% 1248+1G>A int 7 1 0.1% 1249-27delTA int 7 1 0.4% 1334G>A W401X 8 1 0.1% 1461ins4 9 5 0.4% 1471delA 9 2 0.2% 1607C>T S492F 10 2 0.3% 1609C>T Q493X 10 1 0.1% 1648_1653delATC I507del 10 3 0.4% 10 0.8% 1 0.4% 1652_1655del 3 bp F508del 10 582 74.8% 966 76.5% 226 81.3% 1690G>T V520F 10 4 0.3% 1717-1G>A int 10 8 1.0% 9 0.7% 1756G>T G542X 11 5 0.6% 8 0.6% 1779T>G S549R 11 1 0.1% 1784G>A G551D 11 29 3.7% 82 6.5% 27 9.7% 1789C>G R553G 11 1 0.1% 1789C>T R553X 11 3 0.4% 1 0.1% 1806delA 11 1 0.1% 1811G>A R560K 11 2 0.3% 1811G>C R560T 11 30 2.4% 2 0.7% 1819T>A Y563N 12 1 0.1% 1853C>A P574H 12 1 0.1% 1898+1G>A int 12 1 0.1% 2184delA 13 1 0.1% 1 0.1% 2184insA 13 1 0.1% 2622+1G>A int 13 1 0.1% 2 0.2% 2622+1G>T int 13 1 0.1% 2623-2A>G ** int 13 1 0.1% 2670G>A W846X2 14a 8 1.0% 2752-1G>T int 14a 1 0.1% 2752-26A>G int 14a 2 0.2% 2789+5G>A int 14b 6 0.8% 2966C>T S945L 15 2 0.3% 3007delG 15 4 0.3% 3040G>C G970R 15 1 0.1% 3062C>T S977F 16 1 0.1% 3120+1G>A int 16 1 0.1% 3272-26A>G int 17a 4 0.5% 2 0.2% 2 0.7% 3320dupli(CTATG) 17b 1 0.1% 3329G>A R1066H 17b 1 0.1% 3340C>T R1070W 17b 1 0.1% 3408C>A Y1092X 17b 7 0.9% 3442G>T E1104X 17b 1 0.1% 3446T>G ** M1105R 17b 1 0.1% 3586G>C D1152H 18 1 0.1% 3601-17T>C + 1367delC int 18 + 9 1 0.1% 3616C>T R1162X 19 1 0.1% 2 0.2% 3659delC 19 2 0.2% 3832A>G I1234V 19 2 0.3% 3849+4A>G int 19 1 0.1% 3849+10kbC>T int 19 3 0.2% 3877G>A G1249R 20 1 0.1% 3884G>A S1251N 20 1 0.1% 3898insC 20 1 0.1% 3905insT 20 2 0.3% 3978G>A W1282X 20 3 0.4% 4005+1G>A int 20 6 0.8% 4016insT 21 1 0.1% 4041C>G N1303K 21 11 1.4% 5 0.4% 4136T>C L1335P 22 1 0.1% 1 0.4% 4279insA 23 1 0.1% Unidentified Unidentified - 3 0.4% 41 3.2% 11 4.0% Total 778 100.0% 1262 100.0% 278 100.0% * All nucleotide changes correspond to cDNA numbering.
X
ABCC7 p.Tyr563Asn 12815607:64:1301
status: NEW
PMID: 15274098
[PubMed]
Davis PB et al: "Relation of sweat chloride concentration to severity of lung disease in cystic fibrosis."
No.
Sentence
Comment
27
T; G91R; E92K; P205S; G551S; Y563N; and P574H.23,24 Note that there are 36 mild alleles in 34 subjects, because two subjects had both the 3848 þ 10 kb C !
X
ABCC7 p.Tyr563Asn 15274098:27:29
status: NEW
PMID: 16132229
[PubMed]
Eudes R et al: "Nucleotide binding domains of human CFTR: a structural classification of critical residues and disease-causing mutations."
No.
Sentence
Comment
227
Missense mutations affecting Y563 (Y563N, Y563D, Y563C) have been reported, reduced levels of mature CFTR being observed for Y563N [40].
X
ABCC7 p.Tyr563Asn 16132229:227:35
status: NEWX
ABCC7 p.Tyr563Asn 16132229:227:125
status: NEW
PMID: 18361776
[PubMed]
Loo TW et al: "Correctors promote folding of the CFTR in the endoplasmic reticulum."
No.
Sentence
Comment
49
The COPII exit motif (Y563 KDAD567 ) was disrupted by introducing the Y563N or D565A/D567A changes into wild-type CFTR [21] or into the double-cysteine mutants.
X
ABCC7 p.Tyr563Asn 18361776:49:70
status: NEW50 The F508 mutation was also introduced into the Y563N double-cysteine mutants.
X
ABCC7 p.Tyr563Asn 18361776:50:47
status: NEW63 Cell-surface labelling of CFTR Wild-type CFTR or COPII exit motif mutant Y563N or D565A/ D567A was transiently expressed in HEK-293 cells.
X
ABCC7 p.Tyr563Asn 18361776:63:73
status: NEW145 Tyr563 , Asp565 and Asp567 in the exit motif are evolutionarily Figure 5 Effect of COPII mutations on cross-linking of cysteine mutants (A) Whole-cell SDS extracts of HEK-293 cells expressing wild-type CFTR and wild-type CFTR containing Y563N or D565A/D567A mutation were subjected to immunoblot analysis.
X
ABCC7 p.Tyr563Asn 18361776:145:240
status: NEW146 (B) HEK293 cells expressing wild-type CFTR or wild-type CFTR containing Y563N or D565A/D567A mutant were surface-labelled with sulfo-NHS-SS-biotin.
X
ABCC7 p.Tyr563Asn 18361776:146:72
status: NEW148 (C) M348C(TM6)/T1142C(TM12)/Y563N, T351C(TM6)/T1142C(TM12)/Y563N or W356C(TM6)/W1145C(TM12)/Y563N mutant in the cysteine-less/V510A CFTR background was expressed in the absence (-) or presence (+) of 15 μM corr-4a.
X
ABCC7 p.Tyr563Asn 18361776:148:28
status: NEWX
ABCC7 p.Tyr563Asn 18361776:148:59
status: NEWX
ABCC7 p.Tyr563Asn 18361776:148:92
status: NEW151 (D) Membranes were prepared from HEK-293 cells expressing M348C(TM6)/T1142C(TM12)/Y563N, T351C(TM6)/T1142C(TM12)/Y563N or W356C(TM6)/W1145C(TM12)/Y563N mutant in the cysteine-less/V510A background that were grown in the absence (-) or presence (+) 15 μM corr-4a.
X
ABCC7 p.Tyr563Asn 18361776:151:82
status: NEWX
ABCC7 p.Tyr563Asn 18361776:151:113
status: NEWX
ABCC7 p.Tyr563Asn 18361776:151:146
status: NEW152 Samples were then treated with 0.025 mM M8M [M348C(TM6)/T1142C(TM12)/Y563N, W356C(TM6)/W1145C(TM12)/Y563N] or 0.2 mM M8M [T351C(TM6)/T1142C(TM12)/Y563N] for 10 min at 20◦C. The reactions were stopped by addition of SDS sample buffer containing 50 mM EDTA with (+) or without (-) 20 mM dithiothreitol (+DTT).
X
ABCC7 p.Tyr563Asn 18361776:152:69
status: NEWX
ABCC7 p.Tyr563Asn 18361776:152:100
status: NEWX
ABCC7 p.Tyr563Asn 18361776:152:146
status: NEW158 Accordingly, we introduced the Y563N or D565A/D567A mutations in the COPII exit motif of wild-type CFTR.
X
ABCC7 p.Tyr563Asn 18361776:158:31
status: NEW161 Cells expressing wild-type CFTR or Y563N or D565A/D567A mutant were treated with sulfo-NHS-SS-biotin, and then lysed with detergent.
X
ABCC7 p.Tyr563Asn 18361776:161:35
status: NEW166 The Y563N mutation was then introduced into M348C(TM6)/T1142C(TM12), T351C(TM6)/T1142C(TM12) or W356C(TM6)/W1145C(TM12) mutant in the cysteine-less/V510A background.
X
ABCC7 p.Tyr563Asn 18361776:166:4
status: NEW167 The mutants were each expressed in HEK-293 cells to test whether the Y563N mutation would block maturation when they were expressed in the absence or presence of corr-4a.
X
ABCC7 p.Tyr563Asn 18361776:167:69
status: NEW171 Membranes were then prepared from cells transfected with M348C(TM6)/T1142C(TM12), T351C(TM6)/T1142C(TM12) or W356C(TM6)/W1145C(TM12) mutant cDNA in the cysteine-less/V510A/Y563N background and grown in the presence or absence of corr-4a.
X
ABCC7 p.Tyr563Asn 18361776:171:172
status: NEW178 To confirm that the corrector was modulating folding in the ER, we expressed wild-type CFTR and T351C(TM6)/T1142C- (TM12)/Y563N/cysteine-less/V510A mutant in the absence or presence of brefeldin A before cross-linking with M8M cross-linker.
X
ABCC7 p.Tyr563Asn 18361776:178:122
status: NEW182 Cross-linking of T351C(TM6)/ T1142C(TM12)/Y563N/cysteine-less/V510A mutant expressed in the presence of brefeldin A with or without corr-4a showed that there was more cross-linked product when corr-4a was present (Figure 6B).
X
ABCC7 p.Tyr563Asn 18361776:182:42
status: NEW186 To test whether corr-4a promoted folding of the F508 mutant in the ER, the F508 mutation was introduced into Figure 6 Effect of brefeldin A on maturation of wild-type CFTR and cross-linking analysis of T351C(TM6)/T1142C(TM12)/Y563N/cysteine-less/V510A mutant HEK-293 cells were transfected with wild-type or T351C(TM6)/T1142C(TM12)/Y563N/cysteineless/V510A mutant CFTR cDNAs.
X
ABCC7 p.Tyr563Asn 18361776:186:228
status: NEWX
ABCC7 p.Tyr563Asn 18361776:186:334
status: NEW189 (B) After 16 h, the medium in cells expressing T351C(TM6)/T1142C(TM12)/Y563N/cysteine-less/V510A mutant was replaced with fresh medium containing 10 μg/ml brefeldin A with (+) or without (-) 15 μM corr-4a.
X
ABCC7 p.Tyr563Asn 18361776:189:71
status: NEW193 the double-cysteine mutants M348C(TM6)/T1142C-(TM12), T351C(TM6)/T1142C(TM12) and W356C(TM6)/W1145C- (TM12) in the Y563N/cysteine-less/V510A CFTR background.
X
ABCC7 p.Tyr563Asn 18361776:193:115
status: NEW196 Expression in the presence of corr-4a, however, increased the yield of cross-linked product of F508/M348C(TM6)/T1142C(TM12)/Y563N/cysteine-less/ V510A, F508/T351C(TM6)/T1142C(TM12)/Y563N/cysteine-less/V510Aand F508/W356C(TM6)/W1145C(TM12)/Y563N/ cysteine-less/V510A mutants to 5, 11 and 10% respectively (Figure 7).
X
ABCC7 p.Tyr563Asn 18361776:196:124
status: NEWX
ABCC7 p.Tyr563Asn 18361776:196:181
status: NEWX
ABCC7 p.Tyr563Asn 18361776:196:239
status: NEW207 The presence Figure 7 Effects of F508 mutation on cross-linking of COPII cysteine mutants HEK-293 cells expressing CFTR F508/M348C(TM6)/T1142C(TM12)/Y563N/cysteine-less/V510A, F508/T351C(TM6)/T1142C(TM12)/Y563N/cysteine-less/V510A or F508/ W356C(TM6)/W1145C(TM12)/Y563N/cysteine-less/V510A mutant were grown in the absence (-) or presence (+) of 15 μM corr-4a. Membranes were prepared, and cross-linking with M8M cross-linker was performed.
X
ABCC7 p.Tyr563Asn 18361776:207:149
status: NEWX
ABCC7 p.Tyr563Asn 18361776:207:205
status: NEWX
ABCC7 p.Tyr563Asn 18361776:207:264
status: NEW
PMID: 20059485
[PubMed]
Dorfman R et al: "Do common in silico tools predict the clinical consequences of amino-acid substitutions in the CFTR gene?"
No.
Sentence
Comment
64
Mutations in the CFTR gene grouped by clinical category Cystic fibrosis CFTR-related disease No disease T338I D614G L320V V920L L90S M470V H199R S1251N I203M G550R P111A I148T Q1291H R560K L1388Q L183I R170H I1027T S549R D443Y P499A L1414S T908N R668C S549N A455E E1401K Q151K G27E I1234L Y563N R347P C866R S1118C P1290S R75Q A559T V520F P841R M469V E1401G P67L G85E S50Y E1409K R933G G458V G178R Y1032C R248T I980K G85V V392G L973P L137H T351S R334W I444S V938G R792G R560T R555G L1339F D1305E P574H V1240G T1053I D58G G551D L1335P I918M F994C S945L L558S F1337V R810G D1152H G1247R P574S R766M D579G W1098R H949R F200I R352Q L1077P K1351E M244K L206W M1101K D1154G L375F N1303K R1066C E528D D110Y R347H R1070Q A800G P1021S S549K A1364V V392A damaging` (is supposed to affect protein function or structure) and 'probably damaging` (high confidence of affecting protein function or structure).
X
ABCC7 p.Tyr563Asn 20059485:64:289
status: NEW
PMID: 17825628
[PubMed]
Fichou Y et al: "Estimating the age of CFTR mutations predominantly found in Brittany (Western France)."
No.
Sentence
Comment
51
Primers amplifying the regions of interest were designed with PrimerQuestSM from Table 1 Genotypes of CF patients W846X2 1078delT G551D Mutation in trans Number Mutation in trans Number Mutation in trans Number ΔF508 6 ΔF508 21 ΔF508 18 R117C 1 1078delTa 2 E60K 1 ΔI507 1 4005+1GNA 2 W79X 1 Y563N 1 L610S 1 C225X 1 1078delTb 1 W846X2 b 1 F311L 1 621+1GNT 1 R1066H 1 R347H 1 2789+5GNA 1 1221delCT 1 G542X 1 3849+4ANG 1 1717-1GNA 1 G551D 1 3659delC 1 R553G 1 S942F 1 Y1092X 1 621+1GNT 1 2789+5GNA 1 4006-1GNA 1 Unidentified 1 Total 13 Total 31 Total 32 a One particular case: in this individual, the two chromosomes 7 are identical by descent.
X
ABCC7 p.Tyr563Asn 17825628:51:311
status: NEW
PMID: 16049310
[PubMed]
Schrijver I et al: "Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations."
No.
Sentence
Comment
51
Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS.
X
ABCC7 p.Tyr563Asn 16049310:51:3422
status: NEW
PMID: 15858154
[PubMed]
Schrijver I et al: "Diagnostic testing by CFTR gene mutation analysis in a large group of Hispanics: novel mutations and assessment of a population-specific mutation spectrum."
No.
Sentence
Comment
103
Table 1. Continued Mutations in 257 patients Allele counts of each mutation % of variant alleles (183) % of all alleles tested (514) R1070W 1 0.55 0.19 R1158X 1 0.55 0.19 R1438W 1 0.55 0.19 R334W 2 1.09 0.39 R352W 1 0.55 0.19 R553X 2 1.09 0.39 R668C 2 1.09 0.39 R74W 3 1.64 0.58 R75X 3 1.64 0.58 S1235R 2 1.09 0.39 S492F 2 1.09 0.39 S549N 1 0.55 0.19 S573CS573C 1 0.55 0.19 S945L 1 0.55 0.19 T351S 1 0.55 0.19 T501A 2 1.09 0.39 T604ST604S 1 0.55 0.19 V11I 1 0.55 0.19 V201 mol/L 1 0.55 0.19 V232D 2 1.09 0.39 V754 mol/L 1 0.55 0.19 W1089X 2 1.09 0.39 W1098C 1 0.55 0.19 W1204X 4 2.19 0.78 Y563N 1 0.55 0.19 Y913XY913X 1 0.55 0.19 85 different mutations 183 100.00 35.60 Novel variants are in boldface, mutations on the ACMG/ACOG panel are italicized.
X
ABCC7 p.Tyr563Asn 15858154:103:589
status: NEW187 CFTR Sequence Variants Identified in Five Comprehensive CFTR Studies in US Hispanics CFTR mutations Alleles Relative mutation frequency (%) (of 317) deltaF508 123 38.80 3876delA 15 4.70 G542X 12 3.80 406 - 1GϾA 8 2.50 3849 ϩ 10kbCϾT 5 1.60 R75X 4 1.30 935delA 4 1.30 S549N 4 1.30 W1204X 4 1.30 R334W 4 1.30 2055del9ϾA 3 1 R74W 3 1 H199Y 3 1 L206W 3 1 663delT 3 1 3120 ϩ 1GϾA 3 1 L997F 3 1 I1027T 3 1 R1066C 3 1 W1089X 3 1 D1270N 3 1 2105del13insAGAAA 3 1 Q98R 2 Ͻ1 E116K 2 Ͻ1 I148T 2 Ͻ1 R668C 2 Ͻ1 P205S 2 Ͻ1 V232D 2 Ͻ1 S492F 2 Ͻ1 T501A 2 Ͻ1 1949del84 2 Ͻ1 Q890X 2 Ͻ1 3271delGG 2 Ͻ1 3272 - 26AϾG 2 Ͻ1 G1244E 2 Ͻ1 D1445N 2 Ͻ1 R553X 2 Ͻ1 E588V 2 Ͻ1 1717 - 8GϾA 2 Ͻ1 A1009T 2 Ͻ1 S1235R 2 Ͻ1 G85E 1 Ͻ1 296 ϩ 28AϾG 1 Ͻ1 406 - 6TϾC 1 Ͻ1 V11I 1 Ͻ1 Q179K 1 Ͻ1 V201 mol/L 1 Ͻ1 874insTACA 1 Ͻ1 I285F 1 Ͻ1 deltaF311 1 Ͻ1 F311L 1 Ͻ1 L320V 1 Ͻ1 T351S 1 Ͻ1 R352W 1 Ͻ1 1248 ϩ 1GϾA 1 Ͻ1 1249 - 29delAT 1 Ͻ1 1288insTA 1 Ͻ1 1341 ϩ 80GϾA 1 Ͻ1 1429del7 1 Ͻ1 1525 - 42GϾA 1 Ͻ1 P439S 1 Ͻ1 1717 - 1GϾA 1 Ͻ1 1811 ϩ 1GϾA 1 Ͻ1 deltaI507 1 Ͻ1 G551D 1 Ͻ1 A559T 1 Ͻ1 Y563N 1 Ͻ1 (Table continues) In this study, we used temporal temperature gradient gel electrophoresis (TTGE) and direct DNA sequencing to increase the sensitivity of mutation detection in U.S. Hispanics, and to determine whether additional mutations are recurrent.
X
ABCC7 p.Tyr563Asn 15858154:187:1416
status: NEW
PMID: 10923036
[PubMed]
Claustres M et al: "Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France."
No.
Sentence
Comment
109
h M1K, K14X, W19X, 211delG, G27E, R31C, 237insA, 241delAT, Q39X, 244delTA, 296+2T>C, 297-3C>T, W57X+F87L, 306delTAGA, P67L, A72D, 347delC, R75Q, 359insT, 394delT, 405+4A>G, Q98R, 457TAT>G, R117H+5T, R117H+I1027T, R117L, R117P, H139R, A141D, M152V, N186K, D192N, D192del, E193X, 711+1G>A, 711+3A>G, 712-1G>T, L206F, W216X, C225R, Q237E, G241R, 852del22, 876-14del12, 905delG, 993del5, E292K, Y304X, F311del, 1161delC, R347L, R352Q, W361R, 1215delG, S364P, S434X, D443Y, S466X, C491R, T501A, I506T, F508C, I507del+F508C, F508del+L467F, 1774delCT, R553G, 1802delC, 1806delA, A559E, Y563N, 1833delT, Y569C, Y569H, Y569X, G576X, G576A, T582I, 1898+3A>G+186-13C>G, 1918delGC, R600G, L610S, G628R, 2043delG, 2118del4, E664X, 2174insA, Q689X, K698R, K716X, L732X, 2347delG, 2372del8, R764X, 2423delG, S776X, 2634insT, 2640delT, C866Y, 2752-1G>T, W882X, Y913C, V920M, 2896insAG, H939D, H939R, D979V, D985H, D993Y, 3120G>A, I1005R, 3195del6, 3293delA, 3320ins5, W1063X, A1067T, 3359delCT, T1086I, W1089X, Y1092X+S1235R, W1098X, E1104X, R1128X, 3532AC>GTA, 3548TCAT>G, M1140del, 3600G>A, R1162L, 3667ins4, 3732delA+K1200E, S1206X, 3791delC, S1235R+5T, Q1238R, Q1238X, 3849+4A>G, T1246I, 3869insG, S1255P, R1283K, F1286S, 4005+1G>T, 4006-8T>A, 4015delA, N1303H, N1303I, 4172delGC, 4218insT, 4326delTC, Q1382X, 4375-1C>T, 4382delA, D1445N, CF40kbdel4-10, Cfdel17b.
X
ABCC7 p.Tyr563Asn 10923036:109:579
status: NEW
PMID: 9511935
[PubMed]
Bianchet MA et al: "Modeling of nucleotide binding domains of ABC transporter proteins based on a F1-ATPase/recA topology: structural model of the nucleotide binding domains of the cystic fibrosis transmembrane conductance regulator (CFTR)."
No.
Sentence
Comment
360
The CFTR NBD1 model that results (Fig. 6) gathers the disease causing mutations in three different clusters: (1) mutations affecting the nucleotide binding pocket and the putative general base: A455E, G458V, E504Q AI507 AF508 P574H; (2) mutations in motif C which are probably related to an interaction with region D: S549[R,N,I] G551[S,D], R553Q; and (3) mutations within or near motif B, L558S, A559T, R560T, Y563N and mutations S492F and G480C.
X
ABCC7 p.Tyr563Asn 9511935:360:411
status: NEW
PMID: 8956039
[PubMed]
Hughes DJ et al: "Mutation characterization of CFTR gene in 206 Northern Irish CF families: thirty mutations, including two novel, account for approximately 94% of CF chromosomes."
No.
Sentence
Comment
53
35%) PAGE (278) Kerem et al.. 1989AF508 G551D R117H R560T G542X 621+1G>T A1507 E60X 3659delC R553X 3120G>A 1l54insTC 2789+5G>A N1303K MlI(G>T) QW P67L 557delT 711+3A>G L206W R297Q V520F V562L Y563N Y917C R1162X 3849G>A 3849 +10kbC>T 3850-1GBA W1282X 280 21 17 12 9 9 7 3 2 1 68.0 5.1 4.1 2.9 2.2 2.2 1.7 0.7 0.5 0.24 17-32-13 (38;27%j 17-31-13(24,17%) 16-07-17 16-30-13 plus14 rare haplotypes (29) 16-07-17 23-33-13 (4) 22-31-13 (2) 21-31-13 17-07-17 (5) 16-31-13 16-35-13 17-58-13 17-35-13 16-07-17 17-07-17 23-29-13 (1) 23-31-13 (1) 16-07-17 16-31-13 16-07-17 15-29-13 16-33-13 16-07-17 17-07-17 16-07-17 16-07-17 16-30-13 16-32-17 17-31-13 16-31-14 16-46-13 16-30-14 17-07-17 DGGE(2) ' RD ASO's (11) DGGE(6) RD AR (8) DGGE (1) RD PAGE (5) DGGE (2) SEQ SEQ (2) DGGE (1) RD DGGE DGGE DGGE SEQ DGGE DGGE DGGE SEQ DGGE DGGE SEQ DGGE DGGE DGGE DGGE DGGE SEQ RD DGGE DGGE Cutting et al.. 1990 Dean et al.. 1990 Kerem et al., 1990 Kerem et al.. 1990 Zielenski et al., 1991 Kerem et al.. 1990 Malone et al., CFGAC Kerem et al., 1990 Cutting et al., 1990 Zielenski et al., CFGAC lannuzzi et al., 1991 Highsmith et al., 1990 Osborne et al., 1991 this study Savov et al., 1994 Hamosh et al., CFGAC Graham et al., 1992 Petreska et al., CFGAC Claustres et al., 1993 Graham et al., 1991 Jones et al.. 1992 this study Kerem et al.. 1990 Edkins & Creegan, CFGAC Gasparini et al., 1991 Cutting et al.. 1992 Highsmith et al., 1994 Audriizet et al., 1993 Vidaud et al., 1990 "Numbers in parentheses after the microsatellite haplotypes refer to the number of alleles haplotyped when not all of the available chromosomeswere typed.
X
ABCC7 p.Tyr563Asn 8956039:53:192
status: NEW78 R560T, 1811+1G>C V562L, Y563N, 1898+lG>T 2143delT E827X R709X, K716X R764X E831X, W846X1,2711delT 2789+5G>A Y917C S977P.
X
ABCC7 p.Tyr563Asn 8956039:78:24
status: NEW
PMID: 8889582
[PubMed]
Hughes D et al: "Fluorescent multiplex microsatellites used to define haplotypes associated with 75 CFTR mutations from the UK on 437 CF chromosomes."
No.
Sentence
Comment
74
CF 8CA-17bTA-17bCA Mutation chromosomes % Normal Laboratoryb Reference' HaplotVpe 1)15-29-13 557delT Nl Graham et al.. 1992 21 16-07-17 MU (G>T) 3) 16-24-13 4) 16-25-13 5) 16-29-13 6) 16-30-13 7) 16-30-14 8) 16-31-13 9) 16-31-14 10) 16-32-13 12) 16-33-13 13) 16-34-13 14) 16-35-13 11)16-32-17 15)1645-13 16) 1646-13 17) 1646-14 19) 17-07-17 18)16-53-13 20)17-29-14 21) 17-31-13 22) 17-32-13 23) 17-35-13 24) 17-51-11 25) 17-55-13 27) 17-58-13 28) 21-31-13 29) 22-31-13 31)23-22-17 26) 17-56-13 30) 22-33-13 32) 23-29-13 33)23-31-13 34)23-32-13 35)23-33-13 36)23-34-13 37) 23-36-13 38)24-22-17 39) 24-31-13 182delT P67L R75X L206W 1154insTC 146linsAGAT Q493x V520F 1717-1G>A G551D R560T V562L R709X S1196X L1254X R1283M G85E 2184insA 711+lG>T 3495delA 4279insA SlOR L88S R117C R117H G178R 1717-1G>A Y563N W1098R G1123R 3850- 1G>A E6OX %%deIT 1138insG R34P 2183AA>G 2184delA R1158X 1078delT R1162X 3849G>A Q141W R347P Y917C G2iX 711+3A>G 441delA 3130de115 3659delC 1898+1G>A R709X 2711delT R1158X E92K 3849+lOkbC>T 2118delAACT 4048insCC 296+1 2 T S Q22OX R297Q A1507 2789+5G>A 3120+1G>A W128W 1811+lG>C AF508 E831X R116W AF508 W846X1 3120G>A R785X R553X R553X R553X 621+1G>T G542X G542X Y1182X N1303K AF508 G54W 3041delG 1525-1G>A N1303K G542X G542X G542X 394delTT R709X N1303K 1 1 1 2 1 1 4 2 3 4 2 26 8 1 1 1 1 1 8 1 1 1 1 1 1 1 19 1 2 1 1 1 1 7 1 1 2 1 1 2 1 1 1 1 1 1 1 1 2 1 1 7 4 1 2 1 1 2 1 1 4 Asian 1 2 1Asian 5 4 i Afro-Caribbean 5 1 42 (19%) 1 1 57 (26%) 1 2 1 1 1 2 12 2 11.4 0.4 4.9 16.3 1.1 3.8 1.9 10.6 2.3 1.5 2.3 1.5 2.7 4.5 0.4 0.8 0.8 0.4 0.8 0.4 1 2 1 7 1 1 1Asian 1 1.5 0.8 0.8 NI G NI, M M NI NI.
X
ABCC7 p.Tyr563Asn 8889582:74:798
status: NEW
No.
Sentence
Comment
78
Of the 13 Young syndrome patients, we identified one (Patient 5) who was het- CBAVD Dl152H D1270N G576A* R75Q* P67L Rl17H 3849 + 10 KB C > T G551S Rl17H Pancreatic Sufficient, Moderate Pulmonary Symptoms, Normal Sweat Chloride Concentrations Pancreatic Sufficient, Moderate Pulmonary Symptoms R347P 2789 + 5 G > A R334W G85E R347H R347L Rl17H G91R A455E S945L Y563N Q1291H R297Q R352Q L1065P 3850-3 T > G F1286S 3849 + 10 KB C > T TABLE 1 CFTR MUTATION SCREENING PANEL Severe M508 G551D R553X N1303K W1282X G542X 1717-1 G > A ~1507 R560T 3659deiC 621 + 1 G > T S549N TABLE 2 CLINICAL FEATURES OF YOUNG SYNDROME PATIENTS Patient Age Sweat CI- FEV, Paranasal Sputum No.
X
ABCC7 p.Tyr563Asn 7551394:78:360
status: NEW
PMID: 7526685
[PubMed]
Morral N et al: "Independent origins of cystic fibrosis mutations R334W, R347P, R1162X, and 3849 + 10kbC-->T provide evidence of mutation recurrence in the CFTR gene."
No.
Sentence
Comment
112
CT................... 3863: G--oA .................. G-.T ................... 3980: G-jA .................. G--)T.................... 4374+1: G-A .................. G--oT.................... L88S L88X L88X G. Malone, personal communication Savov et al. 1994b Macek et al. 1992 406-1G--.C Bonizzato et al. 1992 406-1G- T T. Bienvenu, personal communication E92K Nunes et al. 1993 E92X Will et al. 1994 S549N Cutting et al. 1990 S5491 Kerem et al. 1990 R560K Ferec et al. 1992 R560T Kerem et al. 1990 Y563D A. Hamosh, personal communication Y563N Kerem et al. 1990 1898+1CG-.A Strong et al. 1992 1898+1GC-.C Cuppens et al. 1993 1898+3A-)C W. Lissens, personal communication 1898+3A--4G Cremonesi et al. 1992 G628R G628R 2183AA- G 2184delA 2184insA M1101K M1101R 3667del4 3667ins4 3791delC T12201 G1244E G1244V R1283K R1283M Fanen et al. 1992 Cuppens et al. 1993 Bozon et al. 1994 Dork et al., in press N. Kilin, personal communication Zielenski et al. 1993 Mercier et al. 1993 Chillon et al. 1994a Sangiuolo et al. 1993 M. Macek, Jr., personal communication Ghanem et al. 1994 Devoto et al. 1991 Savov et al. 1994a Chevalier et al., in press Cheadle et al. 1992 4374+1G-*A Fanen et al. 1992 4374+1G--iT Dork et al. 1993 of the most common allele.
X
ABCC7 p.Tyr563Asn 7526685:112:538
status: NEW
PMID: 7525963
[PubMed]
Chevalier-Porst F et al: "Mutation analysis in 600 French cystic fibrosis patients."
No.
Sentence
Comment
21
Among the 104 other CFTR mutations tested on the 373 non-AF508 CF chromosomes, none of the following 58 mutations were found: G91R, 435 insA, 444delA, D11OH, 556delA, 557delT, R297Q, 1154insTC, R347L, R352Q, Q359K/T360K, 1221delCT, G480C, Q493R, V520F, C524X, 1706dell7, S549R (A-C), S549N, S549I, G551S, 1784delG, Q552X, L558S, A559T, R560T, R560K, Y563N, P574H, 2307insA, 2522insC, 2556insAT, E827X, Q890X, Y913C, 2991de132 (Dork et al, personal communication), L967S, 3320ins5, 3359delCT, H1085R, R1158X, 3662delA, 3667del4, 3667ins4, 3732delA, 3737delA, W1204X, 3750delAG, I 1234V, Q1238X, 3850- 3T-+G, 3860ins31, S1255X, 3898insC, D1270N, R1283M, F1286S, 4005 + I G-A. Forty-six other mutations were found on at Distribution of CFTR mutations found in our sample ofpopulation (1200 CF chromosomes) Mutations tested No of CF chromosomes Haplotypes Method with the mutation XV2C-KM19 (% of total CF alleles) Exon 3: G85E 4 (033) 3C HinfI/ASO394delTT 2 2B PAGEExon 4: R117H 1 B ASOY122X 2 2C MseI/sequenceI148T 1 B ASO621+IG-J* 1 B MseIIASOExon 5: 711+1G--T 8(07) 8A ASOExon 7: AF311 1 C PAGE/sequencelO78delT 5 (0-42) 5C PAGE/ASOR334W 5 (0-42) 2A,2C,ID MspIlASOR347P 5 (042) 5A CfoI/NcoIR347H 1 Cfol/sequenceExon 9: A455E 1 B ASOExon 10: S492F I C DdeI/sequenceQ493X 1 D ASOl609deICA 1 C PAGE/Ddel/sequenceA1507 3 (025) 3D PAGE/ASOAF508 827 (69) 794B,30D,2C,IA PAGEl677delTA 1 A PAGE/sequenceExon I11: 1717-IG--.A 16(1-3) 14B Modified primers + AvaIIG542X 40 (3-3) 29B,5D,2A Modified primers + BstNiS549R(T--*G) 2 2B ASOG551D 3 (025) 3B HincII/Sau3AR553X 10(0-8) 6A,1B,2C,ID Hincll/sequenceExon 12: 1898+IG--A 1 C ASO1898+ IG-C 2 IC ASOExon 13: l9l8deIGC 1 A PAGE/sequence1949de184 I C PAGE/sequenceG628R(G-+A) 2 2A Sequence2118de14 I c PAGE/sequence2143de1T 1 B PAGE/modified primers2184de1A+2183A--*G 11 (0-9) lIB PAGE/ASO2184de1A 1 ASOK710X 3 (025) IC XmnI2372de18 1 B PAGE/sequenceExon 15: S945L 1 C TaqlExon 17b:L1065P I MnlIL1077P 1 A ASOY1092X 3 (025) 2C,IA Rsal/ASOExon 19: RI1162X 6 (0-5) 5C,IA DdeI/ASO3659delC 3 (025) 3C ASOExon 20: G1244E 2 2A MboIIS1251N 2 2C RsaI3905insT 4 (0-33) 4C PAGE/ASOW1282X 18 (105) 15B,1D MnlI/ASOR1283K 1 C Mnll/sequenceExon 21: N1303K 22 (1-8) 18B,lA,ID Modified primers+BstNI 47 mutations 1031 (85 9) least one CF chromosome (table): 21 of them are very rare as they were found on only one CF chromosome in our population.
X
ABCC7 p.Tyr563Asn 7525963:21:350
status: NEW
PMID: 7521710
[PubMed]
Ravnik-Glavac M et al: "Sensitivity of single-strand conformation polymorphism and heteroduplex method for mutation detection in the cystic fibrosis gene."
No.
Sentence
Comment
121
1078delT (35), L327R (Ravnik-Glavac a al., unpublished), R334W (36), D36K (31), R347L (26), R347P (14), A349V (26), R352Q (30), 1221delCT (34); Exon 8: W401X (31), 1342-1G-C (25); Exon 9: G458V (37), 1525 -1G-A (38); Exon 10: S492F (34), Q493X (39), 1609delCA (40,17), deltaI507 (39,41), deltaF5O8 (3), 1717-1G-A (39,42); Exon 11: G542X (39), S549N, G551D, R553X (43), R553Q (44), A559T (43), R560K (Fine et al., pers. comm.), R560T (39); Exon 12: Y563N (39), 1833delT (Schwartz et al., pers. comm.), P574H (39), 1898 + 1G-C (31), 1898+3A-G (Ferrari et al., pers. comm.); Exon 13: G628R(G-C) (31), Q685X (Firec et al., pers. comm.), K716X (26), L719X (Dork etal., pers. comm.), 2522insC (15), 2556insAT (45), E827X (34); Exon 14a: E831X (Ffrec et al., pers. comm.), R851X (29), 2721delll (31), C866Y (Audrezet et al., pers. comm.); Exon 14b: 2789+5G-A (Highsmith et al., pers. comm.); Exon 15: 2907denT (21), 2991del32 (Dark and TQmmler, pers. comm.), G970R (31); Exon 16: S977P, 3100insA (D6rk et al., pers. comm.); Exon 17a: I1005R (Dork and TQmmler, pers. comm.), 3272-1G-A (46); Exon 17b: H1054D (F6rec et al., pers. comm.), G1061R (Fdrec et al., pers. comm.), 332Oins5, R1066H, A1067T (34), R1066L (Fe"rec etal., pers. comm.), R1070Q (46), E1104X (Zielenski el al., pers. comm.), 3359delCT (46), L1077P (Bozon « a/., pers. comm.), H1085R (46), Y1092X (Bozon etal., pers. comm.), W1098R, M1101K (Zielenski et al., pers. comm.); Exon 18: D1152H (Highsmith et al., pers. comm.); Exon 19:R1162X (36), 3659delC (39), 3662delA (25), 3667del4 (Chillon et al., pers. comm.), 3737ddA (35), 3821ddT (15), I1234V (35), S1235R (31), Q1238X (26), 3849G-A (25), 385O-3T-G (38); Exon20:3860ins31 (Chillon etal., pers. comm.), S1255X (47), 3898insC (26), 3905insT (Malik et al., pers. comm.), D127ON (48), W1282X (49), Q1291R (Dork et al., pers. comm.), Exon 21: N1303H (35), N13O3K (50), W1316X (43); Exon 22: 11328L/4116delA (Dork and TQmmler, pers. comm.), E1371X (25); Exon 23: 4374+ 1G-T (38); Exon 24: 4382delA (Claustres et al., pers. comm.).
X
ABCC7 p.Tyr563Asn 7521710:121:448
status: NEW
PMID: 7513293
[PubMed]
Chillon M et al: "Analysis of the CFTR gene confirms the high genetic heterogeneity of the Spanish population: 43 mutations account for only 78% of CF chromosomes."
No.
Sentence
Comment
31
At present, we have not detected any Spanish CF chromosomes bearing any of the following mutations: 394delTA, Y122X, 556delA, 852de122, R347P, $492F, 1677delTA, V520F, Q552X, R553X, L559S, R560K, R560T, Y563N, P564H, 2043delG, 3320ins5, R1066H, A1067T, H1085R, 3732delA, 3737delA, I1234V, S1255P, 3898insC, Q1291H or 4005+ 1G---~A.
X
ABCC7 p.Tyr563Asn 7513293:31:203
status: NEW
PMID: 7678316
[PubMed]
Kubesch P et al: "Genetic determinants of airways' colonisation with Pseudomonas aeruginosa in cystic fibrosis."
No.
Sentence
Comment
71
The NBF gene mutations in the study population were all severe disease alleles with respect to pancreatic function, and none of the rare PS alleles G551S, Y563N, P574H was detected.4,25 Hence, our findings do not necessarily imply that a NBF mutation should a priori be considered a "high risk" allele but rather that the more common "severe" disease alleles cluster in the NBF.
X
ABCC7 p.Tyr563Asn 7678316:71:155
status: NEW
PMID: 1376017
[PubMed]
Cutting GR et al: "Analysis of four diverse population groups indicates that a subset of cystic fibrosis mutations occur in common among Caucasians."
No.
Sentence
Comment
66
The first patient had a missense mutation, tyrosine to asparagine at codon 563, on the other chromosome (Kerem et al. 1990).
X
ABCC7 p.Tyr563Asn 1376017:66:43
status: NEW
PMID: 1376016
[PubMed]
Kristidis P et al: "Genetic determination of exocrine pancreatic function in cystic fibrosis."
No.
Sentence
Comment
58
Intron 10: 1717-1G-'A Exon 11: G542X .......... S549R ........... G551D .......... R553X .......... R560T .......... Exon 12: Y563N .......... P574H .......... Exon 19: 3659delC ....... Exon 20: W1282X ....... Exon 21: N1303K ..... G460-C A deletion G482-'A A deletion T575-C 621 + 1G-T C1132-T C1172- G C1496-A G1505-'T G1570-T C1609-T 3-bp deletion 3-bp deletion G1690-T G1717-1-A G1756-T T1779-G G1784- A C1789-T G1811-C T1819- A C1853- A C deletion G3978-A C4041-G Asp 110-His Frameshift Arg 117-His Frameshift Ile 148-Thr Splice mutation Arg 334-Trp Arg 347-Pro Ala 455- Glu Gly 458-'Val Gly480-Cys Gln 493- stop del of Ile 507 del of Phe 508 Val 520-Phe Splice mutation Gly 542- stop Ser 549-'Arg Gly 551-WAsp Arg 553- stop Arg 560- Thr Tyr 563- Asn Pro 574-His Frameshift Trp 1282-stop Asn 1303-Lys Dean et al. 1990 White et al. 1991 Dean et al. 1990 Zielenski et al. 1991a F. Rininsland, D. Bozon, and L.-C. Tsui, unpublished data Zielenski et al. 1991a Gasparini et al. 1991 Dean et al. 1990 Kerem et al. 1990b Cuppens et al. 1990 Strong et al. 1991 Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1989b Jones et al. 1991 Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1990b Cutting et al. 1990 Cutting et al. 1990 Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1990b Vidaud et al. 1990 Osborne et al. 1990 PI or PS, but not with both.
X
ABCC7 p.Tyr563Asn 1376016:58:126
status: NEW66 As shown in table 3, meconium ileus Table 2 1181 Table 3 Frequency of 25 CF Mutations in Chromosomes of the Toronto Study Population Mutation AF508 ...... G551D...... G542X...... 621 +1G-'T N1303K..... W1282X..... R1 17H...... 1717-1G-~A R560T...... A1507 ...... R553X...... V52OF ...... R334W ..... A455E...... I148T ...... Q493X...... P574H...... R347P ...... SS6delA ..... 3659delC .... G480C...... 444delA ..... D110H...... G458V...... S549R ...... Y563N......
X
ABCC7 p.Tyr563Asn 1376016:66:455
status: NEW
PMID: 1372093
[PubMed]
Cuppens H et al: "Simultaneous screening for 11 mutations in the cystic fibrosis transmembrane conductance regulator gene by multiplex amplification and reverse dot-blot."
No.
Sentence
Comment
19
Frequency of 31 mutations in the CFTR gene in 194 Belgian CF chromosomes The 51255X, W1316X ;5 S549N, G551D, R553X, A559T;6 D110H, R117H, R347P;' Q493X, S5491, S549R(T-+G), R560T, Y563N, P574H ;9 W846X, Y913C;10 2556insAT;" R334W;" S549R(A-+C);'6 444delA, 3821deIT;" 621 +1G-*T18 mutations were not present in this random sample of the Belgian CF population .
X
ABCC7 p.Tyr563Asn 1372093:19:180
status: NEW