ABCMdb

ABCC7 p.Pro67Leu

Admin's notes:	Class II-III (maturation defect, gating defect) Veit et al.
ClinVar:	c.200C>T , p.Pro67Leu D , Pathogenic
CF databases:	c.200C>T , p.Pro67Leu D , CF-causing ; CFTR1: P67L mutation was seen on one Caucasian CF chromosome of 48 screened. It was not detected on any of 181 non-CF Caucasian chromosomes by ASO analysis. The patient, a 15 year old female, carries [delta]F508 on the other allele. She was diagnosed at the age of 12. She is pancreatic sufficient with sweat chloride concentrations of 54 and 67 meq/L.
Predicted by SNAP2:	A: D (85%), C: D (85%), D: D (95%), E: D (95%), F: D (91%), G: D (91%), H: D (91%), I: D (91%), K: D (95%), L: N (57%), M: D (91%), N: D (95%), Q: D (91%), R: D (95%), S: D (91%), T: D (91%), V: D (85%), W: D (91%), Y: D (91%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

II-III (maturation defect, gating defect) <a href="https://www.ncbi.nlm.nih.gov/pubmed/26823392">Veit et al.</a>
admin on 2016-08-19 15:16:22

Publications
[hide] Proportion of cystic fibrosis gene mutations not d... JAMA. 1999 Jun 16;281(23):2217-24. Mak V, Zielenski J, Tsui LC, Durie P, Zini A, Martin S, Longley TB, Jarvi KA
Proportion of cystic fibrosis gene mutations not detected by routine testing in men with obstructive azoospermia.
JAMA. 1999 Jun 16;281(23):2217-24., 1999-06-16 [PMID:10376575]

Abstract [show]
CONTEXT: Infertile men with obstructive azoospermia may have mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, many of which are rare in classic cystic fibrosis and not evaluated in most routine mutation screening. OBJECTIVE: To assess how often CFTR mutations or sequence alterations undetected by routine screening are detected with more extensive screening in obstructive azoospermia. DESIGN: Routine screening for the 31 most common CFTR mutations associated with the CF phenotype in white populations, testing for the 5-thymidine variant of the polythymidine tract of intron 8 (IVS8-5T) by allele-specific oligonucleotide hybridization, and screening of all exons through multiplex heteroduplex shift analysis followed by direct DNA sequencing. SETTING: Male infertility clinic of a Canadian university-affiliated hospital. SUBJECTS: Of 198 men with obstructive (n = 149) or nonobstructive (n = 49; control group) azoospermia, 64 had congenital bilateral absence of the vas deferens (CBAVD), 10 had congenital unilateral absence of the vas deferens (CUAVD), and 75 had epididymal obstruction (56/75 were idiopathic). MAIN OUTCOME MEASURE: Frequency of mutations found by routine and nonroutine tests in men with obstructive vs nonobstructive azoospermia. RESULTS: Frequency of mutations and the IVS8-5T variant in the nonobstructive azoospermia group (controls) (2% and 5.1% allele frequency, respectively) did not differ significantly from that in the general population (2% and 5.2%, respectively). In the CBAVD group, 72 mutations were found by DNA sequencing and IVS8-5T testing (47 and 25, respectively; P<.001 and P = .002 vs controls) vs 39 by the routine panel (P<.001 vs controls). In the idiopathic epididymal obstruction group, 24 mutations were found by DNA sequencing and IVS8-5T testing (12 each; P=.01 and P=.14 vs controls) vs 5 by the routine panel (P=.33 vs controls). In the CUAVD group, 2 mutations were found by routine testing (P=.07 vs controls) vs 4 (2 each, respectively; P=.07 and P=.40 vs controls) by DNA sequencing and IVS8-5T testing. The routine panel did not identify 33 (46%) of 72, 2 (50%) of 4, and 19 (79%) of 24 detectable CFTR mutations and IVS8-5T in the CBAVD, CUAVD, and idiopathic epididymal obstruction groups, respectively. CONCLUSIONS: Routine testing for CFTR mutations may miss mild or rare gene alterations. The barrier to conception for men with obstructive infertility has been overcome by assisted reproductive technologies, thus raising the concern of iatrogenically transmitting pathogenic CFTR mutations to the progeny.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
45 (%) Men With 2 Mutations ⌬F508/IVS8-5T 7 (11) ⌬F508/IVS8-5T 1 (10) ⌬F508/IVS8-5T 1 (1.8) ⌬F508/R117H 6 (9) W1282X/IVS8-5T 1 (1.8) ⌬F508/L206W 1 (1.6) G544S/IVS8-5T 1 (1.8) ⌬F508/M952T 1 (1.6) V754M/-741T→G 1 (1.8) ⌬F508/P67L 1 (1.6) R75Q/R258G 1 (1.8) ⌬F508/S549R 1 (1.6) R334W/R334W 1 (1.6) R117H/R117H 1 (1.6) R117H/IVS8-5T 1 (1.6) R347P/IVS8-5T 1 (1.6) N1303K/IVS8-5T 1 (1.6) 1677delTA/IVS8-5T 1 (1.6) R117L/IVS8-5T 1 (1.6) D979A/IVS8-5T 1 (1.6) IVS8-5T/IVS8-5T 1 (1.6) Men With 1 Mutation IVS8-5T/N 10 (16) ⌬F508/N 1 (10) IVS8-5T/N 9 (16) ⌬F508/N 1 (2) ⌬F508/N 6 (9) IVS8-5T/N 1 (10) ⌬F508/N 1 (1.8) G542X/N 1 (2) W1282X/N 2 (3) R75Q/N 1 (1.8) IVS8-5T/N 5 (10) L206W/N 1 (1.6) W1282X/N 1 (1.8) 4016insT/N 1 (1.6) R117H/N 1 (1.8) 2423delG/N 1 (1.8) Men With No Mutations 18 (28) 7 (70) 37 (66) 42 (86) *N indicates that no CFTR mutations or variants were detected. Login to comment
50 Of the 8 additional CFTR gene sequence alterations detected using extensive CFTR exon screening, 5 have been described rarely in the CF population (L206W [identified in 2 subjects], P67L, 1677delTA, R117L, and 4016insT).60 One mutation, D979A, was previously identified in a Vietnamese CBAVD patient.60 Interestingly, our CBAVD subject with D979A (also a carrier of IVS8-5T) was of Vietnamese descent as well. Login to comment
58 (%) 31 Mutation panel† ⌬F508 23 (18) ⌬F508 2 (10) ⌬F508 2 (1.8) ⌬F508 1 (1) R117H 9 (7) W1282X 2 (1.8) G542X 1 (1) W1282X 2 (1.6) R117H 1 (0.9) R334W 2 (1.6) S549R 1 (0.8) R347P 1 (0.8) N1303K 1 (0.8) Extensive screen† ⌬F508 23 (18) ⌬F508 2 (10) ⌬F508 2 (1.8) ⌬F508 1Mutations included in R117H 9 (7) W1282X 2 (1.8) G542X 131 mutation panel W1282X 2 (1.6) R117H 1 (0.9) R334W 2 (1.6) S549R 1 (0.8) R347P 1 (0.8) N1303K 1 (0.8) L206W 2 (1.6)‡ R75Q 2 (1.8)‡Mutations not included in P67L 1 (0.8)‡ G544S 1 (0.9)‡31 mutation panel 1677delTA 1 (0.8)‡ 2423delG 1 (0.9)‡ R117L 1 (0.8)‡ V754M 1 (0.9)‡ 4016insT 1 (0.8)‡ -741T→G 1 (0.9)‡ D979A 1 (0.8)§ R258G 1 (0.9)§ M952T 1 (0.8)¶ IVS8-5T 25 (20)# 2 (10) 12 (11) 5 (5) Detectable mutations 72 (56)# 4 (20) 24 (21)# 7 (7) Detectable mutations missed by 31 mutation panel 33 (46) 2 (50) 19 (79) Detectable non-IVS8-5T mutations missed by 31 mutation panel 8 (17) 0 (0) 7 (58) *Percentages indicate allele frequency. Login to comment

[hide] Many deltaF508 heterozygote neonates with transien... J Med Genet. 2000 Jul;37(7):543-7. Boyne J, Evans S, Pollitt RJ, Taylor CJ, Dalton A
Many deltaF508 heterozygote neonates with transient hypertrypsinaemia have a second, mild CFTR mutation.
J Med Genet. 2000 Jul;37(7):543-7., [PMID:10970190]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
538 These have been reported in patients with presenting phenotypes ranging from "cystic fibrosis" to oligospermia, but there have been too few cases Table 2 Compound heterozygotes detected Domain and mutation type Genotype Exon 1st IRT 2nd IRT Transmembrane, missense F508/P67L 3 129 34* F508/R117H 4 110 21* F508/R117H 4 84 34 F508/R117H 4 95 39 F508/R117H 4 104 40 F508/R117H 4 146 41 F508/R117H 4 104 48* F508/R117H 4 120 53 F508/R117H 4 111 54 F508/R117H 4 175 72* F508/R117L 4 129 70 F508/L967S 15 122 15 F508/F1052V 17b 189 29 F508/R1066H 17b 94 18 Transmembrane, nonsense F508/R75X 3 86 26 F508/R75X 3 171 27 F508/R851X 14a 112 76 Regulatory, missense F508/F693L 13 109 29 Alternate splice site F508/3849+10KB C→T i19 99 26* F508/3849+10KB C→T i19 112 36* None of these samples had the IVS8-5T variant sequence. Login to comment

[hide] Cystic fibrosis in infertility: screening before a... Hum Reprod. 2000 Nov;15(11):2415-7. Lewis-Jones DI, Gazvani MR, Mountford R
Cystic fibrosis in infertility: screening before assisted reproduction: opinion.
Hum Reprod. 2000 Nov;15(11):2415-7., [PMID:11056144]

Abstract [show]
Cystic fibrosis (CF) is the most common autosomal recessive disease in Caucasians. In 97-98% of men with CF, bilateral congenital absence of the vas deferens (CBAVD) blocks the transport of spermatozoa resulting in azoospermia. Abnormalities in sperm parameters have also been identified in males with CF. To date, over 800 disease-causing mutations of the CF transmembrane conductance regulator (CFTR) gene have been identified (also called ABCC7). Current legislation suggests that prior to intracytoplasmic sperm injection (ICSI) treatment, men with CBAVD or unexplained oligozoospermia should be considered for screening. If the male is negative with routine screening then the female partner is not screened. This is fundamentally wrong because if the female is screened and is found to be CF positive on routine testing, her partner would then need the fullest possible investigation of the CFTR gene. It is ideal to screen both partners in cases of oligozoospermia. However, if the resources are stretched, then only the female needs to be routinely screened because if she is negative, then the couple's residual risk of having a CF or CBAVD child will be reduced to 1:960. Only when the female is found to be a carrier does the male partner need routine screening followed by full testing for known mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
65 N. Engl. J. Med., 332, 1475-1480.∆F 508 G85E 296ϩ12T→C Daigneault, J., Aubin, G., Simard, F. and DeBraekeleer, M. (1992) TheN1303K E6OX 711ϩ1G→T incidence of cystic fibrosis in Saguenay-Lac-St-Jean (Quebec, Canada).G542 L88s 711ϩ3A→G Hum. Biol., 64, 115-119.R117H P67L A455E 621ϩ16→T R75X 1461ins4 DeBraekeleer, M. and Daigneault, J. (1992) Spatial distribution of the ∆F508 mutation of cystic fibrosis. Login to comment

[hide] Comprehensive mutation screening in a cystic fibro... Pediatrics. 2001 Feb;107(2):280-6. Wine JJ, Kuo E, Hurlock G, Moss RB
Comprehensive mutation screening in a cystic fibrosis center.
Pediatrics. 2001 Feb;107(2):280-6., [PMID:11158459]

Abstract [show]
OBJECTIVES AND BACKGROUND: The identities of a cystic fibrosis (CF) patient's CFTR mutations can influence therapeutic strategies, but because >800 CFTR mutations exist, cost-effective, comprehensive screening requires a multistage approach. Single-strand conformation polymorphism and heteroduplex analysis (SSCP/HA) can be an important part of mutation detection, but must be calibrated within each laboratory. The sensitivity of a combined commercial-SSCP/HA approach to genotyping in a large, ethnically diverse US center CF population has not been established. STUDY DESIGN: We screened all 27 CFTR exons in 10 human participants who had an unequivocal CF diagnosis including a positive sweat chloride test and at least 1 unknown allele after commercial testing for the 70 most common mutations by SSCP/HA. These participants were compared with 7 participants who had negative sweat tests but at least 1 other CF-like symptom meriting complete genotyping. RESULTS: For the 10 CF participants, we detected 11 of 16 unknown alleles (69%) and all 4 of the known alleles (100%), for an overall rate of 75% inpatients not fully genotyped by conventional 70 mutation screen. For 7 participants with negative sweat tests, we confirmed 1 identified mutation in 14 alleles and detected 3 additional mutations. Mutations detected in both groups included 7 missense mutations (S13F, P67L, G98R, S492F, G970D, L1093P, N1303K) and 9 deletion, frameshift, nonsense or splicing mutations (R75X, G542X, DeltaF508, 451-458Delta8 bp, 5T, 663DeltaT, exon 13 frameshift, 1261+1G-->A and 3272-26A-->G). Three of these mutations were novel (G970D, L1093P, and 451-458Delta8 bp(1)). Thirteen other changes were detected, including the novel changes 1812-3 ins T, 4096-278 ins T, 4096-265 ins TG, and 4096-180 T-->G. CONCLUSION: When combined with the 70 mutation Genzyme test, SSCP/HA analysis allows for detection of >95% of the mutations in an ethnically heterogeneous CF center population. We discuss 5 possible explanations that could account for the few remaining undetected mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
16 Mutations detected in both groups included 7 missense mutations (S13F, P67L, G98R, S492F, G970D, L1093P, N1303K) and 9 deletion, frameshift, nonsense or splicing mutations (R75X, G542X, ⌬F508, 451-458⌬8 bp, 5T, 663⌬T, exon 13 frameshift, 1261؉1G3A and 3272-26A3G). Login to comment
100 After screening with SSCP/HA, 2 mutations, P67L and 1261ϩ1G3A, were detected in another patient who also had the highest sweat chloride value in this group (48 mM). Login to comment
155 PS none - SN3 unk/unk 10-15 PS none GATT6/6, 1001ϩ11 C3T, TG10, T9 homozygous all SN4 unk/unk 25 PI None M470V (10), (GT)11/10 GATT7/7, 1896ϩ152 A/T (I12); 2694T/G (14a), 4521G3A (24) SN5 G542X unk 25 PS none M470V (10), TG11, T7 SN6 unk*/unk* 48 PS P67L (3) 1261ϩIG3A (I13) 1898ϩ174 ins A (I12), 2694T3G (14a) 4521G3A (24) 1812-3 ins T, (I11), homozygous SN7 unk/unk 40 PS None found - Notation as for Table 1. Login to comment

[hide] Cystic fibrosis: a worldwide analysis of CFTR muta... Hum Mutat. 2002 Jun;19(6):575-606. Bobadilla JL, Macek M Jr, Fine JP, Farrell PM
Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening.
Hum Mutat. 2002 Jun;19(6):575-606., [PMID:12007216]

Abstract [show]
Although there have been numerous reports from around the world of mutations in the gene of chromosome 7 known as CFTR (cystic fibrosis transmembrane conductance regulator), little attention has been given to integrating these mutant alleles into a global understanding of the population molecular genetics associated with cystic fibrosis (CF). We determined the distribution of CFTR mutations in as many regions throughout the world as possible in an effort designed to: 1) increase our understanding of ancestry-genotype relationships, 2) compare mutational arrays with disease incidence, and 3) gain insight for decisions regarding screening program enhancement through CFTR multi-mutational analyses. Information on all mutations that have been published since the identification and cloning of the CFTR gene's most common allele, DeltaF508 (or F508del), was reviewed and integrated into a centralized database. The data were then sorted and regional CFTR arrays were determined using mutations that appeared in a given region with a frequency of 0.5% or greater. Final analyses were based on 72,431 CF chromosomes, using data compiled from over 100 original papers, and over 80 regions from around the world, including all nations where CF has been studied using analytical molecular genetics. Initial results confirmed wide mutational heterogeneity throughout the world; however, characterization of the most common mutations across most populations was possible. We also examined CF incidence, DeltaF508 frequency, and regional mutational heterogeneity in a subset of populations. Data for these analyses were filtered for reliability and methodological strength before being incorporated into the final analysis. Statistical assessment of these variables revealed that there is a significant positive correlation between DeltaF508 frequency and the CF incidence levels of regional populations. Regional analyses were also performed to search for trends in the distribution of CFTR mutations across migrant and related populations; this led to clarification of ancestry-genotype patterns that can be used to design CFTR multi-mutation panels for CF screening programs. From comprehensive assessment of these data, we offer recommendations that multiple CFTR alleles should eventually be included to increase the sensitivity of newborn screening programs employing two-tier testing with trypsinogen and DNA analysis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
111 Slovakia ∆F508 (57.3%) CFTRdele2,3 (1.2%) 82.7 68.4 14 908/254 CFGAC [1994]; Estivill et al. G542X (6.8%) 3849+10KbC→T (1.0%) [1997]; Dörk et al. [2000]; R553X (4.0%) S42F (0.9%) Macek et al. [2002] N1303K (3.4%) R75X (0.9%) 2143delT (1.8%) G85E (0.9%) R347P (1.4%) 605insT (0.9%) W1282X (1.3%) 1898+1G→A (0.9%) Slovenia ∆F508 (57.8%) R347P (1.1%) 79.7 63.5 16 455/132 CFGAC [1994]; Dörk et al. 2789+5G→A (4.1%) S4X (0.8%) [2000]; Macek et al. [2002] R1162X (3.2%) 457TAT→G (0.8%) G542X (1.9%) D192G (0.8%) Q552X (1.5%) R553X (0.8%) Q685X (1.5%) A559T (0.8%) 3905insT (1.5%) 2907delTT (0.8%) CFTRdele2,3 (1.5%) 3667ins4 (0.8%) Spain ∆F508 (52.7%) G85E (0.8%) 80.2 64.3 21 3608/1356 Chillón et al. [1994]; Casals et G542X (8.0%) R1066C (0.8%) al. [1997]; Estivill et al. [1997] N1303K (2.5%) 2789+5G→A (0.7%) 3601-111G→C (2.0%) 2869insG (0.7%) 1811+1.6Kb A→G (1.7%) ∆I507 (0.6%) R1162X (1.6%) W1282X (0.6%) 711+1G→T (1.3%) L206W (0.5%) R334W (1.2%) R709X (0.5%) Q890X (1.0%) K710X (0.5%) 1609delCA (1.0%) 3272-26A→G (0.5%) 712-1G→T (1.0%) Sweden ∆F508 (66.6%) E60X (0.6%) 85.9 73.8 10 1357/662 Schwartz et al. [1994]; Estivill et 394delTT (7.3%) Y109C (0.6%) al. [1997]; Schaedel et al. 3659delC (5.4%) R117H (0.6%) [1999] 175insT (2.4%) R117C (0.6%) T338I (1.2%) G542X (0.6%) Switzerland ∆F508 (57.2%) K1200E (2.1%) 91.3 83.4 9 1268/1173 Estivill et al. [1997]; R553X (14.0%) N1303K (1.2%) Hergersberg et al. [1997] 3905insT (9.8%) W1282X (1.1%) 1717-1G→A (2.7%) R347P (0.6%) G542X (2.6%) Ukraine ∆F508 (65.2%) CFTRdele2,3 (1.1%) 74.6 55.7 6 1055/580 Estivill et al. [1997]; Dörk et al. R553X (3.6%) G551D (1.8%) [2000]; Macek et al. [2002] N1303K (2.4%) W1282X (0.5%) United ∆F508 (75.3%) 621+1G→T (0.93%) 81.6 66.6 5 19622/9815 Schwartz et al. [1995b]; Kingdom G551D (3.1%) 1717-1G→A (0.57%) Estivill et al. [1997] (total) G542X (1.7%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS585 United ∆F508 (56.6%) 621+1G→T (1.8%) 69.1 47.7 7 456 CFGAC [1994] Kingdom G551D (3.7%) R117H (1.5%) (N. Ireland) R560T (2.6%) ∆I507 (0.9%) G542X (2.0%) United ∆F508 (19.2%) 621+2T→C (3.8%) 84.4 71.2 11 52 Malone et al. [1998] Kingdom Y569D (15.4%) 2184insA (3.8%) (Pakistani) Q98X (11.5%) R560S (1.9%) 1525-1G→A (9.6%) 1898+1G→T (1.9%) 296+12T→C (7.7%) R709X (1.9%) 1161delC (7.7%) United ∆F508 (71.3%) 1717-1G→A (1.0%) 86.4 74.6 9 1236/730 Shrimpton et al. [1991]; Kingdom G551D (5.5%) 621+1G→T (0.6%) Gilfillan et al. [1998] (Scotland) G542X (4.0%) ∆I507 (0.6%) R117H (1.4%) R560T (0.6%) P67L (1.4%) United ∆F508 (71.6%) 1717-1G→A (1.1%) 98.7 97.4 17 183 Cheadle et al. [1993] Kingdom 621+1G→T (6.6%) 3659delC (0.5%) (Wales) 1898+1G→A (5.5%) R117H (0.5%) G542X (2.2%) N1303K (0.5%) G551D (2.2%) E60X (0.5%) 1078delT (2.2%) S549N (0.5%) R1283M (1.6%) 3849+10KbC→T (0.5%) R553X (1.1%) 4016insT (0.5%) ∆I507 (1.1%) Yugoslavia ∆F508 (68.9%) 3849G→A (1.0%) 82.2 67.6 11 709/398 Dabovic et al. [1992]; Estivill et G542X (4.0%) N1303K (0.8%) al. [1997]; Macek et al. R1162C (3.0%) 525delT (0.5%) (submitted for publication) 457TAT→G (1.0%) 621+1G→T (0.5%) I148T (1.0%) G551D (0.5%) Q552X (1.0%) Middle East/Africa Algeria 1) DF508 (20.0%) 4) 1812-1G®A (5.0%) - - 5 20 Loumi et al. [1999] 2) N1303K (20.0%) 5) V754M (5.0%) 3) 711+1G®T (10.0%) Jewish W1282X (48.0%) 3849+10KbC→T (6.0%) 95.0 90.3 6 261 Kerem et al. [1995] (Ashkenazi) ∆F508 (28.0%) N1303K (3.0%) G542X (9.0%) 1717-1G→A (1.0%) Jewish 1) N1303K - - 1 6 Kerem et al. [1995] (Egypt) Jewish 1) Q359K/T360K - - 1 8 Kerem et al. [1995] (Georgia) Jewish 1) DF508 2) 405+1G®A - - 2 11 Kerem et al. [1995] (Libya) Jewish 1) DF508 (72.0%) 3) D1152H (6.0%) - - 3 33 Kerem et al. [1995] (Morocco) 2) S549R (6.0%) Jewish ∆F508 (35.0%) W1282X (2.0%) 43.0 18.5 4 51 Shoshani et al. [1992] (Sepharadim) G542X (4.0%) S549I (2.0%) (Continued) BOBADILLAETAL. Login to comment

[hide] Variant cystic fibrosis phenotypes in the absence ... N Engl J Med. 2002 Aug 8;347(6):401-7. Groman JD, Meyer ME, Wilmott RW, Zeitlin PL, Cutting GR
Variant cystic fibrosis phenotypes in the absence of CFTR mutations.
N Engl J Med. 2002 Aug 8;347(6):401-7., 2002-08-08 [PMID:12167682]

Abstract [show]
BACKGROUND: Cystic fibrosis is a life-limiting autosomal recessive disorder with a highly variable clinical presentation. The classic form involves characteristic findings in the respiratory tract, gastrointestinal tract, male reproductive tract, and sweat glands and is caused by loss-of-function mutations in the cystic fibrosis transmembrane conductance regulator (CFTR ) gene. Nonclassic forms of cystic fibrosis have been associated with mutations that reduce but do not eliminate the function of the CFTR protein. We assessed whether alteration in CFTR function is responsible for the entire spectrum of variant cystic fibrosis phenotypes. METHODS: Extensive genetic analysis of the CFTR gene was performed in 74 patients with nonclassic cystic fibrosis who had been referred by 34 medical centers. We evaluated two families that each included a proband without identified mutations and a sibling with nonclassic cystic fibrosis to determine whether there was linkage to the CFTR locus and to measure the extent of CFTR function in the sweat gland and nasal epithelium. RESULTS: Of the 74 patients studied, 29 had two mutations in the CFTR gene, 15 had one mutation, and 30 had no mutations. A final genotype of two mutations was more common among patients who had been referred after screening for common cystic fibrosis-causing mutations identified one mutation than among those who had been referred after screening had identified no such mutations (26 of 34 patients vs. 3 of 40 patients, P<0.001). Comparison of clinical features and sweat chloride concentrations revealed no significant differences among patients with two, one, or no CFTR mutations. Haplotype analysis in the two families revealed no linkage to CFTR. Although each of the affected siblings had elevated sweat chloride concentrations, measurements of cyclic AMP-mediated ion and fluid transport in the sweat gland and nasal epithelium demonstrated the presence of functional CFTR. CONCLUSIONS: Factors other than mutations in the CFTR gene can produce phenotypes clinically indistinguishable from nonclassic cystic fibrosis caused by CFTR dysfunction.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
71 MUTATION IDENTIFIED BY SCREENING FOR COMMON MUTATIONS MUTATION IDENTIFIED BY DNA SEQUENCING NO. OF PATIENTS ∆F508 5T* 3 ∆F508 D1152H 2 ∆F508 2789+2insA 2 ∆F508 R117C 2 ∆F508 D110H 1 ∆F508 2789+5G→A 1 ∆F508 P205S 1 ∆F508 L967S 1 ∆F508 I1027T 1 ∆F508 L206W 1 ∆F508 T1053I and 5T 1 ∆F508 V920M and 5T 1 ∆F508 R1070W 1 ∆F508 D579G 1 ∆F508 P67L 1 ∆F508 2811G→T†‡ 1 G85E F191V† 1 R117H G103X and 5T 1 I148T I556V 1 G542X R1162L 1 W1282X D1152H 1 None L138ins and 3272-26 A→G 1 None G463D† and 5T 1 None F693L and 5T 1 ∆F508 None 6 G551D None 1 W1282X None 1 None 5T 4 None 2307insA 1 None L997F 1 None V520I 1 None None 30 in Subject II-2 in Family 1. Login to comment

[hide] Demographics of the UK cystic fibrosis population:... Eur J Hum Genet. 2002 Oct;10(10):583-90. McCormick J, Green MW, Mehta G, Culross F, Mehta A
Demographics of the UK cystic fibrosis population: implications for neonatal screening.
Eur J Hum Genet. 2002 Oct;10(10):583-90., [PMID:12357328]

Abstract [show]
The objective was to determine the composition of the Cystic Fibrosis (CF) Population attending specialist UK CF centres in terms of age, gender, age at diagnosis, genotype and ethnicity. With the planned introduction of the national CF screening programme in the UK, cystic fibrosis transmembrane regulator (CFTR) mutations were compared between different ethnic groups enabling a UK-specific frequency of mutations to be defined. Data were analysed from the patient biographies held in the UK CF Database (see www.cystic-fibrosis.org.uk). The currently registered population of 5,274 CF patients is 96.3% Caucasian with a male preponderance that significantly increases with age. The majority of the 196 non-Caucasian CF patients are from the Indian Subcontinent (ISC), of which one in 84 UK CF patients are of Pakistani origin. The commonest CFTR mutation, deltaF508, is found in 74.1% of all CF chromosomes. In the Caucasian CF population, 57.5% are deltaF508 homozygotes but the UK ISC CF population with only 24.7%, has significantly fewer deltaF508 homozygotes patients (95% confidence interval (CI) 0.2-0.4). The distribution of Caucasian patients with deltaF508/deltaF508, deltaF508/Other and Other/Other does not fit the expected distribution with a Hardy-Weinberg model unless those patients without a detected mutation are excluded (P<0.001). The UK CF Database has shown the UK CF population to have distinct characteristics separate from the North American and European CF Registries. The ISC group contains many mutations not recognised by current genetic analysis, and one in four ISC patients have no CFTR mutations identified. The CFTR analysis proposed for the screening programme would detect 96% of patients registered in the database, but is unlikely to achieve the desired >80% detection rates in the ethnic minority groups. Screen-positive, non-Caucasian infants without an identifiable CFTR mutation should be referred for a sweat test and genetic counselling when serum trypsinogen concentrations remain elevated after birth.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
84 The following seven mutations appear in Table 4 but not in the 31 mutation panel; 1154insTC, E60X, P67L, Y569D, L218X, 1161delC and R709X. Login to comment
85 Table 4 The commonest CFTR mutations in the UK Genotypes UK CF population Genotyped UK Caucasian CF Genotyped UK CF ISC (n=9866 chromosomes) population (n=9506 chromosomes) population (n=156 chromosomes) CFTR mutation gene frequency per 1000 genes gene frequency per 1000 genes gene frequency per 1000 genes DF508 741.0 752.0 294.9 G551D 33.7 34.3 12.8 G542X 18.5 18.4 25.6 R117H 12.5 12.7 0.0 621+1G?T 12.7 12.7 6.4 1717-1G?A 5.8 5.8 0.0 1898+1G?A 5.7 5.9 0.0 N1303K 5.6 5.4 0.0 DI507 4.8 5.0 0.0 R560T 4.2 4.3 0.0 R553X 3.3 3.4 0.0 1154insTC 3.2 3.3 0.0 Q493X 2.8 2.9 0.0 3659delC 2.8 2.9 0.0 E60X 2.4 2.4 0.0 W1282X 2.7 2.7 0.0 P67L 2.1 2.1 0.0 G85E 2.1 2.0 0.0 V520F 1.6 1.7 0.0 1078delT 1.3 1.4 0.0 Y569D 1.5 0.0 96.2 L218X 0.6 0.0 38.5 1161delC 0.7 0.1 38.5 R1162X 0.9 0.6 19.2 R709X 0.4 0.2 12.8 3849+10kbC?T 1.2 0.8 19.2 S549R* 0.6 0.0 0.0 *S549R mutations appear in the non-Caucasian but not the ISC subgroup. Login to comment

[hide] Cystic fibrosis mutation frequencies in an Irish p... Clin Genet. 2003 Feb;63(2):121-5. Devaney J, Glennon M, Farrell G, Ruttledge M, Smith T, Houghton JA, Maher M
Cystic fibrosis mutation frequencies in an Irish population.
Clin Genet. 2003 Feb;63(2):121-5., [PMID:12630958]

Abstract [show]
The incidence of cystic fibrosis (CF) at birth in Ireland is 1/1461. Neonate CF genetic testing is not routinely performed in Ireland. Currently, screening is only carried out where there is clinical evidence or a family history to suggest disease. Here we report the frequencies of common CF mutations occurring in an Irish population composed of samples collected from western, mid-western and southern regions of Ireland. Rarer CF mutations were also identified in a selected number of CF patients. In addition, a number of polymorphisms were identified, some of which are reported to be functionally and phenotypically important.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
67 Frequency of rarer CF mutations and polymorphisms Mutation Numberof chromosomes Frequency (%) Polymorphism Frequency (%) E60X 1 0.24 IVS6a-8 25.0 P67L 1 0.24 (TG)m 37.5 G85E 1 0.24 IVS8-Tn 23.8 6211G >T 1 0.24 M470V 41.3 IVS8^5T 5 1.21 V520F 2 0.48 18981G >A 2 0.48 R117H 1 ^ DF508 17 ^ Total 80 15 Frequencypercentages areadjustedtorepresent 85%. Login to comment
78 There are no reports of the E60X, P67L, G85E, IVS8-5T, V520F or 1898 1G> A mutations in previously published CF mutation frequency reports for the Republic of Ireland (11, 12). Login to comment
79 The E60X mutation has been reported in Northern Ireland (0.7%), with no V520F or P67L alleles being detected (13). Login to comment

[hide] Molecular consequences of cystic fibrosis transmem... Gut. 2003 Aug;52(8):1159-64. Ahmed N, Corey M, Forstner G, Zielenski J, Tsui LC, Ellis L, Tullis E, Durie P
Molecular consequences of cystic fibrosis transmembrane regulator (CFTR) gene mutations in the exocrine pancreas.
Gut. 2003 Aug;52(8):1159-64., [PMID:12865275]

Abstract [show]
BACKGROUND AND AIMS: We tested the hypothesis that the actual or predicted consequences of mutations in the cystic fibrosis transmembrane regulator gene correlate with the pancreatic phenotype and with measures of quantitative exocrine pancreatic function. METHODS: We assessed 742 patients with cystic fibrosis for whom genotype and clinical data were available. At diagnosis, 610 were pancreatic insufficient, 110 were pancreatic sufficient, and 22 pancreatic sufficient patients progressed to pancreatic insufficiency after diagnosis. RESULTS: We identified mutations on both alleles in 633 patients (85.3%), on one allele in 95 (12.8%), and on neither allele in 14 (1.9%). Seventy six different mutations were identified. The most common mutation was DeltaF508 (71.3%) followed by G551D (2.9%), G542X (2.3%), 621+1G-->T (1.2%), and W1282X (1.2%). Patients were categorized into five classes according to the predicted functional consequences of each mutation. Over 95% of patients with severe class I, II, and III mutations were pancreatic insufficient or progressed to pancreatic insufficiency. In contrast, patients with mild class IV and V mutations were consistently pancreatic sufficient. In all but four cases each genotype correlated exclusively with the pancreatic phenotype. Quantitative data of acinar and ductular secretion were available in 93 patients. Patients with mutations belonging to classes I, II, and III had greatly reduced acinar and ductular function compared with those with class IV or V mutations. CONCLUSION: The predicted or known functional consequences of specific mutant alleles correlate with the severity of pancreatic disease in cystic fibrosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
309 Table 2 Genotype classification according to the functional consequences of CFTR gene mutations Pancreatic status Class I Class II Class III Class IV Class V PS F1 , 875+1G→C(2) F, F (1) F, G551D (1) F, R117H (11) F,3849+10kbC→T (5) F, G85E2 (1) F, R347H (3) F,3272-26A→G (4) F, S1251N (2) F,A445E (3) F, D614G (1) F,P574H (2) F, R347P (1) F,3120G>A (1) R117H,R117H (1) F, 5T (8) F, L1335P (1) F,2789+5G→A (1) F,P67L (1) F,R347P/R347H (1) F,V232D(2) R334W, R334W(1) PS→PI F,3659delC (1) F,F (15) F,G551D (1) F, I1234V (1) F,2184insA (1) F,R560T (1) PI F, G542X (27) F,F (365) F, G551D (28) F, 621+1G→T (13) F, R560T (7) F,R553X (7) F, N1303K (9) F, R1162X (6) F,L1077P (2) F, 3659delC (5) F, I48T (1) F, 1717-1G→A (5) F,A559T (1) F, W1282X (5) F, G85E2 (2) F, 711+1G→T (5) G551D,G551D(1) F,2184delA(4) F,H199R (1) W1282X,W1282X (4) F,I1072T(1) F,Y1092X (3) F,S549 (R75Q) (1) F,556delA (3) F, Q493X (3) F,4016InsT (3) F, 3120+1G→A (2) F, G551D/R553X (2) F,Q814X(2) F,1154insTC (2) F,441delA (1) F, 4326delTC (1) F,Q552X(1) F,3007delG (1) F,2184insA (1) F, 4010del4 (1) F,3905insT (1) F,1078delT(1) F,E1104X (1) F,3876delA (1) F,4374+1G→T (1) F,E585X (1) F, E60X (1) CFTR, cystic fibrosis transmembrane regulator; PI, pancreatic insufficiency; PS, pancreatic sufficiency. Login to comment

[hide] Late diagnosis defines a unique population of long... Am J Respir Crit Care Med. 2005 Mar 15;171(6):621-6. Epub 2004 Dec 10. Rodman DM, Polis JM, Heltshe SL, Sontag MK, Chacon C, Rodman RV, Brayshaw SJ, Huitt GA, Iseman MD, Saavedra MT, Taussig LM, Wagener JS, Accurso FJ, Nick JA
Late diagnosis defines a unique population of long-term survivors of cystic fibrosis.
Am J Respir Crit Care Med. 2005 Mar 15;171(6):621-6. Epub 2004 Dec 10., 2005-03-15 [PMID:15591474]

Abstract [show]
Although the median survival for patients with cystic fibrosis (CF) is 32.9 years, a small group of patients live much longer. We analyzed the genotype and phenotype of CF patients 40 years and older seen between 1992 and 2004 at the National Jewish Medical and Research Center (n = 55). These patients were divided into two groups according to age at diagnosis: an early diagnosis (ED) group, median age at diagnosis 2.0 years (range 0.1-15 years, n = 28), and a late diagnosis (LD) group, median age of diagnosis 48.8 years (range 24-72.8 years, n = 27). Consistent with the hypothesis that the CFTR genotype affects the age at diagnosis, CFTR DeltaF508 homozygous individuals were more common in the ED group. Although patients in the ED group were predominantly male, the majority of LD patients were female. Patients with CF diagnosed late had a significantly lower prevalence of pancreatic insufficiency and CF-related diabetes, and better lung function. Fewer patients in the LD groups were infected with Pseudomonas aeruginosa, whereas a greater percentage had cultures positive for nontuberculous mycobacteria. This is the largest cohort of older patients with CF described to date, and our findings indicate that patients diagnosed as adults differ distinctly from survivors of long-term CF diagnosed as children.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
117 GENOTYPE DISTRIBUTION Early Diagnosis Late Diagnosis ⌬F508/⌬F508 10 1 ⌬F508/⌬I507 1 ⌬F508/G551D 1 ⌬F508/M1101K 1 ⌬F508/P67L/11027T 1 ⌬F508/3120G-A 1 ⌬F508/2789ϩ5G-A 1 2 ⌬F508/W1282X 1 ⌬F508/621ϩ1G-T 1 ⌬F508/R347P 1 ⌬F508/3849ϩ10kbC-T 1 1 ⌬F508/A455E 2 ⌬F508/R347H 2 ⌬F508/D1152H 1 ⌬508/I148T 1 ⌬F508/R117H 1 ⌬F508/Y109N 1 ⌬F508/IVS8-5T 1 ⌬F508/unknown 3 5 S1251N/D1152H 1 G542X/R117C 1 R117H/G551D 1 W1282X/D1152H 1 Unknown 4 4 Values represent number of individuals in each diagnostic group with each genotype. Login to comment

[hide] Genotype-phenotype correlation for pulmonary funct... Thorax. 2005 Jul;60(7):558-63. de Gracia J, Mata F, Alvarez A, Casals T, Gatner S, Vendrell M, de la Rosa D, Guarner L, Hermosilla E
Genotype-phenotype correlation for pulmonary function in cystic fibrosis.
Thorax. 2005 Jul;60(7):558-63., [PMID:15994263]

Abstract [show]
BACKGROUND: Since the CFTR gene was cloned, more than 1000 mutations have been identified. To date, a clear relationship has not been established between genotype and the progression of lung damage. A study was undertaken of the relationship between genotype, progression of lung disease, and survival in adult patients with cystic fibrosis (CF). METHODS: A prospective cohort of adult patients with CF and two CFTR mutations followed up in an adult cystic fibrosis unit was analysed. Patients were classified according to functional effects of classes of CFTR mutations and were grouped based on the CFTR molecular position on the epithelial cell surface (I-II/I-II, I-II/III-V). Spirometric values, progression of lung disease, probability of survival, and clinical characteristics were analysed between groups. RESULTS: Seventy four patients were included in the study. Patients with genotype I-II/I-II had significantly lower current spirometric values (p < 0.001), greater loss of pulmonary function (p < 0.04), a higher proportion of end-stage lung disease (p < 0.001), a higher risk of suffering from moderate to severe lung disease (odds ratio 7.12 (95% CI 1.3 to 40.5)) and a lower probability of survival than patients with genotype I-II/III, I-II/IV and I-II/V (p < 0.001). CONCLUSIONS: The presence of class I or II mutations on both chromosomes is associated with worse respiratory disease and a lower probability of survival.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
251 The mild pulmonary phenotype seen in patients with genotype I-II/III-V is consistent with previous reports where a few rare mutations such as A455E, R117H, 3849+10kbCRT, 2789+5GRT, and P67L (all class IV or V mutations) are clearly linked to a better pulmonary outcome.13 14 26-28 The findings observed in this study support the hypothesis that differences in CF pulmonary phenotype could be related to the effect of the genotype on CFTR protein production and function. Nevertheless, it is important to recognise that specific mutations may have characteristics of more than one 1.0 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0.0 20 30 40 50 60 Follow up (years) Events Lung transplant Dead I-II/I-II 9 6 I-II/III-V 1 0 Genotype I-II/III, IV or V I-II/I-II p<0.001 (Log-rank test for trend) Figure 3 Kaplan-Meier survival curves by genotype. Login to comment

[hide] Extensive sequencing of the CFTR gene: lessons lea... Hum Genet. 2005 Dec;118(3-4):331-8. Epub 2005 Sep 28. McGinniss MJ, Chen C, Redman JB, Buller A, Quan F, Peng M, Giusti R, Hantash FM, Huang D, Sun W, Strom CM
Extensive sequencing of the CFTR gene: lessons learned from the first 157 patient samples.
Hum Genet. 2005 Dec;118(3-4):331-8. Epub 2005 Sep 28., [PMID:16189704]

Abstract [show]
Cystic fibrosis (CF) is one of the most common monogenic diseases affecting Caucasians and has an incidence of approximately 1:3,300 births. Currently recommended screening panels for mutations in the responsible gene (CF transmembrane regulator gene, CFTR) do not detect all disease-associated mutations. Our laboratory offers extensive sequencing of the CFTR (ABCC7) gene (including the promoter, all exons and splice junction sites, and regions of selected introns) as a clinical test to detect mutations which are not found with conventional screening. The objective of this report is to summarize the findings of extensive CFTR sequencing from our first 157 consecutive patient samples. In most patients with classic CF symptoms (18/24, 75%), extensive CFTR sequencing confirmed the diagnosis by finding two disease-associated mutations. In contrast, only 5 of 75 (7%) patients with atypical CF had been identified with two CFTR mutations. A diagnosis of CF was confirmed in 10 of 17 (58%) newborns with either positive sweat chloride readings or positive immunoreactive trypsinogen (IRT) screen results. We ascertained ten novel sequence variants that are potentially disease-associated: two deletions (c.1641AG>T, c.2949_2853delTACTC), seven missense mutations (p.S158T, p.G451V, p.K481E, p.C491S, p.H949L, p.T1036N, p.F1099L), and one complex allele ([p.356_A357del; p.358I]). We ascertained three other apparently novel complex alleles. Finally, several patients were found to carry partial CFTR gene deletions. In summary, extensive CFTR gene sequencing can detect rare mutations which are not found with other screening and diagnostic tests, and can thus establish a definitive diagnosis in symptomatic patients with previously negative results. This enables carrier detection and prenatal diagnosis in additional family members.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
75 Dx of CF, pancreatic insufficiency, frequent colds and cough 4 DF508/p.P67L 3 months F Positive sweat test 50, 53, 60 Followed in CF Clinic 5 DF508/p.W846X 9 months M Positive sweat test ? Login to comment

[hide] Two-tiered immunoreactive trypsinogen-based newbor... J Pediatr. 2005 Sep;147(3 Suppl):S83-8. Sontag MK, Hammond KB, Zielenski J, Wagener JS, Accurso FJ
Two-tiered immunoreactive trypsinogen-based newborn screening for cystic fibrosis in Colorado: screening efficacy and diagnostic outcomes.
J Pediatr. 2005 Sep;147(3 Suppl):S83-8., [PMID:16202790]

Abstract [show]
OBJECTIVE: To examine immunoreactive trypsinogen (IRT)-based screening for cystic fibrosis (CF) for recall rate, genotype distribution, and "borderline" sweat test results. STUDY DESIGN: CF newborn screening in Colorado began in 1982, and >1,153,000 infants were screened through 2002 with an IRT-based screen (IRT/IRT). RESULTS: We have identified 313 infants with CF, giving an overall incidence of 1 in 3684 and a Hispanic incidence of 1 in 6495. Fifty-five infants with meconium ileus (17.6%) were excluded from analysis. Fourteen infants with false-negative results were identified (5.4%). The average recall rate was 0.6%, with a positive predictive value of 4.7%. Ninety-three percent of the infants had at least 1 DeltaF508 mutation, and 98% of the infants had at least 1 mutation from the American College of Medical Genetics recommended panel. Six infants had hypertrypsinogenemia and borderline results on sweat tests (30-60 mmol/L). Increased variability in sweat chloride levels were seen in these infants compared with infants with homozygous DeltaF508. Three children with initial borderline results on sweat tests had CF diagnosed. CONCLUSIONS: The recall and false-negative rates of our IRT/IRT CF screening program are reported. Additionally, genotypes of the patients identified mirror the CF population genotypes, reflecting similar disease severity in the screened population. Finally, infants with persistent hypertrypsinogenemia and borderline sweat test results need long-term follow-up.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
86 The pancreatic sufficient mutations identified were 18981 5G>T, 278915G>A, A455E, G551S, G85E, I336K, P67L, R117C, R117H, R334W, R347P. Login to comment

[hide] Establishing a diagnosis of cystic fibrosis. Chron Respir Dis. 2004;1(4):205-10. Southern KW, Peckham D
Establishing a diagnosis of cystic fibrosis.
Chron Respir Dis. 2004;1(4):205-10., [PMID:16281647]

Abstract [show]
Cystic fibrosis (CF) is a recessively inherited condition caused by mutation of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Characterization of the genetic defect has improved understanding of the condition and, in the majority of cases, diagnosis is straightforward. However, in a significant number, diagnosis remains a challenge. This paper will discuss the management of these issues and reflect on atypical presentations. In addition we will discuss situations in which genetic variations of the CFTR gene are not associated with a classical CF phenotype and the implications for practice in both paediatric and adult clinics.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 For example, another splice site mutation (3849 + 10 kb C > T) and other class IV mutations (e.g., I1 19V, R334W and P67L) have been associated with borderline sweat tests. Login to comment

[hide] Mutations in the cystic fibrosis transmembrane reg... Am J Respir Crit Care Med. 2006 Oct 1;174(7):787-94. Epub 2006 Jul 13. Wilschanski M, Dupuis A, Ellis L, Jarvi K, Zielenski J, Tullis E, Martin S, Corey M, Tsui LC, Durie P
Mutations in the cystic fibrosis transmembrane regulator gene and in vivo transepithelial potentials.
Am J Respir Crit Care Med. 2006 Oct 1;174(7):787-94. Epub 2006 Jul 13., 2006-10-01 [PMID:16840743]

Abstract [show]
AIM: To examine the relationship between cystic fibrosis transmembrane regulator gene mutations (CFTR) and in vivo transepithelial potentials. METHODS: We prospectively evaluated 162 men including 31 healthy subjects, 21 obligate heterozygotes, 60 with congenital bilateral absence of the vas deferens (CBAVD) and 50 with CF by extensive CFTR genotyping, sweat chloride and nasal potential difference testing. RESULTS: Six (10%) men with CBAVD carried no CFTR mutations, 18 (30%) carried one mutation, including the 5T variant, and 36 (60%) carried mutations on both alleles, for a significantly higher rate carrying one or more mutations than healthy controls (90% versus 19%, p < 0.001). There was an overlapping spectrum of ion channel measurements among the men with CBAVD, ranging from values in the control and obligate heterozygote range at one extreme, to values in the CF range at the other. All pancreatic-sufficient patients with CF and 34 of 36 patients with CBAVD with mutations on both alleles carried at least one mild mutation. However, the distribution of mild mutations in the two groups differed greatly. Genotyping, sweat chloride and nasal potential difference (alone or in combination) excluded CF in all CBAVD men with no mutations. CF was confirmed in 56% and 67% of CBAVD men carrying 1 and 2 CFTR mutations, respectively. CONCLUSION: Abnormalities of CFTR transepithelial function correlate with the number and severity of CFTR gene mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
71 Only two individuals in the CF-PS and CBAVD-2 groups carried a combination of the same mutations on both alleles (⌬F508/P67L). Login to comment

[hide] Functional characterization of a novel CFTR mutati... Cell Physiol Biochem. 2007;19(5-6):239-48. Kraus C, Reis A, Naehrlich L, Dotsch J, Korbmacher C, Rauh R
Functional characterization of a novel CFTR mutation P67S identified in a patient with atypical cystic fibrosis.
Cell Physiol Biochem. 2007;19(5-6):239-48., [PMID:17495464]

Abstract [show]
Cystic fibrosis (CF) is caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. CFTR serves as a cAMP-stimulated chloride channel in a wide range of epithelial tissues and its dysfunction is a hallmark of CF. Over 1400 mutations in the CFTR gene are known, but functional data exist only for a minority of the mutant channels. The aim of the present study was to functionally characterize a novel CFTR mutation identified in a patient with atypical CF. Full length sequencing of the patient's CFTR gene revealed a homozygous C to T transition at nucleotide position 331 (CCT>TCT), which results in a P67S amino acid substitution. Mutant and wild-type CFTR were heterologously expressed in Xenopus laevis oocytes. CFTR whole-cell currents were studied using the two-electrode voltage-clamp technique. Channel surface expression was assessed by a chemiluminescence assay. Expression of P67S-CFTR resulted in functional CFTR chloride channels. However, the CFTR chloride conductance observed in oocytes expressing the mutant channel averaged only 24% of that in oocytes expressing wild-type CFTR. Similarly, surface expression of the mutant channel was reduced. In contrast, the mutation did not alter the anion selectivity of the channel, and Western blot analysis indicated a similar protein expression level of mutant and wild-type CFTR. Our findings indicate that the P67S mutation reduces CFTR chloride channel function by reducing channel surface expression. The mild disease phenotype of the patient indicates that the residual function of the mutant channel is sufficient to prevent the development of severe CF symptoms.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
86 In the same way a P67L mutation was generated (forward: GCT GGC TTC AAA GAA AAA TCT TAA ACT CAT TAA TGC CCT TCG; reverse: CGA AGG GCA TTA ATG AGT TTA AGA TTT TTC TTT GAA GCC AGC). Login to comment
101 Defolliculated stage V-VI oocytes were injected (Nanoject automatic injector, Drummond, Broomall, PA) with 0.25 ng cRNA of wild-type CFTR or P67S mutant or P67L mutant. Login to comment
182 The previously reported P67L mutation has a similar effect on CFTR function as the P67S mutation As shown above the P67S mutation reduces ΔGIBMX/ Fsk by decreasing the surface expression of the mutated CFTR channels. Login to comment
194 same position in the CFTR protein has previously been described, P67L, and was reported to cause a dominant mild phenotype of CF [29], i.e. if a patient is heterozygous for this mutation, he suffers from a mild CF even when the mutation on the other allele is known to cause severe CF (e.g. ΔF508). Login to comment
196 Therefore, we decided to investigate the P67L mutation to compare its effect with the effect of the P67S mutation. Login to comment
197 In two different batches of oocytes we found that ΔGIBMX/Fsk was similarly decreased in P67S CFTR (30.2 ± 2.8 µS, n=9) and P67L CFTR (14.3 ± 4.1 µS, n=9) expressing oocytes compared to ΔGIBMX/Fsk of wild-type CFTR (157.0 ± 24.4 µS, n=9, see figure 5) expressing oocytes. Login to comment
200 IBMX/forskolin activated whole-cell conductance (ΔGIBMX/Fsk ) of wild-type, P67S, and P67L CFTR. Login to comment
201 Experiments were essentially performed as described in figure 2 to determine ΔGIBMX/Fsk in matched oocytes from two different batches expressing either wild-type CFTR, P67S or P67L CFTR (N=2, n=9,** p<0.01, *** p<0.001). Login to comment
205 3) The mutation P67L, a previously described dominant mild form of CFTR [29], reduced the CFTR whole-cell conductance to about the same level as the P67S mutation. Login to comment
223 This P67L mutation was found to confer a dominant mild effect, i.e. compound heterozygotes carrying the P67L mutation on one allele and a severe CFTR mutation (e.g. ΔF508) on the other allele have a mild phenotype. Login to comment
224 Gilfillan et al. [29] reported that none of the P67L compound heterozygotes they investigated showed consistently raised sweat chloride concentrations and 77% of the 13 patients investigated were pancreatic sufficient. Login to comment
225 Another study [31] reported one patient with a negative sweat test and pancreatic sufficiency, who was also heterozygous for P67L. Login to comment
226 To our knowledge no functional data have yet been reported for the P67L mutant. Login to comment
227 In our study we found that the P67L mutant had a similar inhibitory effect on the CFTR whole-cell conductance as the P67S mutant. Login to comment
231 Thus, in the oocyte expression system the inhibitory effect of the ΔF508 mutation seems to be rather similar to that observed in the present study for the P67S and P67L mutant channels. Login to comment
236 Thus, the temperature sensitivity of the ΔF508-CFTR may explain its more severe phenotype compared to the P67S or the P67L mutations. Login to comment
237 In any case, the mild CF phenotype of patients with the P67S or the P67L mutations suggests that the residual function of these mutant channels is sufficient to prevent severe symptoms. Login to comment

[hide] Correlation of chest radiograph pattern with genot... Chest. 2007 Aug;132(2):569-74. Epub 2007 Jun 15. Kaza V, Katz MF, Cumming S, Frost AE, Safdar Z
Correlation of chest radiograph pattern with genotype, age, and gender in adult cystic fibrosis: a single-center study.
Chest. 2007 Aug;132(2):569-74. Epub 2007 Jun 15., [PMID:17573513]

Abstract [show]
INTRODUCTION: Cystic fibrosis (CF) is a common lethal genetic disorder. The aim of this study was to determine the common chest radiograph (CXR) patterns in adult CF, and correlate disease distribution on CXRs with genotype, age, and gender. METHODS: One hundred nine CF patients treated at Baylor Adult Cystic Fibrosis Center were identified. The intake CXR was reviewed and characterized as diffuse bilateral (DB), unilateral, upper lobe (UL), and lower lobe (LL) disease, or relatively normal. Lack of intake CXR, and/or genotype excluded 41 patients from analysis. RESULTS: Of 68 patients, 38 were homozygous for DeltaF508 and 30 were heterozygous. Mean age of the population was 30 +/- 8 years (+/- SD) [range, 18 to 48 years]. The most common CXR pattern was DB; 62% had DB, 28% had UL, and 7% had LL predominance. This is in contrast to the UL-predominant CXR pattern commonly described in the pediatric population. In 18 DB patients, archived pediatric films were available, and the average patient age was 15.7 years. DB pattern was present in 16 of 18 CXRs that antedated adult intake CXRs by an average of 12.7 years. Homozygous DeltaF508 genotype was identified in 56% of patients and did not distinguish radiologic phenotypes. There was no association between radiograph pattern and identified infecting/colonizing organisms and percentage of predicted FEV(1). CONCLUSIONS: CF has commonly been reported as an UL disease. However, in this study of adult patients, the common pattern observed was DB. A small subgroup analysis suggests that DB disease was not a pattern of disease evolution but may be present from disease onset.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
62 Homozygous ⌬F508 38 F508/no ID 10 F508/G542X 4 F508/n3849 ϩ 10KBT 2 F508/N1303K 2 F508/G85E 2 F508/G551D 2 F508/R1179H 1 F508/3849 ϩ 10 KBC.T 1 F508/621ϩIG-T 1 F508/3659deltaC 1 F508/P67L 1 F508/2789 ϩ 5E 1 G551/LL48T 1 G551D/no ID 1 Total 68 570 our adult CF population was UL predominance; 26% of those homozygous for ⌬F508 (group I) and 30% of the other genotypes (group II) had the radiologic appearance of UL disease (Fig 2). Login to comment

[hide] Adenosine receptors, cystic fibrosis, and airway h... Handb Exp Pharmacol. 2009;(193):363-81. Com G, Clancy JP
Adenosine receptors, cystic fibrosis, and airway hydration.
Handb Exp Pharmacol. 2009;(193):363-81., [PMID:19639288]

Abstract [show]
Adenosine (Ado) regulates diverse cellular functions in the lung through its local production, release, metabolism, and subsequent stimulation of G-protein-coupled P1 purinergic receptors. The A(2B) adenosine receptor (A(2B)AR) is the predominant P1 purinergic receptor isoform expressed in surface airway epithelia, and Ado is an important regulator of airway surface liquid (ASL) volume through its activation of the cystic fibrosis transmembrane conductance regulator (CFTR). Through a delicate balance between sodium (Na(+)) absorption and chloride (Cl(-)) secretion, the ASL volume is optimized to promote ciliary activity and mucociliary clearance, effectively removing inhaled particulates. When CFTR is dysfunctional, the Ado/A(2B)AR regulatory system fails to optimize the ASL volume, leading to its depletion and interruption of mucociliary clearance. In cystic fibrosis (CF), loss of CFTR function and resultant mucus stasis leaves the lower airways susceptible to mucus obstruction, chronic bacterial infection, relentless inflammation, and eventually panbronchiectasis. Adenosine triphosphate (ATP) also regulates transepithelial Cl(-) conductance, but through a separate system that relies on stimulation of P2Y(2) purinergic receptors, mobilization of intracellular calcium, and activation of calcium-activated chloride channels (CaCCs). These pathways remain functional in CF, and may serve a protective role in the disease. In this chapter, we will review our current understanding of how Ado and related nucleotides regulate CFTR and Cl(-) conductance in the human airway, including the regulation of additional intracellular and extracellular signaling pathways that provide important links between ion transport and inflammation relevant to the disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
125 These results, coupled with the previously subject 1 (20 yo) 51-61 ΔF508/- ΔF508/- ΔF508/ Δ1270N/ ΔF508/ P67L G551D R74W (M470V) ΔF508/- 77-100 97 80, 86 (+) sweat, unavailable 74-68 83% 92% 132% 101% 107% 122% Yes Yes Yes Yes Yes No 7 yr 17 yr 2 yr 2 yr 11 yr 5 mo 2 (22 yo) 3 (30 yo) 4 (14 yo) 5 (19 yo) 6 (17 yr) genotype sweat [CI-] FEV1 PS? Login to comment

[hide] Sweat gland bioelectrics differ in cystic fibrosis... Thorax. 2009 Nov;64(11):932-8. Epub 2009 Sep 3. Gonska T, Ip W, Turner D, Han WS, Rose J, Durie P, Quinton P
Sweat gland bioelectrics differ in cystic fibrosis: a new concept for potential diagnosis and assessment of CFTR function in cystic fibrosis.
Thorax. 2009 Nov;64(11):932-8. Epub 2009 Sep 3., [PMID:19734129]

Abstract [show]
BACKGROUND: For nearly 50 years the diagnosis of cystic fibrosis (CF) has depended on measurements of sweat chloride concentration. While the validity of this test is universally accepted, increasing diagnostic challenges and the search for adequate biomarker assays to support curative-orientated clinical drug trials have created a new demand for accurate, reliable and more practical CF tests. A novel concept is proposed that may provide a more efficient real-time method for assessing CFTR function in vivo. METHODS: Cholinergic and beta-adrenergic agonists were iontophoresed to stimulate sweating. The bioelectric potential from stimulated sweat glands (SPD) was measured in vivo using a standard ECG electrode applied to the skin surface. SPD and sweat chloride concentrations were compared in cohorts predicted to express a range of CFTR function as presented by healthy controls (HC), heterozygotes (Hz), pancreatic sufficient (CFPS) and pancreatic insufficient patients with CF (CFPI). RESULTS: The median SPD was hyperpolarized in patients with CF compared with control subjects (-47.4 mV vs -14.5 mV, p<0.001). In distinguishing between control and CF subjects, SPD (area under receiver operator curve (AUC) = 0.997) was similar to sweat chloride concentration (AUC = 0.986). Sequential cholinergic/beta-adrenergic sweat stimulation dramatically depolarised the SPD in patients with CF (p<0.001) but had no effect in control subjects (p = 0.6) or on the sweat chloride concentration in either group (p>0.5). Furthermore, the positive SPD response was larger in CFPI than in CFPS subjects (p = 0.04). CONCLUSION: These results support the concept that skin surface voltages arising from stimulated sweat glands can be exploited to assess expressed CFTR function in vivo and may prove to be a useful diagnostic tool.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
68 Table 1 Summary of study subjects ID Category Sex Age Genotype ID Category Sex Age Genotype 1 HC F 49 +/+ 21 CFPS M 46 deltaF508/P67L 2 HC F 39 +/+ 22 CFPS F 41 deltaF508/R117C 3 HC M 32 +/+ 23 CFPS F 57 G542X/D1152H 4 HC M 23 +/+ 24 CFPS M 34 deltaF508/M1101K 5 HC F 28 +/+ 25 CFPS F 29 deltaF508/L1335P 6 HC M 26 +/+ 26 CFPS F 48 deltaF508/+ 7 HC M 26 R75Q/+ 27 CFPS M 26 deltaF508/R117H 8 HC M 30 +/+ 28 CFPS M 44 deltaF508/3272_26A.G 9 HC M 22 +/+ 29 CFPS M 46 deltaF508/R117H 5T 10 HC M 22 +/+ 30 CFPS M 48 R347P/2753-2A.G 11 Hz F 26 deltaF508/+ 31 CFPI M 29 deltaF508/deltaF508 12 Hz F 54 deltaF508/+ 32 CFPI M 29 deltaF508/2194inA 13 Hz F 24 deltaF508/+ 33 CFPI F 40 G551D/621+1 G.T 14 Hz F 33 deltaF508/+ 34 CFPI M 33 deltaF508/deltaF508 15 Hz M 25 deltaF508/+ 35 CFPI M 27 deltaF508/deltaF508 16 Hz F 37 deltaF508/+ 36 CFPI M 25 deltaF508/deltaF508 17 Hz F 49 deltaF508/+ 37 CFPI M 27 deltaF508/deltaF508 18 Hz M 49 deltaF508/+ 38 CFPI M 29 deltaF508/deltaF508 19 Hz F 55 deltaF508/+ 20 Hz M 61 deltaF508/+ CFPI, pancreatic-insufficient CF patients; CFPS, pancreatic-sufficient CF patients; HC, healthy controls; Hz, heterozygotes. Login to comment

[hide] Do common in silico tools predict the clinical con... Clin Genet. 2010 May;77(5):464-73. Epub 2009 Jan 6. Dorfman R, Nalpathamkalam T, Taylor C, Gonska T, Keenan K, Yuan XW, Corey M, Tsui LC, Zielenski J, Durie P
Do common in silico tools predict the clinical consequences of amino-acid substitutions in the CFTR gene?
Clin Genet. 2010 May;77(5):464-73. Epub 2009 Jan 6., [PMID:20059485]

Abstract [show]
Computational methods are used to predict the molecular consequences of amino-acid substitutions on the basis of evolutionary conservation or protein structure, but their utility in clinical diagnosis or prediction of disease outcome has not been well validated. We evaluated three popular computer programs, namely, PANTHER, SIFT and PolyPhen, by comparing the predicted clinical outcomes for a group of known CFTR missense mutations against the diagnosis of cystic fibrosis (CF) and clinical manifestations in cohorts of subjects with CF-disease and CFTR-related disorders carrying these mutations. Owing to poor specificity, none of tools reliably distinguished between individual mutations that confer CF disease from mutations found in subjects with a CFTR-related disorder or no disease. Prediction scores for CFTR mutations derived from PANTHER showed a significant overall statistical correlation with the spectrum of disease severity associated with mutations in the CFTR gene. In contrast, PolyPhen- and SIFT-derived scores only showed significant differences between CF-causing and non-CF variants. Current computational methods are not recommended for establishing or excluding a CF diagnosis, notably as a newborn screening strategy or in patients with equivocal test results.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 Mutations in the CFTR gene grouped by clinical category Cystic fibrosis CFTR-related disease No disease T338I D614G L320V V920L L90S M470V H199R S1251N I203M G550R P111A I148T Q1291H R560K L1388Q L183I R170H I1027T S549R D443Y P499A L1414S T908N R668C S549N A455E E1401K Q151K G27E I1234L Y563N R347P C866R S1118C P1290S R75Q A559T V520F P841R M469V E1401G P67L G85E S50Y E1409K R933G G458V G178R Y1032C R248T I980K G85V V392G L973P L137H T351S R334W I444S V938G R792G R560T R555G L1339F D1305E P574H V1240G T1053I D58G G551D L1335P I918M F994C S945L L558S F1337V R810G D1152H G1247R P574S R766M D579G W1098R H949R F200I R352Q L1077P K1351E M244K L206W M1101K D1154G L375F N1303K R1066C E528D D110Y R347H R1070Q A800G P1021S S549K A1364V V392A damaging` (is supposed to affect protein function or structure) and 'probably damaging` (high confidence of affecting protein function or structure). Login to comment
57 PI prevalence and in silico prediction scores for 13 most frequent missense mutations identified in Canadian CF patients Mutation Total PI Total (PI + PS) PI prevalence Class PANTHER scorea POLYPHENa SIFTa p.R334W 1 9 0.11 CF-PS -7.4419 Possibly damaging 0.01 p.P67L 2 14 0.14 CF-PS -4.1736 Probably damaging 0 p.R347P 2 12 0.17 CF-PS -7.5259 Possibly damaging 0.01 p.R347H 1 5 0.20 CF-PS -6.8327 Possibly damaging 0 p.A455E 8 39 0.21 CF-PS -8.8641 Probably damaging 0 p.L206W 4 19 0.21 CF-PS -8.5817 Possibly damaging 0 p.P574H 4 7 0.57 CF-PI/PSb -8.1252 Probably damaging 0 p.G85E 15 24 0.63 CF-PI/PSb -7.3194 Possibly damaging 0 p.M1101K 22 33 0.67 CF-PI/PSb -5.8849 Probably damaging 0.01 p.R1066C 7 8 0.88 CF-PI -7.7424 Probably damaging 0 p.G551D 56 59 0.95 CF-PI -9.5654 Probably damaging 0 p.N1303K 47 49 0.96 CF-PI -9.7687 Probably damaging 0 p.V520F 7 7 1.00 CF-PI -7.1652 Benign 0 aPANTHER scores range from zero to negative values (maximum -12). Login to comment
121 Intermediate prediction scores (-7.32 to -5.88) were given for p.G86E, p.M1101K mutations with intermediate PI scores (0.63 and 0.67, respectively), and a low score (-4.17) was assigned to p.P67L with a low PI score (0.14). Login to comment
124 SIFT-generated low (deleterious) scores for missense mutations associated both with the highest (p.N1303K, p.G551D, p.V520F) and the lowest PI prevalence scores (p.A455E, p.P67L, p.L206W). Login to comment

[hide] Cystic fibrosis newborn screening: using experienc... J Inherit Metab Dis. 2010 Oct;33(Suppl 2):S255-61. Epub 2010 Jun 3. Hale JE, Parad RB, Dorkin HL, Gerstle R, Lapey A, O'Sullivan BP, Spencer T, Yee W, Comeau AM
Cystic fibrosis newborn screening: using experience to optimize the screening algorithm.
J Inherit Metab Dis. 2010 Oct;33(Suppl 2):S255-61. Epub 2010 Jun 3., [PMID:20521170]

Abstract [show]
Newborn screening (NBS) for cystic fibrosis (CF) offers the opportunity for early diagnosis and improved outcomes in patients with CF and has been universally available in the state of Massachusetts since 1999 using an immunoreactive trypsinogen (IRT)-DNA algorithm. Ideally, CF NBS is incorporated as part of an integrated NBS system that allows for comprehensive and coordinated education, laboratory screening, clinical follow-up, and evaluation so that evidence-based data can be used to maximize quality improvements and optimize the screening algorithm. The New England Newborn Screening Program (NENSP) retrospectively analyzed Massachusetts's CF newborn screening data that yielded decisions to eliminate a screen-positive category, maintain the IRT cutoff value that prompts the second tier DNA testing, and communicate CF relative risk to primary care providers (PCPs) based on categorization of positive CF NBS results.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
72 The fourth infant had a sweat chloride that was in the borderline range (38 mEq/L) and has a genotype that can be associated with a variable phenotype (P67L/5T). Login to comment
77 Discussion In addition to providing the laboratory services necessary for implementation of CF NBS, effective newborn screen- Table 4 Summary of positive screens identified by Massachusetts failsafe cystic fibrosis (CF) newborn screening (NBS) protocol Top 0.2% [IRT] Top 0.1% [IRT] Total Monitored by CF center 3 1 4 Borderline sweat testa 1 1 2 Negative sweat test 364 136 485 Not sweat testedb 91 62 153 IRT Immunoreactive trypsinogen a Infants do not have CF and are not monitored by a CF center b The 153 infants who did not have a documented sweat test either expired prior to a sweat test (36%), had a QNS sweat test and did not return for repeat sweat test (8%), had parents who refused sweat test (2%), or are lost to follow up (54%) Table 5 Infants followed at a cystic fibrosis (CF) center identified by Massachusetts failsafe CF newobrn screening (NBS) protocol Infant [IRT] (ng/ml) Mutations on NBS panel (n) Sweat [Cl- ] MEq/L Extended genotype results Comments A 141 16 41, 83 G85E/R117C Would be identified by current mutation panel B 503 16 103 Negative for 86 CFTR mutations C 274 16 92 Negative for 86 CFTR mutations D 159 39 38 P67L trans to 5t Does not meet 2008 CFF consensus guidelines for CF but is positive for CRMS CFF Cystic Fibrosis Foundation, CRMS cystic fibrosis transmembrane conductance regulator-related metabolic syndrome (Borowitz 2009) ing programs should collect and monitor outcomes for quality assurance purposes. Login to comment

[hide] Mutations that permit residual CFTR function delay... Respir Res. 2010 Oct 8;11:140. Green DM, McDougal KE, Blackman SM, Sosnay PR, Henderson LB, Naughton KM, Collaco JM, Cutting GR
Mutations that permit residual CFTR function delay acquisition of multiple respiratory pathogens in CF patients.
Respir Res. 2010 Oct 8;11:140., [PMID:20932301]

Abstract [show]
BACKGROUND: Lung infection by various organisms is a characteristic feature of cystic fibrosis (CF). CFTR genotype effects acquisition of Pseudomonas aeruginosa (Pa), however the effect on acquisition of other infectious organisms that frequently precede Pa is relatively unknown. Understanding the role of CFTR in the acquisition of organisms first detected in patients may help guide symptomatic and molecular-based treatment for CF. METHODS: Lung infection, defined as a single positive respiratory tract culture, was assessed for 13 organisms in 1,381 individuals with CF. Subjects were divided by predicted CFTR function: 'Residual': carrying at least one partial function CFTR mutation (class IV or V) and 'Minimal' those who do not carry a partial function mutation. Kaplan-Meier estimates were created to assess CFTR effect on age of acquisition for each organism. Cox proportional hazard models were performed to control for possible cofactors. A separate Cox regression was used to determine whether defining infection with Pa, mucoid Pa or Aspergillus (Asp) using alternative criteria affected the results. The influence of severity of lung disease at the time of acquisition was evaluated using stratified Cox regression methods by lung disease categories. RESULTS: Subjects with 'Minimal' CFTR function had a higher hazard than patients with 'Residual' function for acquisition of 9 of 13 organisms studied (HR ranging from 1.7 to 3.78 based on the organism studied). Subjects with minimal CFTR function acquired infection at a younger age than those with residual function for 12 of 13 organisms (p-values ranging: < 0.001 to 0.017). Minimal CFTR function also associated with younger age of infection when 3 alternative definitions of infection with Pa, mucoid Pa or Asp were employed. Risk of infection is correlated with CFTR function for 8 of 9 organisms in patients with good lung function (>90%ile) but only 1 of 9 organisms in those with poorer lung function (<50%ile). CONCLUSIONS: Residual CFTR function correlates with later onset of respiratory tract infection by a wide spectrum of organisms frequently cultured from CF patients. The protective effect conferred by residual CFTR function is diminished in CF patients with more advanced lung disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 For Pa, the hazard ratio Table 1 Classification of CFTR alleles Category Mutation Specific mutations Class I Defective Protein Synthesis (nonsense, frameshift, aberrant splicing) 1078delT, 1154 insTC, 1525-2A > G, 1717-1G > A, 1898+1G > A, 2184delA, 2184 insA, 3007delG, 3120+1G > A, 3659delC, 3876delA, 3905insT, 394delTT, 4010del4, 4016insT, 4326delTC, 4374+1G > T, 441delA, 556delA, 621+1G > T, 621-1G > T, 711+1G > T, 875+1G > C, E1104X, E585X, E60X, E822X, G542X, G551D/R553X, Q493X, Q552X, Q814X, R1066C, R1162X, R553X, V520F, W1282X, Y1092X Class II Abnormal Processing and Trafficking A559T, D979A, ΔF508, ΔI507, G480C, G85E, N1303K, S549I, S549N, S549R Class III Defective Channel Regulation/Gating G1244E, G1349D, G551D, G551S, G85E, H199R, I1072T, I48T, L1077P, R560T, S1255P, S549 (R75Q) Class IV Decreased Channel Conductance A800G, D1152H, D1154G, D614G, delM1140, E822K, G314E, G576A, G622D, G85E, H620Q, I1139V, I1234V, L1335P, M1137V, P67L, R117C, R117P, R117H, R334W, R347H, R347P, R347P/ R347H, R792G, S1251N, V232D Class V Reduced Synthesis and/or Trafficking 2789+5G > A, 3120G > A, 3272-26A > G, 3849+10kbC > T, 5T variant, 621+3A > G, 711+3A > G, A445E, A455E, IVS8 poly T, P574H was increased 3 fold for those with 'Minimal` function when compared to those with 'Residual` function. Login to comment

[hide] Alpha1-antitrypsin deficiency alleles and the Taq-... Eur Respir J. 1998 Apr;11(4):873-9. Mahadeva R, Westerbeek RC, Perry DJ, Lovegrove JU, Whitehouse DB, Carroll NR, Ross-Russell RI, Webb AK, Bilton D, Lomas DA
Alpha1-antitrypsin deficiency alleles and the Taq-I G-->A allele in cystic fibrosis lung disease.
Eur Respir J. 1998 Apr;11(4):873-9., [PMID:9623690]

Abstract [show]
Cystic fibrosis (CF) is characterized by progressive and ultimately fatal pulmonary disease although there are notable variations in clinical features. This heterogeneity is thought to lie outside the cystic fibrosis transmembrane regulator (CFTR) gene locus and may stem from deficiencies in the antiproteinase screen that protects the lung from proteolytic attack. One hundred and fifty seven patients were recruited from two UK CF centres. The serum concentrations of alpha1-antitrypsin, alpha1-antichymotrypsin and C-reactive protein (CRP) were determined and patients were screened for the common S and Z deficiency alleles of alpha1-antitrypsin and the G-->A mutation in the 3' noncoding region of the alpha1-antitrypsin gene (Taq-I G-->A allele). Alpha1-antitrypsin deficiency phenotypes were detected in 20 (16 MS, 1 S and 3 MZ) out of 147 unrelated tested CF patients and were, surprisingly, associated with significantly better lung function (adjusted mean forced expiratory volume in one second (FEV1) 62.5% of predicted for deficient group and 51.1% pred for normal alleles; p=0.043). The Taq-I G-->A allele was found in 21 out of 150 unrelated patients and had no significant effect on CF lung disease or on levels of alpha1-antitrypsin during the inflammatory response. We show here that, contrary to current thinking, common mutations of alpha1-antitrypsin that are associated with mild to moderate deficiency of the protein predict a subgroup of cystic fibrosis patients with less severe pulmonary disease. Moreover, the Taq-I G-->A allele has no effect on serum levels of alpha1-antitrypsin in the inflammatory response, which suggests that the previously reported association of the Taq-I G-->A allele with chronic obstructive pulmonary disease is not mediated by its effect on the serum level of alpha1-antitrypsin.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 The 39 "other" CF mutations in the normal α1-AT phenotype 508/other group were: six patients G551D, three R117H, three 621+1G→T, two R1162X, two G542X and one each had P67L, 1078delT, 2711delT, 1717-1G→A, V520F, 1898+1G→T, W1310X and N1303K in addition to the ∆F508 mutation. Login to comment

[hide] Are p.I148T, p.R74W and p.D1270N cystic fibrosis c... BMC Med Genet. 2004 Aug 2;5:19. Claustres M, Altieri JP, Guittard C, Templin C, Chevalier-Porst F, Des Georges M
Are p.I148T, p.R74W and p.D1270N cystic fibrosis causing mutations?
BMC Med Genet. 2004 Aug 2;5:19., 2004-08-02 [PMID:15287992]

Abstract [show]
BACKGROUND: To contribute further to the classification of three CFTR amino acid changes (p.I148T, p.R74W and p.D1270N) either as CF or CBAVD-causing mutations or as neutral variations. METHODS: The CFTR genes from individuals who carried at least one of these changes were extensively scanned by a well established DGGE assay followed by direct sequencing and familial segregation analysis of mutations and polymorphisms. RESULTS: Four CF patients (out of 1238) originally identified as carrying the p.I148T mutation in trans with a CF mutation had a second mutation (c.3199del6 or a novel mutation c.3395insA) on the p.I148T allele. We demonstrate here that the deletion c.3199del6 can also be associated with CF without p.I148T. Three CBAVD patients originally identified with the complex allele p.R74W-p.D1270N were also carrying p.V201M on this allele, by contrast with non CF or asymptomatic individuals including the mother of a CF child, who were carrying p.R74W-p.D1270N alone. CONCLUSION: These findings question p.I148T or p.R74W-p.D1270N as causing by themselves CF or CBAVD and emphazises the necessity to perform a complete scanning of CFTR genes and to assign the parental alleles when novel missense mutations are identified.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 The second individual was the mother of a CF girl who was compound heterozygous for p.F508del and p.P67L. Login to comment
52 This woman, who was carrying p.P67L on one CFTR gene and [p.R74W-p.D1270N] on the other (table 1), was completely asymptomatic at age 45 years Table 1: CFTR haplotypes associated with mutations found in CF patients carrying p.I148T in cis with c.3395insA or c.3199del6 and in one CF patient carrying c.3199del6 alone Indiv No. Login to comment
72 A CFTR alteration producing a premature termination signal is a class I mutation, considered severe enough to cause CF by itself and exclude the contribution of any other sequence Table 2: CFTR sequence changes found in individuals carrying missense alterations p.R74W, p.D1270N, or p.V201M Mutations Haplotype IVS1 IVS8 IVS8 IVS8 470 IVS17B IVS17B CA CA TGm Tn TA CA CBAVD1 p.R1066C 22 16 11 7 V 30 13 [p.R74W;p.V201M;p.D1270N] 22 16 11 7 V 31 13 CBAVD2 p.M952I 26 17 10 7 M 7 17 [p.R74W;p.V201M;p.D1270N] 22 16 11 7 V 31 13 CBAVD3 [p.R74W;p.V201M;p.D1270N] 22 16 11 7 V 31 13 [p.R74W;p.V201M;p.D1270N] 22 16 11 7 V 31 13 Individual non affected with CF No mutation 21 nd 10 7 M 7 17 [p.R74W;p.D1270N] 22 nd 11 7 V 30 13 Asymptomatic mother of a CF affected girl p.P67L 23 16 10 7 M 7 17 [p.R74;p.D1270N] 22 16 11 7 V 31 13 change on the same allele. Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... J Cyst Fibros. 2012 Sep;11(5):355-62. doi: 10.1016/j.jcf.2012.05.001. Epub 2012 Jun 2. Ooi CY, Durie PR
Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in pancreatitis.
J Cyst Fibros. 2012 Sep;11(5):355-62. doi: 10.1016/j.jcf.2012.05.001. Epub 2012 Jun 2., [PMID:22658665]

Abstract [show]
BACKGROUND: The pancreas is one of the primary organs affected by dysfunction of the cystic fibrosis transmembrane conductance regulator (CFTR) protein. While exocrine pancreatic insufficiency is a well-recognized complication of cystic fibrosis (CF), symptomatic pancreatitis is often under-recognized. RESULTS: The aim of this review is to provide a general overview of CFTR mutation-associated pancreatitis, which affects patients with pancreatic sufficient CF, CFTR-related pancreatitis, and idiopathic pancreatitis. The current hypothesis regarding the role of CFTR dysfunction in the pathogenesis of pancreatitis, and concepts on genotype-phenotype correlations between CFTR and symptomatic pancreatitis will be reviewed. Symptomatic pancreatitis occurs in 20% of pancreatic sufficient CF patients. In order to evaluate genotype-phenotype correlations, the Pancreatic Insufficiency Prevalence (PIP) score was developed and validated to determine severity in a large number of CFTR mutations. Specific CFTR genotypes are significantly associated with pancreatitis. Patients who carry genotypes with mild phenotypic effects have a greater risk of developing pancreatitis than patients carrying genotypes with moderate-severe phenotypic consequences at any given time. CONCLUSIONS: The genotype-phenotype correlation in pancreatitis is unique compared to other organ manifestations but still consistent with the complex monogenic nature of CF. Paradoxically, genotypes associated with otherwise mild phenotypic effects have a greater risk for causing pancreatitis; compared with genotypes associated with moderate to severe disease phenotypes. Greater understanding into the underlying mechanisms of disease is much needed. The emergence of CFTR-assist therapies may potentially play a future role in the treatment of CFTR-mutation associated pancreatitis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
855 CFTR mutation Total PI Total PI + PS PIP score CFTR mutation Total PI Total PI + PS PIP score 621+1G>T 96 96 1.00 G542X 74 75 0.99 711+1G>T 36 36 1.00 F508del 1276 1324 0.96 I507del 34 34 1.00 1717-1G>A 20 21 0.95 R553X 24 24 1.00 W1282X 19 20 0.95 Q493X 11 11 1.00 N1303K 45 48 0.94 S489X 11 11 1.00 R1162X 12 13 0.92 1154insTC 10 10 1.00 Y1092X 12 13 0.92 3659delC 9 9 1.00 I148T 10 11 0.91 CFTRdele2 7 7 1.00 V520F 9 10 0.90 4016insT 7 7 1.00 G551D 59 67 0.88 E60X 7 7 1.00 L1077P 5 6 0.83 R560T 7 7 1.00 R1066C 5 6 0.83 R1158X 7 7 1.00 2184insA 9 12 0.75 3905insT 6 6 1.00 2143delT 3 4 0.75 I148T;3199del6 5 5 1.00 1161delC 3 4 0.75 2183AA>G 5 5 1.00 3120+1G>A 3 4 0.75 1898+1G>A 5 5 1.00 S549N 3 4 0.75 2347delG 4 4 1.00 G85E 16 22 0.73 Q1313X 3 3 1.00 R117C 2 3 0.67 Q220X 3 3 1.00 M1101K 19 30 0.63 2184delA 3 3 1.00 P574H 3 5 0.60 1078delT 3 3 1.00 474del13BP 1 2 0.50 L1254X 3 3 1.00 R352Q 1 2 0.50 E585X 3 3 1.00 Q1291H 1 2 0.50 3876delA 2 2 1.00 A455E 18 37 0.49 S4X 2 2 1.00 R347P 6 15 0.40 R1070Q 2 2 1.00 2789+5G>A 6 16 0.38 F508C 2 2 1.00 L206W 6 18 0.33 DELI507 2 2 1.00 IVS8-5T 4 16 0.25 Q1411X 2 2 1.00 3272-26A>G 1 4 0.25 365-366insT 2 2 1.00 R334W 1 10 0.10 R709X 2 2 1.00 3849+10kbC>T 2 22 0.09 1138insG 2 2 1.00 P67L 1 14 0.07 CFTRdele2-4 2 2 1.00 R117H 1 25 0.04 3007delG 2 2 1.00 R347H 0 5 0.00 Q814X 2 2 1.00 G178R 0 3 0.00 394delTT 2 2 1.00 E116K 0 2 0.00 406-1G>A 2 2 1.00 875+1G>C 0 2 0.00 R75X 2 2 1.00 V232D 0 2 0.00 CFTRdel2-3 2 2 1.00 D579G 0 2 0.00 E193X 2 2 1.00 L1335P 0 2 0.00 185+1G>T 2 2 1.00 Mild mutations (based on PIP scores) are shaded in gray. Login to comment

[hide] Prospective and parallel assessments of cystic fib... Eur J Pediatr. 2012 Aug;171(8):1223-9. Epub 2012 May 12. Krulisova V, Balascakova M, Skalicka V, Piskackova T, Holubova A, Paderova J, Krenkova P, Dvorakova L, Zemkova D, Kracmar P, Chovancova B, Vavrova V, Stambergova A, Votava F, Macek M Jr
Prospective and parallel assessments of cystic fibrosis newborn screening protocols in the Czech Republic: IRT/DNA/IRT versus IRT/PAP and IRT/PAP/DNA.
Eur J Pediatr. 2012 Aug;171(8):1223-9. Epub 2012 May 12., [PMID:22581207]

Abstract [show]
Cystic fibrosis (CF) is a life-threatening disease for which early diagnosis following newborn screening (NBS) improves the prognosis. We performed a prospective assessment of the immunoreactive trypsinogen (IRT)/DNA/IRT protocol currently in use nationwide, versus the IRT/pancreatitis-associated protein (PAP) and IRT/PAP/DNA CF NBS protocols. Dried blood spots (DBS) from 106,522 Czech newborns were examined for IRT concentrations. In the IRT/DNA/IRT protocol, DNA-testing was performed for IRT >/= 65 ng/mL. Newborns with IRT >/= 200 ng/mL and no detected cystic fibrosis transmembrane conductance regulator gene (CFTR) mutations were recalled for a repeat IRT. In the same group of newborns, for both parallel protocols, PAP was measured in DBS with IRT >/= 50 ng/mL. In PAP-positive newborns (i.e., >/=1.8 if IRT 50-99.9 or >/=1.0 if IRT >/= 100, all in ng/mL), DNA-testing followed as part of the IRT/PAP/DNA protocol. Newborns with at least one CFTR mutation in the IRT/DNA/IRT and IRT/PAP/DNA protocols; a positive PAP in IRT/PAP; or a high repeat IRT in IRT/DNA/IRT were referred for sweat testing. CONCLUSION: the combined results of the utilized protocols led to the detection of 21 CF patients, 19 of which were identified using the IRT/DNA/IRT protocol, 16 using IRT/PAP, and 15 using IRT/PAP/DNA. Decreased cut-offs for PAP within the IRT/PAP protocol would lead to higher sensitivity but would increase false positives. Within the IRT/PAP/DNA protocol, decreased PAP cut-offs would result in high sensitivity, an acceptable number of false positives, and would reduce the number of DNA analyses. Thus, we concluded that the IRT/PAP/DNA protocol would represent the most suitable protocol in our conditions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 According to the protocol, this result indicated the sequencing of the Table 1 Parallel comparison of CF NBS protocols IRT/DNAa /IRT IRT/PAP IRT/PAP/DNAa Newborns screened (N) 106,522 106,522 106,522 IRT positives (N; %) 1,158 (1.09) 3,155 (2.96) 3,155 (2.96) PAP positives (N; %) - 260 (0.24) 260 (0.24) Median age (range) at the availability of DNA-testinga results (days) 36 (9-222b ) - 36 (9-222b ) 1 and/or 2 CF mutations detected (N; %) 76 (0.07) - 27 (0.03) Recalled newborns for repeated IRT examination (N; %) 47 (0.04) - - Positive CF NBS (N; %) 123 (0.12) 260 (0.24) 27 (0.03) Positive IRT in newborns recalled for repeated examination (N) 1 - - ST indicated (N; %) 77 (0.07) 260 (0.24) 27 (0.03) ST carried out (N; % of indicated ST) 72c (93.51) 204c (78.46) 24c (88.89) CF carriers (N) 55 - 12 Prevalence of CF carriers 1 in 21 - 1 in 22 Diagnosed CF patients (N) 19 16 15 False positives based on performed ST (N; % of all cases screened) 99d (0.09) 188 (0.18) 9 (0.01) Newborns with equivocal diagnosis [F508del/R117H-IVS-8 T(7) and ST<30 mmol/L; N] 2 - 0 False negatives (N) 2 5 6 Total of CF patients detected (N) 21e Median age (range) at diagnosis (days) 36 (9-57)e CF prevalence 1 in 5,072e Sensitivity (TP/TP+FN) 0.9048 0.7619 0.7142 Specificity (TN/TN+FP) 0.9991 0.9982 0.9999 PPV (TP/TP+FP) 0.1610 0.0784 0.625 N number, % of all cases screened, TP true positives, FN false negatives, TN true negatives, FP false positives, PPV positive predictive value, ST sweat test a CF-causing mutations covered by Elucigene assays ("legacy" nomenclature) with the CF-EU1Tm accounting for: p.Arg347Pro (R347P), c.2657+ 5G>A (2789+5G>A), c.2988+1G>A (3120+1G>A), c.579+1G>T (711+1G>T), p.Arg334Trp (R334W), p.Ile507del (I507del), p.Phe508del (F508del), c.3718-2477C>T (3849+10kbC>T), p.Phe316LeufsX12 (1078delT), p.Trp1282X (W1282X), p.Arg560Thr (R560T), p.Arg553X (R553X), p.Gly551Asp (G551D), p.Met1101Lys (M1101K), p.Gly542X (G542X), p.Leu1258PhefsX7 (3905insT), p.Ser1251Asn (S1251N), c.1585-1G>A (1717-1G>A), p.Arg117His (R117H), p.Asn1303Lys (N1303K), p.Gly85Glu (G85E), c.1766+1G>A (1898+1G>A), p.Lys684AsnfsX38 (2184delA), p.Asp1152His (D1152H), c.54-5940_273+10250del (CFTRdele2,3), p.Pro67Leu (P67L), p.Glu60X (E60X), p.Lys1177SerfsX15 (3659delC), c.489+1G>T (621+1G>T), p.Ala455Glu (A455E), p.Arg1162X (R1162X), p.Leu671X (2143delT), c.1210-12T[n] (IVS8-T(n) variant), including additional mutations in the CF-EU2Tm : p.Gln890X (Q890X), p.Tyr515X (1677delTA), p.Val520Phe (V520F), c.3140-26A>G (3272-26A>G), p.Leu88IlefsX22 (394delTT), p.Arg1066Cys (R1066C), p.Ile105SerfsX2 (444delA), p.Tyr1092X (C>A) (Y1092X(C>A)), p.Arg117Cys (R117C), p.Ser549Asn (S549N), p.Ser549ArgT>G (S549R T>G), p.Tyr122X (Y122X), p.Arg1158X (R1158X), p.Leu206Trp (L206W), c.1680-886A>G (1811+1.6kbA>G), p.Arg347His (R347H), p.Val739TyrfsX16 (2347delG) and p.Trp846X (W846X) b failed DNA isolation from DBS, including repetition of DNA-testing c deceased patient or non-compliance with referrals (five CF carriers in IRT/DNA/IRT, 56 newborns in IRT/PAP, three CF carriers in IRT/PAP/DNA) d comprising newborns with repeated IRT (47 newborns) e aggregate data from all protocols entire CFTR coding region in both newborns, and led to the identification of p.Ile336Lys (I336K) and p.Glu1104Lys (E1104K) mutations. Login to comment

[hide] An immunocytochemical assay to detect human CFTR e... Mol Cell Probes. 2009 Dec;23(6):272-80. Epub 2009 Jul 15. Davidson H, Wilson A, Gray RD, Horsley A, Pringle IA, McLachlan G, Nairn AC, Stearns C, Gibson J, Holder E, Jones L, Doherty A, Coles R, Sumner-Jones SG, Wasowicz M, Manvell M, Griesenbach U, Hyde SC, Gill DR, Davies J, Collie DD, Alton EW, Porteous DJ, Boyd AC
An immunocytochemical assay to detect human CFTR expression following gene transfer.
Mol Cell Probes. 2009 Dec;23(6):272-80. Epub 2009 Jul 15., [PMID:19615439]

Abstract [show]
BACKGROUND: To assess gene therapy treatment for cystic fibrosis (CF) in clinical trials it is essential to develop robust assays that can accurately detect transgene expression in human airway epithelial cells. Our aim was to develop a reproducible immunocytochemical assay for human CFTR protein which can measure both endogenous CFTR levels and augmented CFTR expression after gene delivery. METHODS: We characterised an antibody (G449) which satisfied the criteria for use in clinical trials. We optimised our immunocytochemistry method and identified G449 dilutions at which endogenous CFTR levels were negligible in CF samples, thus enhancing detection of transgenic CFTR protein. After developing a transfection technique for brushed human nasal epithelial cells, we transfected non-CF and CF cells with a clinically relevant CpG-free plasmid encoding human CFTR. RESULTS: The optimised immunocytochemistry method gave improved discrimination between CF and non-CF samples. Transfection of a CFTR expression vector into primary nasal epithelial cells resulted in detectable RNA and protein expression. CFTR protein was present in 0.05-10% of non-CF cells and 0.02-0.8% of CF cells. CONCLUSION: We have developed a sensitive, clinically relevant immunocytochemical assay for CFTR protein and have used it to detect transgene-expressed CFTR in transfected human primary airway epithelial cells.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
162 TwotransfectedCF samples (1DF508/G542X,11585-1G>A/P67L) and three transfected non-CF samples were negative for plasmid-expressed CFTR. Login to comment
165 TwotransfectedCF samples (1DF508/G542X,11585-1G>A/P67L) and three transfected non-CF samples were negative for plasmid-expressed CFTR. Login to comment

[hide] Genotyping microarray for the detection of more th... J Mol Diagn. 2005 Aug;7(3):375-87. Schrijver I, Oitmaa E, Metspalu A, Gardner P
Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations.
J Mol Diagn. 2005 Aug;7(3):375-87., [PMID:16049310]

Abstract [show]
Cystic fibrosis (CF), which is due to mutations in the cystic fibrosis transmembrane conductance regulator gene, is a common life-shortening disease. Although CF occurs with the highest incidence in Caucasians, it also occurs in other ethnicities with variable frequency. Recent national guidelines suggest that all couples contemplating pregnancy should be informed of molecular screening for CF carrier status for purposes of genetic counseling. Commercially available CF carrier screening panels offer a limited panel of mutations, however, making them insufficiently sensitive for certain groups within an ethnically diverse population. This discrepancy is even more pronounced when such carrier screening panels are used for diagnostic purposes. By means of arrayed primer extension technology, we have designed a genotyping microarray with 204 probe sites for CF transmembrane conductance regulator gene mutation detection. The arrayed primer extension array, based on a platform technology for disease detection with multiple applications, is a robust, cost-effective, and easily modifiable assay suitable for CF carrier screening and disease detection.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS. Login to comment
150 Primers Generated to Create Synthetic Templates That Serve As Positive Mutation Controls Primer name Sense strand 5Ј 3 3Ј Name Antisense strand 5Ј 3 3Ј 175delC synt F T(15)ATTTTTTTCAGGTGAGAAGGTGGCCA 175delC synt R T(15)ATTTGGAGACAACGCTGGCCTTTTCC W19C synt F T(15)TACCAGACCAATTTTGAGGAAAGGAT W19C synt R T(15)ACAGCTAAAATAAAGAGAGGAGGAAC Q39X synt F T(15)TAAATCCCTTCTGTTGATTCTGCTGA Q39X synt R T(15)AGTATATGTCTGACAATTCCAGGCGC 296 ϩ 12TϾC synt F T(15)CACATTGTTTAGTTGAAGAGAGAAAT 296 ϩ 12TϾC synt R T(15)GCATGAACATACCTTTCCAATTTTTC 359insT synt F T(15)TTTTTTTCTGGAGATTTATGTTCTAT 359insT synt R T(15)AAAAAAACATCGCCGAAGGGCATTAA E60X synt F T(15)TAGCTGGCTTCAAAGAAAAATCCTAA E60X synt R T(15)ATCTATCCCATTCTCTGCAAAAGAAT P67L synt F T(15)TTAAACTCATTAATGCCCTTCGGCGA P67L synt R T(15)AGATTTTTCTTTGAAGCCAGCTCTCT R74Q synt F T(15)AGCGATGTTTTTTCTGGAGATTTATG R74Q synt R T(15)TGAAGGGCATTAATGAGTTTAGGATT R75X synt F T(15)TGATGTTTTTTCTGGAGATTTATGTT R75X synt R T(15)ACCGAAGGGCATTAATGAGTTTAGGA W57X(TAG) synt F T(15)AGGATAGAGAGCTGGCTTCAAAGAAA W57X(TAG) synt R T(15)TATTCTCTGCAAAAGAATAAAAAGTG W57X(TGA) synt F T(15)AGATAGAGAGCTGGCTTCAAAGAAAA W57X(TGA) synt R T(15)TCATTCTCTGCAAAAGAATAAAAAGT G91R synt F T(15)AGGGTAAGGATCTCATTTGTACATTC G91R synt R T(15)TTAAATATAAAAAGATTCCATAGAAC 405 ϩ 1GϾA synt F T(15)ATAAGGATCTCATTTGTACATTCATT 405 ϩ 1GϾA synt R T(15)TCCCTAAATATAAAAAGATTCCATAG 405 ϩ 3AϾC synt F T(15)CAGGATCTCATTTGTACATTCATTAT 405 ϩ 3AϾC synt R T(15)GACCCCTAAATATAAAAAGATTCCAT 406 - 1GϾA synt F T(15)AGAAGTCACCAAAGCAGTACAGCCTC 406 - 1GϾA synt R T(15)TTACAAAAGGGGAAAAACAGAGAAAT E92X synt F T(15)TAAGTCACCAAAGCAGTACAGCCTCT E92X synt R T(15)ACTACAAAAGGGGAAAAACAGAGAAA E92K synt F T(15)AAAGTCACCAAAGCAGTACAGCCTCT E92K synt R T(15)TCTACAAAAGGGGAAAAACAGAGAAA 444delA synt F T(15)GATCATAGCTTCCTATGACCCGGATA 444delA synt R T(15)ATCTTCCCAGTAAGAGAGGCTGTACT 574delA synt F T(15)CTTGGAATGCAGATGAGAATAGCTAT 574delA synt R T(15)AGTGATGAAGGCCAAAAATGGCTGGG 621GϾA synt F T(15)AGTAATACTTCCTTGCACAGGCCCCA 621GϾA synt R T(15)TTTCTTATAAATCAAACTAAACATAG Q98P synt F T(15)CGCCTCTCTTACTGGGAAGAATCATA Q98P synt R T(15)GGTACTGCTTTGGTGACTTCCTACAA 457TATϾG synt F T(15)GGACCCGGATAACAAGGAGGAACGCT 457TATϾG synt R T(15)CGGAAGCTATGATTCTTCCCAGTAAG I148T synt F T(15)CTGGAATGCAGATGAGAATAGCTATG I148T synt R T(15)GTGTGATGAAGGCCAAAAATGGCTGG 624delT synt F T(15)CTTAAAGCTGTCAAGCCGTGTTCTAG 624delT synt R T(15)TAAGTCTAAAAGAAAAATGGAAAGTT 663delT synt F T(15)ATGGACAACTTGTTAGTCTCCTTTCC 663delT synt R T(15)CATACTTATTTTATCTAGAACACGGC G178R synt F T(15)AGACAACTTGTTAGTCTCCTTTCCAA G178R synt R T(15)TAATACTTATTTTATCTAGAACACGG Q179K synt F T(15)AAACTTGTTAGTCTCCTTTCCAACAA Q179K synt R T(15)TTCCAATACTTATTTTATCTAGAACA 711 ϩ 5GϾA synt F T(15)ATACCTATTGATTTAATCTTTTAGGC 711 ϩ 5GϾA synt R T(15)TTATACTTCATCAAATTTGTTCAGGT 712 - 1GϾT synt F T(15)TGGACTTGCATTGGCACATTTCGTGT 712 - 1GϾT synt R T(15)TATGGAAAATAAAAGCACAGCAAAAAC H199Y synt F T(15)TATTTCGTGTGGATCGCTCCTTTGCA H199Y synt R T(15)TATGCCAATGCTAGTCCCTGGAAAATA P205S synt F T(15)TCTTTGCAAGTGGCACTCCTCATGGG P205S synt R T(15)TAAGCGATCCACACGAAATGTGCCAAT L206W synt F T(15)GGCAAGTGGCACTCCTCATGGGGCTA L206W synt R T(15)TCAAGGAGCGATCCACACGAAATGTGC Q220X synt F T(15)TAGGCGTCTGCTTTCTGTGGACTTGG Q220X synt R T(15)TATAACAACTCCCAGATTAGCCCCATG 936delTA synt F T(15)AATCCAATCTGTTAAGGCATACTGCT 936delTA synt R T(15)TGATTTTCAATCATTTCTGAGGTAATC 935delA synt F T(15)GAAATATCCAATCTGTTAAGGCATAC 935delA synt R T(15)TATTTCAATCATTTCTGAGGTAATCAC N287Y synt F T(15)TACTTAAGACAGTAAGTTGTTCCAAT N287Y synt R T(15)TATTCAATCATTTTTTCCATTGCTTCT 1002 - 3TϾG synt F T(15)GAGAACAGAACTGAAACTGACTCGGA 1002 - 3TϾG synt R T(15)TCTAAAAAACAATAACAATAAAATTCA 1154insTC syntwt F T(15)ATCTCATTCTGCATTGTTCTGCGCAT 1154insTC syntwt R T(15)TTGAGATGGTGGTGAATATTTTCCGGA 1154insTC syntmt F T(15)TCTCTCATTCTGCATTGTTCTGCGCAT 1154insTC syntmt R T(15)TAGAGATGGTGGTGAATATTTTCCGGA DF311 mt syntV1 F T(15)CCTTCTTCTCAGGGTTCTTTGTGGTG dF311 mt syntV1 R T(15)GAGAAGAAGGCTGAGCTATTGAAGTATC G330X synt F T(15)TGAATCATCCTCCGGAAAATATTCAC G330X synt R T(15)ATTTGATTAGTGCATAGGGAAGCACA S364P synt F T(15)CCTCTTGGAGCAATAAACAAAATACA S364P synt R T(15)GGTCATACCATGTTTGTACAGCCCAG Q359K/T360K mt synt F T(15)AAAAAATGGTATGACTCTCTTGGAGC Q359K/T360K mt synt R T(15)TTTTTTACAGCCCAGGGAAATTGCCG 1078delT synt F T(15)CTTGTGGTGTTTTTATCTGTGCTTCC 1078delT synt R T(15)CAAGAACCCTGAGAAGAAGAAGGCTG 1119delA synt F T(15)CAAGGAATCATCCTCCGGAAAATATT 1119delA synt R T(15)CTTGATTAGTGCATAGGGAAGCACAG 1161delC synt F T(15)GATTGTTCTGCGCATGGCGGTCACTC 1161delC synt R T(15)TCAGAATGAGATGGTGGTGAATATTT T338I synt F T(15)TCACCATCTCATTCTGCATTGTTCTG T338I synt R T(15)ATGAATATTTTCCGGAGGATGATTCC R352Q synt F T(15)AGCAATTTCCCTGGGCTGTACAAACA R352Q synt R T(15)TGAGTGACCGCCATGCGCAGAACAAT L346P synt F T(15)CGCGCATGGCGGTCACTCGGCAATTT L346P synt R T(15)GGAACAATGCAGAATGAGATGGTGGT 1259insA synt F T(15)AAAAAGCAAGAATATAAGACATTGGA 1259insA synt R T(15)TTTTTGTAAGAAATCCTATTTATAAA W401X(TAG)mtsynt F T(15)AGGAGGAGGTCAGAATTTTTAAAAAA W401X(TAG)mtsynt R T(15)TAGAAGGCTGTTACATTCTCCATCAC W401X(TGA) synt F T(15)AGAGGAGGTCAGAATTTTTAAAAAAT W401X(TGA) synt R T(15)TCAGAAGGCTGTTACATTCTCCATCA 1342 - 2AϾC synt F T(15)CGGGATTTGGGGAATTATTTGAGAAA 1342 - 2AϾC synt R T(15)GGTTAAAAAAACACACACACACACAC 1504delG synt F T(15)TGATCCACTGTAGCAGGCAAGGTAGT 1504delG synt R T(15)TCAGCAACCGCCAACAACTGTCCTCT G480C synt F T(15)TGTAAAATTAAGCACAGTGGAAGAAT G480C synt R T(15)ACTCTGAAGGCTCCAGTTCTCCCATA C524X synt F T(15)ACAACTAGAAGAGGTAAGAAACTATG C524X synt R T(15)TCATGCTTTGATGACGCTTCTGTATC V520F synt F T(15)TTCATCAAAGCAAGCCAACTAGAAGA V520F synt R T(15)AGCTTCTGTATCTATATTCATCATAG 1609delCA synt F T(15)TGTTTTCCTGGATTATGCCTGGCACC 1609delCA synt R T(15)CAGAACAGAATGAAATTCTTCCACTG 1717 - 8GϾA synt F T(15)AGTAATAGGACATCTCCAAGTTTGCA 1717 - 8GϾA synt R T(15)TAAAAATAGAAAATTAGAGAGTCACT 1784delG synt F T(15)AGTCAACGAGCAAGAATTTCTTTAGC 1784delG synt R T(15)ACTCCACTCAGTGTGATTCCACCTTC A559T synt F T(15)ACAAGGTGAATAACTAATTATTGGTC A559T synt R T(15)TTAAAGAAATTCTTGCTCGTTGACCT Q552X synt F T(15)TAACGAGCAAGAATTTCTTTAGCAAG Q552X synt R T(15)AACCTCCACTCAGTGTGATTCCACCT S549R(AϾC) synt F T(15)CGTGGAGGTCAACGAGCAAGAATTTC S549R(AϾC) synt R T(15)GCAGTGTGATTCTACCTTCTCCAAGA S549R(TϾG) synt F T(15)GGGAGGTCAACGAGCAAGTATTTC S549R(TϾG) synt R T(15)CCTCAGTGTGATTCCACCTTCTCCAA L558S synt F T(15)CAGCAAGGTGAATAACTAATTATTGG L558S synt R T(15)GAAGAAATTCTCGCTCGTTGACCTCC 1811 ϩ 1.6 kb AϾG synt F T(15)GTAAGTAAGGTTACTATCAATCACAC 1811 ϩ 1.6 kb AϾG synt R T(15)CATCTCAAGTACATAGGATTCTCTGT 1812 - 1GϾA synt F T(15)AAGCAGTATACAAAGATGCTGATTTG 1812 - 1GϾA synt R T(15)TTAAAAAGAAAATGGAAATTAAATTA D572N synt F T(15)AACTCTCCTTTTGGATACCTAGATGT D572N synt R T(15)TTAATAAATACAAATCAGCATCTTTG P574H synt F T(15)ATTTTGGATACCTAGATGTTTTAACA P574H synt R T(15)TGAGAGTCTAATAAATACAAATCAGC 1833delT synt F T(15)ATTGTATTTATTAGACTCTCCTTTTG 1833delT synt R T(15)CAATCAGCATCTTTGTATACTGCTCT Table 4. Continued Primer name Sense strand 5Ј 3 3Ј Name Antisense strand 5Ј 3 3Ј Y563D synt F T(15)GACAAAGATGCTGATTTGTATTTATT Y563D synt R T(15)CTACTGCTCTAAAAAGAAAATGGAAA T582R synt F T(15)GAGAAAAAGAAATATTTGAAAGGTAT T582R synt R T(15)CTTAAAACATCTAGGTATCCAAAAGG E585X synt F T(15)TAAATATTTGAAAGGTATGTTCTTTG E585X synt R T(15)ATTTTTCTGTTAAAACATCTAGGTAT 1898 ϩ 5GϾT synt F T(15)TTTCTTTGAATACCTTACTTATATTG 1898 ϩ 5GϾT synt R T(15)AATACCTTTCAAATATTTCTTTTTCT 1924del7 synt F T(15)CAGGATTTTGGTCACTTCTAAAATGG 1924del7 synt R T(15)CTGTTAGCCATCAGTTTACAGACACA 2055del9ϾA synt F T(15)ACATGGGATGTGATTCTTTCGACCAA 2055del9ϾA synt R T(15)TCTAAAGTCTGGCTGTAGATTTTGGA D648V synt F T(15)TTTCTTTCGACCAATTTAGTGCAGAA D648V synt R T(15)ACACATCCCATGAGTTTTGAGCTAAA K710X synt F T(15)TAATTTTCCATTGTGCAAAAGACTCC K710X synt R T(15)ATCGTATAGAGTTGATTGGATTGAGA I618T synt F T(15)CTTTGCATGAAGGTAGCAGCTATTTT I618T synt R T(15)GTTAATATTTTGTCAGCTTTCTTTAA R764X synt F T(15)TGAAGGAGGCAGTCTGTCCTGAACCT R764X synt R T(15)ATGCCTGAAGCGTGGGGCCAGTGCTG Q685X synt F T(15)TAATCTTTTAAACAGACTGGAGAGTT Q685X synt R T(15)ATTTTTTTGTTTCTGTCCAGGAGACA R709X synt F T(15)TGAAAATTTTCCATTGTGCAAAAGAC R709X synt R T(15)ATATAGAGTTGATTGGATTGAGAATA V754M synt F T(15)ATGATCAGCACTGGCCCCACGCTTCA V754M synt R T(15)TGCTGATGCGAGGCAGTATCGCCTCT 1949del84 synt F T(15)AAAAATCTACAGCCAGACTTTATCTC 1949del84 synt R T(15)TTTTTAGAAGTGACCAAAATCCTAGT 2108delA synt F T(15)GAATTCAATCCTAACTGAGACCTTAC 2108delA synt R T(15)ATTCTTCTTTCTGCACTAAATTGGTC 2176insC synt F T(15)CCAAAAAAACAATCTTTTAAACAGACTGGAGAG 2176insC synt R T(15)GGTTTCTGTCCAGGAGACAGGAGCAT 2184delA synt F T(15)CAAAAAACAATCTTTTAAACAGACTGG 2184delA synt R T(15)GTTTTTTGTTTCTGTCCAGGAGACAG 2105-2117 del13 synt F T(15)AAACTGAGACCTTACACCGTTTCTCA 2105-2117 del13 synt R T(15)TTTCTTTCTGCACTAAATTGGTCGAA 2307insA synt F T(15)AAAGAGGATTCTGATGAGCCTTTAGA 2307insA synt R T(15)TTTCGATGCCATTCATTTGTAAGGGA W846X synt F T(15)AAACACATACCTTCGATATATTACTGTCCAC W846X synt R T(15)TCATGTAGTCACTGCTGGTATGCTCT 2734G/AT synt F T(15)TTAATTTTTCTGGCAGAGGTAAGAAT 2734G/AT synt R T(15)TTAAGCACCAAATTAGCACAAAAATT 2766del8 synt F T(15)GGTGGCTCCTTGGAAAGTGAGTATTC 2766del8 synt R T(15)CACCAAAGAAGCAGCCACCTGGAATGG 2790 - 2AϾG synt F T(15)GGCACTCCTCTTCAAGACAAAGGGAA 2790 - 2AϾG synt R T(15)CGTAAAGCAAATAGGAAATCGTTAAT 2991del32 synt F T(15)TTCAACACGTCGAAAGCAGGTACTTT 2991del32 synt R T(15)AAACATTTTGTGGTGTAAAATTTTCG Q890X synt F T(15)TAAGACAAAGGGAATAGTACTCATAG Q890X synt R T(15)AAAGAGGAGTGCTGTAAAGCAAATAG 2869insG synt F T(15)GATTATGTGTTTTACATTTACGTGGG 2869insG synt R T(15)CACGAACTGGTGCTGGTGATAATCAC 3120GϾA synt F T(15)AGTATGTAAAAATAAGTACCGTTAAG 3120GϾA synt R T(15)TTGGATGAAGTCAAATATGGTAAGAG 3121 - 2AϾT synt F T(15)TGTTGTTATTAATTGTGATTGGAGCT 3121 - 2AϾT synt R T(15)AGTAAGATCAAAGAAAACATGTTGGT 3132delTG synt F T(15)TTGATTGGAGCCATAGCAGTTGTCGC 3132delTG synt R T(15)AATTAATAACAACTGTAAGATCAAAG 3271delGG synt F T(15)ATATGACAGTGAATGTGCGATACTCA 3271delGG synt R T(15)ATTCAGATTCCAGTTGTTTGAGTTGC 3171delC synt F T(15)ACCTACATCTTTGTTGCAACAGTGCC 3171delC synt R T(15)AGGTTGTAAAACTGCGACAACTGCTA 3171insC synt F T(15)CCCCTACATCTTTGTTGCTACAGTGC 3171insC synt R T(15)GGGGTTGTAAAACTGCGACAACTGCT 3199del6 synt F T(15)GAGTGGCTTTTATTATGTTGAGAGCATAT 3199del6 synt R T(15)CCACTGGCACTGTTGCAACAAAGATG M1101K synt F T(15)AGAGAATAGAAATGATTTTTGTCATC M1101K synt R T(15)TTTTGGAACCAGCGCAGTGTTGACAG G1061R synt F T(15)CGACTATGGACACTTCGTGCCTTCGG G1061R synt R T(15)GTTTTAAGCTTGTAACAAGATGAGTG R1066L synt F T(15)TTGCCTTCGGACGGCAGCCTTACTTT R1066L synt R T(15)AGAAGTGTCCATAGTCCTTTTAAGCT R1070P synt F T(15)CGCAGCCTTACTTTGAAACTCTGTTC R1070P synt R T(15)GGTCCGAAGGCACGAAGTGTCCATAG L1077P synt F T(15)CGTTCCACAAAGCTCTGAATTTACAT L1077P synt R T(15)GGAGTTTCAAAGTAAGGCTGCCGTCC W1089X synt F T(15)AGTTCTTGTACCTGTCAACACTGCGC W1089X synt R T(15)TAGTTGGCAGTATGTAAATTCAGAGC L1093P synt F T(15)CGTCAACACTGCGCTGGTTCCAAATG L1093P synt R T(15)GGGTACAAGAACCAGTTGGCAGTATG W1098R synt F T(15)CGGTTCCAAATGAGAATAGAAATGAT W1098R synt R T(15)GGCGCAGTGTTGACAGGTACAAGAAC Q1100P synt F T(15)CAATGAGAATAGAAATGATTTTTGTC Q1100P synt R T(15)GGGAACCAGCGCAGTGTTGACAGGTA D1152H synt F T(15)CATGTGGATAGCTTGGTAAGTCTTAT D1152H synt R T(15)GTATGCTGGAGTTTACAGCCCACTGC R1158X synt F T(15)TGATCTGTGAGCCGAGTCTTTAAGTT R1158X synt R T(15)ACATCTGAAATAAAAATAACAACATT S1196X synt F T(15)GACACGTGAAGAAAGATGACATCTGG S1196X synt R T(15)CAATTCTCAATAATCATAACTTTCGA 3732delA synt F T(15)GGAGATGACATCTGGCCCTCAGGGGG 3732delA synt R T(15)CTCCTTCACGTGTGAATTCTCAATAA 3791delC synt F T(15)AAGAAGGTGGAAATGCCATATTAGAG 3791delC synt R T(15)TTGTATTTTGCTGTGAGATCTTTGAC 3821delT synt F T(15)ATTCCTTCTCAATAAGTCCTGGCCAG 3821delT synt R T(15)GAATGTTCTCTAATATGGCATTTCCA Q1238X synt F T(15)TAGAGGGTGAGATTTGAACACTGCTT Q1238X synt R T(15)AGCCAGGACTTATTGAGAAGGAAATG S1255X (ex19)synt F T(15)GTCTGGCCCTCAGGGGGCCAAATGAC S1255X (ex19) synt R T(15)CGTCATCTTTCTTCACGTGTGAATTC S1255X;L synt F T(15)AAGCTTTTTTGAGACTACTGAACACT S1255X;L synt R T(15)TATAACAAAGTAATCTTCCCTGATCC 3849 ϩ 4AϾG synt F T(15)GGATTTGAACACTGCTTGCTTTGTTA 3849 ϩ 4AϾG synt R T(15)CCACCCTCTGGCCAGGACTTATTGAG 3850 - 1GϾA synt F T(15)AGTGGGCCTCTTGGGAAGAACTGGAT 3850 - 1GϾA synt R T(15)TTATAAGGTAAAAGTGATGGGATCAC 3905insT synt F T(15)TTTTTTTGAGACTACTGAACACTGAA 3905insT synt R T(15)AAAAAAAGCTGATAACAAAGTACTCT 3876delA synt F T(15)CGGGAAGAGTACTTTGTTATCAGCTT 3876delA synt R T(15)CGATCCAGTTCTTCCCAAGAGGCCCA G1244V synt F T(15)TAAGAACTGGATCAGGGAAGAGTACT G1244V synt R T(15)ACCAAGAGGCCCACCTATAAGGTAAA G1249E synt F T(15)AGAAGAGTACTTTGTTATCAGCTTTT G1249E synt R T(15)TCTGATCCAGTTCTTCCCAAGAGGCC S1251N synt F T(15)ATACTTTGTTATCAGCTTTTTTGAGACTACTG S1251N synt R T(15)TTCTTCCCTGATCCAGTTCTTCCCAA S1252P synt F T(15)CCTTTGTTATCAGCTTTTTTGAGACT S1252P synt R T(15)GACTCTTCCCTGATCCAGTTCTTCCC D1270N synt F T(15)AATGGTGTGTCTTGGGATTCAATAAC D1270N synt R T(15)TGATCTGGATTTCTCCTTCAGTGTTC W1282R synt F T(15)CGGAGGAAAGCCTTTGGAGTGATACC W1282R synt R T(15)GCTGTTGCAAAGTTATTGAATCCCAA R1283K synt F T(15)AGAAAGCCTTTGGAGTGATACCACAG R1283K synt R T(15)TTCCACTGTTGCAAAGTTATTGAATC 4005 ϩ 1GϾA synt F T(15)ATGAGCAAAAGGACTTAGCCAGAAAA 4005 ϩ 1GϾA synt R T(15)TCTGTGGTATCACTCCAAAGGCTTTC 4010del4 synt F T(15)GTATTTTTTCTGGAACATTTAGAAAAAACTTGG 4010del4 synt R T(15)AAAATACTTTCTATAGCAAAAAAGAAAAGAAGAA 4016insT synt F T(15)TTTTTTTCTGGAACATTTAGAAAAAACTTGG 4016insT synt R T(15)AAAAAAATAAATACTTTCTATAGCAAAAAAGAAAAGAAGA CFTRdele21 synt F T(15)TAGGTAAGGCTGCTAACTGAAATGAT CFTRdele21 synt R T(15)CCTATAGCAAAAAAGAAAAGAAGAAGAAAGTATG 4382delA synt F T(15)GAGAGAACAAAGTGCGGCAGTACGAT 4382delA synt R T(15)CTCTATGACCTATGGAAATGGCTGTT Bold, mutation allele of interest; bold and italicized, modified nucleotide. Login to comment

[hide] Diagnostic testing by CFTR gene mutation analysis ... J Mol Diagn. 2005 May;7(2):289-99. Schrijver I, Ramalingam S, Sankaran R, Swanson S, Dunlop CL, Keiles S, Moss RB, Oehlert J, Gardner P, Wassman ER, Kammesheidt A
Diagnostic testing by CFTR gene mutation analysis in a large group of Hispanics: novel mutations and assessment of a population-specific mutation spectrum.
J Mol Diagn. 2005 May;7(2):289-99., [PMID:15858154]

Abstract [show]
Characterization of CFTR mutations in the U.S. Hispanic population is vital to early diagnosis, genetic counseling, patient-specific treatment, and the understanding of cystic fibrosis (CF) pathogenesis. The mutation spectrum in Hispanics, however, remains poorly defined. A group of 257 self-identified Hispanics with clinical manifestations consistent with CF were studied by temporal temperature gradient electrophoresis and/or DNA sequencing. A total of 183 mutations were identified, including 14 different amino acid-changing novel variants. A significant proportion (78/85) of the different mutations identified would not have been detected by the ACMG/ACOG-recommended 25-mutation screening panel. Over one third of the mutations (27/85) occurred with a relative frequency >1%, which illustrates that the identified mutations are not all rare. This is supported by a comparison with other large CFTR studies. These results underscore the disparity in mutation identification between Caucasians and Hispanics and show utility for comprehensive diagnostic CFTR mutation analysis in this population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
165 Due to ascertainment bias, six mutations not included in the recommended panel occurred with a relative frequency greater than 1%: E60X, G576A, I1027T, P67L, R668C, and S1235R. Login to comment

[hide] Complete gene scanning by temperature gradient cap... J Mol Diagn. 2005 Feb;7(1):111-20. Chou LS, Gedge F, Lyon E
Complete gene scanning by temperature gradient capillary electrophoresis using the cystic fibrosis transmembrane conductance regulator gene as a model.
J Mol Diagn. 2005 Feb;7(1):111-20., [PMID:15681482]

Abstract [show]
Many inherited diseases involve large genes with many different mutations. Identifying a wide spectrum of mutations requires an efficient gene-scanning method. By differentiating thermodynamic stability and mobility of heteroduplexes from heterozygous samples, temperature gradient capillary electrophoresis (TGCE) was used to scan the entire coding region of the cystic fibrosis transmembrane conductance regulator gene. An initial panel (29 different mutations) showed 100% agreement between TGCE scanning and previously genotyped results for heterozygous samples. Different peak patterns were observed for single base substitutions and base insertions/deletions. Subsequently, 12 deidentified clinical samples genotyped as wild type for 32 mutations were scanned for the entire 27 exons. Results were 100% concordance with the bidirectional sequence analysis. Ten samples had nucleotide variations including a reported base insertion in intron 14b (2789 + 2insA) resulting in a possible mRNA splicing defect, and an unreported missense mutation in exon 20 (3991 G/A) with unknown clinical significance. This methodology does not require labeled primers or probes for detection and separation through a temperature gradient eliminates laborious temperature optimization required for other technologies. TGCE automation and high-throughput capability can be implemented in a clinical environment for mutation scanning with high sensitivity, thus reducing sequencing cost and effort.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
190 Entire 27 CF Exons of 12 Deidentified DNA Samples Scanned by TGCE Method Exon Amplicon size (bp) Alterations* Confirmation by sequencing Consequence† 1 335 1 125 G/C Sequence variation (5Ј flanking) 2 210 0 3 234 1 332 C/T Change Pro to Leu at 67 4 270 0 5 186 0 6a 248 1 875 ϩ 40 A/G Sequence variation in intron 6a 6b 239 4 IVS6a (GATT)n‡ Sequence variation in intron 6a 7 345 0 8 233 0 9 263 0 10 292 0 11 175 0 12 250 0 13 834 0 14a 248 5 2694 T/G No change (Thr at 854) 14b 192 1 2789 ϩ 2 ins A Suspected deleterious 15 322 1 3030 G/A No change (Thr at 966) 16 216 0 17a 243 0 17b 292 0 18 217 0 19 322 0 20 206 1 3991 G/A Unknown mutation, change Gly to Arg at 1287 21 250 1 4029 A/G No change (Thr at 1299) 22 249 0 23 193 0 24 250 4 4521 G/A No change (Gln at 1463) Total Amplicon analyzed Potential SNP (%)§ 27 324 5% *Number of samples containing potential alterations (n ϭ 12). Login to comment

[hide] High heterogeneity of CFTR mutations and unexpecte... J Cyst Fibros. 2004 Dec;3(4):265-72. des Georges M, Guittard C, Altieri JP, Templin C, Sarles J, Sarda P, Claustres M
High heterogeneity of CFTR mutations and unexpected low incidence of cystic fibrosis in the Mediterranean France.
J Cyst Fibros. 2004 Dec;3(4):265-72., [PMID:15698946]

Abstract [show]
In this report, we present updated spectrum and frequency of mutations of the CFTR gene that are responsible for cystic fibrosis (CF) in Languedoc-Roussillon (L-R), the southwestern part of France. A total of 75 different mutations were identified by DGGE in 215 families, accounting for 97.6% of CF genes and generating 88 different mutational genotypes. The frequency of p.F508del was 60.23% in L-R versus 67.18% in the whole country and only five other mutations (p.G542X, p.N1303K, p.R334W, c.1717-1G>A, c.711+1G>T) had a frequency higher than 1%. The mutations were scattered over 20 exons or their border. This sample representing only 5.7% of French CF patients contributed to 24% of CFTR mutations reported in France. This is one of the highest molecular allelic heterogeneity reported so far in CF. We also present the result of a neonatal screening program based on a two-tiered approach "IRT/20 mutations/IRT" analysis on blood spots, implemented in France with the aim to improve survival and quality of life of patients diagnosed before clinical onset. This 18-month pilot project showed an unexpected low incidence of CF (1/8885) in South of France, with only six CF children detected among 43,489 neonates born in L-R, and 13 among 125,339 neonates born in Provence-Alpes-Cote-d'Azur (PACA).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
68 of chromosomes (frequency %) p.M1V 1 1 (0.23) p.M1K 1 1 (0.23) c.300delA 3 1 (0.23) p.P67L 3 1 (0.23) c.359insT 3 1 (0.23) p.G85E 3 3 (0.70) c.394delTT 3 1 (0.23) p.Q98R 4 1 (0.23) p.R117H 4 2 (0.47) p.Y122X 4 2 (0.47) p.Y161N 4 1 (0.23) c.621+1GNT intron 4 1 (0.23) c.621+2TNG intron 4 1 (0.23) p.I175V 5 2 (0.47) c.711+1GNT intron 5 5 (1.16) p.L206W 6 3 (0.70) p.Q220X 6 1 (0.23) p.L227R 6 1 (0.23) c.1078delT 7 2 (0.47) p.R334W 7 7 (1.63) p.R347P 7 2 (0.47) c.1215delG 7 1 (0.23) c.T5 intron 8 1 (0.23) p.D443Y 9 1 (0.23) p.I506T 10 1 (0.23) p.I507del 10 4 (0.93) p.F508del 10 259 (60.23) p.F508C 10 1 (0.23) c.1677delTA 10 1 (0.23) c.1717-8GNA intron 10 1 (0.23) c.1717-1GNA intron 10 6 (1.40) p.G542X 11 23 (5.35) p.S549R 11 1 (0.23) p.G551D 11 2 (0.47) p.R553X 11 1 (0.23) c1811+1.6kbANG intron 11 4 (0.93) c.1812-1GNA intron 11 1 (0.23) p.T582I 12 1 (0.23) p.E585X 12 2 (0,47) c.1898+1GNA intron 12 1 (0.23) [c.1898+5GNA ;p.E725K] intron 12 1 (0.23) c.1898+73TNG intron 12 1 (0.23) c.2183AANG 13 4 (0.93) c.2184insA 13 1 (0.23) p.K710X 13 4 (0.93) c.2423delG 13 1 (0.23) p.S776X 13 1 (0.23) c.2493ins8 13 1 (0.23) p.R792X 13 1 (0.23) p.K830X 13 1 (0.23) p.D836Y 14a 1 (0.23) p.W846X1 14a 1 (0.23) c.2711delT 14a 1 (0.23) c.2789+5GNA intron 14b 3 (0.70) p.S945L 15 3 (0.70) p.D993Y 16 1 (0.23) c.3129del4 17a 1 (0.23) c.3195del6 17a 1 (0.23) c.3272-26ANG intron 17a 1 (0.23) [c.3395insA ;pI148T] 17b/4 1 (0,23) p.Y1092X 17b 3 (0.70) Table 1 (continued) Mutation Location exon/intron No. Login to comment

[hide] Genotype and phenotype correlations in patients wi... Gastroenterology. 2002 Dec;123(6):1857-64. Durno C, Corey M, Zielenski J, Tullis E, Tsui LC, Durie P
Genotype and phenotype correlations in patients with cystic fibrosis and pancreatitis.
Gastroenterology. 2002 Dec;123(6):1857-64., [PMID:12454843]

Abstract [show]
BACKGROUND & AIMS: Pancreatitis is known to occur in some patients with cystic fibrosis (CF), but the prevalence, natural history, and genotypic basis are unclear. We examined a well-defined cohort of patients with CF to answer these questions. METHODS: Patients with CF were identified from a computerized database (1966-1996). Chart audit identified all patients with CF and pancreatitis. RESULTS: Among 1075 patients with CF, 937 (87%) were pancreatic insufficient at diagnosis, 28 (3%) were pancreatic sufficient but developed pancreatic insufficiency after diagnosis, and 110 (10%) have remained pancreatic sufficient. No patients with pancreatic insufficiency developed pancreatitis. Nineteen patients (17.3%) with pancreatic sufficiency experienced one or more attacks of pancreatitis. The mean age at diagnosis of pancreatitis was 22.7 +/- 10.3 years (range, 10-35 years), and pancreatitis was recognized before the diagnosis of CF in 6 patients (32%). The diagnosis of CF in pancreatic-sufficient patients, with and without pancreatitis, was established at a significantly older age than in those with pancreatic insufficiency (P < 0.0001). Genotyped patients with pancreatic insufficiency carried 2 severe mutant alleles. All genotyped patients with pancreatic sufficiency and pancreatitis carried at least one mild mutation. No specific genotype was predictive of pancreatitis. CONCLUSIONS: Patients with CF with pancreatic sufficiency carry at least one mild mutant allele and are at a significant risk of developing pancreatitis. Symptoms of pancreatitis may precede the diagnosis of CF. Pancreatitis is associated with an otherwise mild CF phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
105 CFTR Genotypes Among CF Patients With PS With and Without Pancreatitis Two mutations (n) ⌬F508/R117H (9) ⌬F508/(5T) (6) ⌬F508/3272-26A 3 G (4) ⌬F508/R347H (2) ⌬F508/P574H (2) ⌬F508/875 ϩ 1G Ͼ C (2) ⌬F508/3849 ϩ 10kb C 3 T (1) ⌬F508/A455E (1) ⌬F508/D614G (1) ⌬F508/G85E (1) ⌬F508/R347P (1) ⌬F508/S1251N (1) ⌬F508/⌬F508a (1) ⌬F508/3120G Ͼ A (1) ⌬F508/G551Da (1) G542X/R117H (1) R560T/L206W (1) R117H/R117H (1) R31L/P67L (1) 1461ins4 (AGAT)/G85E (1) G551D/(5T) (1) R1066C/3849 ϩ 10kb C Ͼ T (1) G551D/3849 ϩ 10kb C Ͼ T (1) R334W/R334W (1) R334W/681delC (1) W1282X/3489 ϩ 10kb C Ͼ T (1) One mutation (n) ⌬F508/- (18) L1077P/- (1) W1282X/- (1) M1137V/- (1) G551D/- (1) R347H/- (1) Q30X1/- (1) G1244E/- (1) R117H/- (1) 621 ϩ 2G621 ϩ 1G 3 T/- (1) NOTE. Login to comment
124 of episodes of pancreatitis Genotype 1 0.3 12 21.7 2 ⌬F508/S1251N 2 0.3 34 30.0 1 ⌬F508/R347H 3 4.4 13 42.5 3 / 4 4.4 21 36.5 1 ⌬F508/ 5 7.3 26 40.8 10 ⌬F508/P67L 6 9.6 29 29.9 (D) 1 ⌬F508/ 7 12.0 18 39.9 1 ⌬F508/R347P 8 12.9 37 40.9 2 G542X/D1152H 9 13.0 30 50.3 1 ⌬F508/3849 ϩ 10Kbc Ͼ T 10 14.7 13 21.5 1 DF508/R117H 11 15.6 34 40.8 1 ⌬F508/2789ϩ5G Ͼ T 12 15.6 10 26.0 10 ⌬F508/R117H 13 16.0 10 22.0 14 ⌬F/508/3849 ϩ 10kbC Ͼ T 14 16.0 18 21.2 (D) 1 R1066C/3849 ϩ 10kbC Ͼ T 15 19.9 15 40.8 5 No DNA 16 23.2 19 23.2 15 ⌬F508/11234V 17 24.1 40 47.6 (D) 1 No DNA 18 26.9 25 43.3 12 No DNA 19 27.4 35 50.3 (D) 2 ⌬F508/A455E NOTE. Login to comment

[hide] Spectrum of CFTR mutations in cystic fibrosis and ... Hum Mutat. 2000;16(2):143-56. Claustres M, Guittard C, Bozon D, Chevalier F, Verlingue C, Ferec C, Girodon E, Cazeneuve C, Bienvenu T, Lalau G, Dumur V, Feldmann D, Bieth E, Blayau M, Clavel C, Creveaux I, Malinge MC, Monnier N, Malzac P, Mittre H, Chomel JC, Bonnefont JP, Iron A, Chery M, Georges MD
Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France.
Hum Mutat. 2000;16(2):143-56., [PMID:10923036]

Abstract [show]
We have collated the results of cystic fibrosis (CF) mutation analysis conducted in 19 laboratories in France. We have analyzed 7, 420 CF alleles, demonstrating a total of 310 different mutations including 24 not reported previously, accounting for 93.56% of CF genes. The most common were F508del (67.18%; range 61-80), G542X (2.86%; range 1-6.7%), N1303K (2.10%; range 0.75-4.6%), and 1717-1G>A (1.31%; range 0-2.8%). Only 11 mutations had relative frequencies >0. 4%, 140 mutations were found on a small number of CF alleles (from 29 to two), and 154 were unique. These data show a clear geographical and/or ethnic variation in the distribution of the most common CF mutations. This spectrum of CF mutations, the largest ever reported in one country, has generated 481 different genotypes. We also investigated a cohort of 800 French men with congenital bilateral absence of the vas deferens (CBAVD) and identified a total of 137 different CFTR mutations. Screening for the most common CF defects in addition to assessment for IVS8-5T allowed us to detect two mutations in 47.63% and one in 24.63% of CBAVD patients. In a subset of 327 CBAVD men who were more extensively investigated through the scanning of coding/flanking sequences, 516 of 654 (78. 90%) alleles were identified, with 15.90% and 70.95% of patients carrying one or two mutations, respectively, and only 13.15% without any detectable CFTR abnormality. The distribution of genotypes, classified according to the expected effect of their mutations on CFTR protein, clearly differed between both populations. CF patients had two severe mutations (87.77%) or one severe and one mild/variable mutation (11.33%), whereas CBAVD men had either a severe and a mild/variable (87.89%) or two mild/variable (11.57%) mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
109 h M1K, K14X, W19X, 211delG, G27E, R31C, 237insA, 241delAT, Q39X, 244delTA, 296+2T>C, 297-3C>T, W57X+F87L, 306delTAGA, P67L, A72D, 347delC, R75Q, 359insT, 394delT, 405+4A>G, Q98R, 457TAT>G, R117H+5T, R117H+I1027T, R117L, R117P, H139R, A141D, M152V, N186K, D192N, D192del, E193X, 711+1G>A, 711+3A>G, 712-1G>T, L206F, W216X, C225R, Q237E, G241R, 852del22, 876-14del12, 905delG, 993del5, E292K, Y304X, F311del, 1161delC, R347L, R352Q, W361R, 1215delG, S364P, S434X, D443Y, S466X, C491R, T501A, I506T, F508C, I507del+F508C, F508del+L467F, 1774delCT, R553G, 1802delC, 1806delA, A559E, Y563N, 1833delT, Y569C, Y569H, Y569X, G576X, G576A, T582I, 1898+3A>G+186-13C>G, 1918delGC, R600G, L610S, G628R, 2043delG, 2118del4, E664X, 2174insA, Q689X, K698R, K716X, L732X, 2347delG, 2372del8, R764X, 2423delG, S776X, 2634insT, 2640delT, C866Y, 2752-1G>T, W882X, Y913C, V920M, 2896insAG, H939D, H939R, D979V, D985H, D993Y, 3120G>A, I1005R, 3195del6, 3293delA, 3320ins5, W1063X, A1067T, 3359delCT, T1086I, W1089X, Y1092X+S1235R, W1098X, E1104X, R1128X, 3532AC>GTA, 3548TCAT>G, M1140del, 3600G>A, R1162L, 3667ins4, 3732delA+K1200E, S1206X, 3791delC, S1235R+5T, Q1238R, Q1238X, 3849+4A>G, T1246I, 3869insG, S1255P, R1283K, F1286S, 4005+1G>T, 4006-8T>A, 4015delA, N1303H, N1303I, 4172delGC, 4218insT, 4326delTC, Q1382X, 4375-1C>T, 4382delA, D1445N, CF40kbdel4-10, Cfdel17b. Login to comment

[hide] A comparison of fluorescent SSCP and denaturing HP... Hum Mutat. 2000;15(6):556-64. Ellis LA, Taylor CF, Taylor GR
A comparison of fluorescent SSCP and denaturing HPLC for high throughput mutation scanning.
Hum Mutat. 2000;15(6):556-64., [PMID:10862085]

Abstract [show]
We examined 67 different mutations in 16 different amplicons in a comparison of mutation detection by fluorescent single strand conformation polymorphism (F-SSCP) and by denaturing HPLC (DHPLC). F-SSCP was used to analyze fluorescent amplicons with internal size standards and automated fragment analysis (GeneScan, PE Applied Biosystems, Foster City, CA). In DHPLC, unlabelled amplicons were analyzed by reverse phase HPLC with fragment detection by absorbance at 260nm. Both methods had high sensitivity (95-100%) and specificity (100%). Overall, F-SSCP with external temperature control was the more sensitive method, but DHPLC was particularly useful for the rapid analysis of novel fragments.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
97 Comparison of F-SSCP and DHPLC Using a Panel of ABCC7 Mutations Gel condition Location Location 49:1 49:1 49:1 49:1 MDE MDE MDE Capillary DHPLC °C from 5' (bp) from 3' (bp) 15 20 25 35 20 25 35 35 N/A Exon 3 (320bp) E60X 128 192 + + + + + + + + - P67L 150 170 + + + - + + + - + R75X 173 147 + + + + + + + + + R75Q 174 146 + + + - + + + + + G85E 204 116 + + + - + + + + + L88S 213 107 + + + + + + + + + Exon 4 (400bp) 441delA 135 265 + + + + + + + + + D110H 154 246 + + + + + + - + + R117H/H 176 224 + + + + + + + + N/A R117R/H 176 224 + + + + + + + + + L137H 236 164 + + + + + + + + + I148T 261 139 + + + + + + + + + 621+1 (G>T) 309 91 + + + + + + + + + Exon 7 (360bp) R334W 180 180 + + + + + + + - + 1058delC 105 255 + + + + + + + + + 1078delT 125 235 + + + - + + + + + 1138insG 226 134 - + + - + + + + + 1154insTC 202 158 + + + + + + + + + 1161delC 209 151 + + + + + + + + + R347H 220 140 + + + + + + - + + R347P 220 140 + + + - + + + - + A349V 226 134 + + + + + + + + + W356X 248 112 + + + + + + + + + Exon 10 (365bp) M470V 143 222 + + + + + + + + + Q493X 212 153 + + + + + + - + - DelF508 255 110 + + + + + + + + - Del I507 253 112 + + + + + + + + + V520F 293 72 + + - + + - + - + Exon 11 (190bp) 1717-1 (G>A) 54 136 + + + - + + - + + G542X 94 96 + + + - + + - + + S549N 116 74 + + + + + + + + - S549R 117 73 + + + + - - - + + G551D 122 68 + - - - + + + - + R553X 127 63 + + + + + + + + + G551D/R553X + + + + + + + + + R560T 149 41 + + + - - - - - + R560K 149 41 + + + - + + + - + 1811+1 (G>C) 150 40 + + + + + + + + + Exon 12 (250bp) 1898+1(G>A) 167 83 + + + + + + - + + Exon 13a (290bp) C590W 87 203 + + - - + - - + + Exon 13b (405bp) 2184insA 148 257 + + + + + + + - + R709X 220 185 - + - - - - - - + V754M 453 52 + + + + + + + - - Exon 13c (345bp) V754M 65 280 + + + + + + - - + R785X 158 187 + + - - + + - - + Exon 19 (370bp) 3601-17 (T>C) 29 341 - + + - + + + - + R1162X 61 309 + + - - + - - + + 3659delC 105 265 - - - + + + + + + Y1182X 123 247 - + + - + + + - + Exon 20 (370bp) W1282X 186 184 + + + + + + + + + % detected 90 96 86 66 94 88 74 72 90 remainder were detected using DGGE. Login to comment

[hide] SSCP analysis: a blind sensitivity trial. Hum Mutat. 1997;10(1):65-70. Jordanova A, Kalaydjieva L, Savov A, Claustres M, Schwarz M, Estivill X, Angelicheva D, Haworth A, Casals T, Kremensky I
SSCP analysis: a blind sensitivity trial.
Hum Mutat. 1997;10(1):65-70., [PMID:9222762]

Abstract [show]
Studies of the sensitivity of SSCP analysis usually have been performed under conditions contrary to the rules of quality control trials and have produced widely different results. We have performed a blind trial of the sensitivity of SSCP analysis for the detection of mutations in fragments up to 500 bp in length under a fixed single set of electrophoretic conditions. The mutation detection rate was 84%. In addition, we have identified a second mutation in nine samples. All these mutations are polymorphisms, including a novel polymorphism 1248 + 52T/C first reported in the present work.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
22 List of Mutations Included in the Experiment and Original Method of Detection Used by the Referring Laboratory Referring Probe Original method laboratory no.a Mutation Exon of detection Original SSCP conditions Institut de 1 1677delTA 10 Heteroduplexes Recerca 1 1859G/C 12 DDGE Oncologica, 3 W1282X 20 SSCPb 6% 19:1 (AA:bisAA) 4°C 5h 30W Department 4 delF508 10 Heteroduplexes de Genetica 4 Q1313X 20 SSCPb 6% 19:1 (AA:bisAA) 4°C 5h 30W Molecular, 5 1609delCA 10 SSCPb 6% 19:1 (AA:bisAA) RT 28h 10W10% glycerol Barcelona, 7 T582R 12 DGGE Spain 8 1898+3G→A ivs 12 DGGE Molecular 910085 1161delC 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Genetics 860176 1138insG 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Laboratory, 930215 1154insTC 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Royal 930838 delF508 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Manchester 930127 delI507 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Children`s 931205 Q493X 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Hospital, 900592 V520F 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm UK G12984 S489X 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 910143 G551D 11 ARMS 930274 S549N 11 SSCP/Heteroduplexes 10% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 920132 1811+1G→C ivs 11 SSCP/Heteroduplexes 10% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 930140 1898+1G→A ivs 12 SSCP/Heteroduplexes 930334 W1282X 20 SSCP/Heteroduplexes 7.25% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 140735 3850-1G→A 20 SSCP/Heteroduplexes 7.25% 49:1 (AA:bisAA) 4°C 20 h 10 V/cm Laboratoire 293 G551D 11 SSCPb 5% 19:1 (AA:bisAA) 4°C 5 h 50W and de Biochimie 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol Genetique, 324 S549R 11 ASO Hybridization Centre 649 1898+1G→A ivs 12 DGGE Hospitalier 583 E585X 12 DGGE Universitaire 710 L967S 15 DGGE Montpellier, 325 S945L 15 SSCPb 5% 19:1 (AA:bisAA) 4° 5h 50W and France 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 473 N1303H 21 SSCPb 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 216 300delA 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 287 394delTT 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 559 R74W 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 237 P67L 3 DGGE 1023 R75X 3 DGGE 885 1215delG 7 DGGE 113 Y122X 4 DGGE, SSCP 356 621+1G→T ivs 4 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 709 621+2T→G ivs 4 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 802 I148T 4 DGGE 1016 Q98R 4 DGGE V75 R117H 4 SSCP 5% 19:1 (AA:bisAA) 4°C 5 h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol a Identification numbers given by referring laboratories. Login to comment
57 Type of Mutations Detected by SSCP Analysis in This Study Type of mutation Mutation Mutation characteristics Detected by SSCP analysis Deletions 1677delTA deletion of TA from 1677 Yes delF508 deletion of 3 bp from 1655 Yes delI507 deletion of 3 bp from 1648 Yes 1609delCA deletion of CA from 1609 Yes 1161delC deletion of C at 1161 Yes 300delA deletion of A at 300 Yes 394delTT deletion of TT from 394 Yes 1215delG deletion of G at 1215 No Insertions 1138insG insertion of G after 1138 Yes 1154insTC insertion of TC after 1154 Yes Base 1859G/C Yes substitutions W1282X G→A at 3978 Yes Q1313X C→T at 4069 Yes T582R C→G at 1877 Yes 1898+3G→A A→G at 1898+3 Yes Q493X C→T at 1609 Yes V520F G→T at 1690 Yes S489X C→A at 1598 Yes G551D G→A at 1784 No S549N G→A at 1778 Yes 1811+1G→C G→C at 1811+1 Yese 1898+1G→A G→A at 1898 Yes 3850-1G→A G→A at 3850-1 Yes S549R T→G at 1779 Yes E585X G→T at 1885 Yes L967S C→T at 2966 Yes S945L C→T at 2966 No N1303H A→C at 4039 Yes R74W C→T at 352 Yes P67L C→T at 332 Yes R75X C→T at 355 Yes Y122X T→A at 498 No 621+1G→T G→T at 621+1 No 621+2T→G T→G at 621+2 No I148T T→C at 575 Yes Q98R A→G at 425 Yes R117H G→A at 482 Yes FIGURE 1. Login to comment

[hide] Mutation characterization of CFTR gene in 206 Nort... Hum Mutat. 1996;8(4):340-7. Hughes DJ, Hill AJ, Macek M Jr, Redmond AO, Nevin NC, Graham CA
Mutation characterization of CFTR gene in 206 Northern Irish CF families: thirty mutations, including two novel, account for approximately 94% of CF chromosomes.
Hum Mutat. 1996;8(4):340-7., [PMID:8956039]

Abstract [show]
A variety of mutation detection techniques, including restriction endonuclease digestion, allele specific oligonucleotides, and automated fluorescent sequencing, were used in the identification of 15 CFTR mutations representing 86.7% of CF chromosomes in 206 Northern Irish cystic fibrosis (CF) families. A systematic analysis of the 27 exons and intron/exon boundaries of the CFTR gene was performed using denaturing gradient gel electrophoresis (DGGE) in an attempt to characterise the 55 unknown CF mutations in 51 patients. Twenty different mutations were detected by DGGE on 30 chromosomes accounting for a further 7.3% of CF alleles. Fifteen of these mutations had not previously been found in Northern Ireland, and two are novel, M1I(G > T) and V562L. In total, 30 CFTR mutations account for 93.9% of the 412 Northern Irish CF chromosomes tested. The three major CF mutations in Northern Ireland are delta F508, G551D, and R117H with respective frequencies of 68.0%, 5.1%, and 4.1%. The efficacy of the DGGE technique was proven by the detection of 77 out of 77 control variants from all the CFTR exons. DGGE is a highly efficient and sensitive method for mutation screening especially in large genes where the mutation spectrum is known to be heterogeneous.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 35%) PAGE (278) Kerem et al.. 1989AF508 G551D R117H R560T G542X 621+1G>T A1507 E60X 3659delC R553X 3120G>A 1l54insTC 2789+5G>A N1303K MlI(G>T) QW P67L 557delT 711+3A>G L206W R297Q V520F V562L Y563N Y917C R1162X 3849G>A 3849 +10kbC>T 3850-1GBA W1282X 280 21 17 12 9 9 7 3 2 1 68.0 5.1 4.1 2.9 2.2 2.2 1.7 0.7 0.5 0.24 17-32-13 (38;27%j 17-31-13(24,17%) 16-07-17 16-30-13 plus14 rare haplotypes (29) 16-07-17 23-33-13 (4) 22-31-13 (2) 21-31-13 17-07-17 (5) 16-31-13 16-35-13 17-58-13 17-35-13 16-07-17 17-07-17 23-29-13 (1) 23-31-13 (1) 16-07-17 16-31-13 16-07-17 15-29-13 16-33-13 16-07-17 17-07-17 16-07-17 16-07-17 16-30-13 16-32-17 17-31-13 16-31-14 16-46-13 16-30-14 17-07-17 DGGE(2) ' RD ASO's (11) DGGE(6) RD AR (8) DGGE (1) RD PAGE (5) DGGE (2) SEQ SEQ (2) DGGE (1) RD DGGE DGGE DGGE SEQ DGGE DGGE DGGE SEQ DGGE DGGE SEQ DGGE DGGE DGGE DGGE DGGE SEQ RD DGGE DGGE Cutting et al.. 1990 Dean et al.. 1990 Kerem et al., 1990 Kerem et al.. 1990 Zielenski et al., 1991 Kerem et al.. 1990 Malone et al., CFGAC Kerem et al., 1990 Cutting et al., 1990 Zielenski et al., CFGAC lannuzzi et al., 1991 Highsmith et al., 1990 Osborne et al., 1991 this study Savov et al., 1994 Hamosh et al., CFGAC Graham et al., 1992 Petreska et al., CFGAC Claustres et al., 1993 Graham et al., 1991 Jones et al.. 1992 this study Kerem et al.. 1990 Edkins & Creegan, CFGAC Gasparini et al., 1991 Cutting et al.. 1992 Highsmith et al., 1994 Audriizet et al., 1993 Vidaud et al., 1990 "Numbers in parentheses after the microsatellite haplotypes refer to the number of alleles haplotyped when not all of the available chromosomeswere typed. Login to comment
72 241delAT 40-70 40 16 E60X 394delTT, R75X R75Q (p),P67L. Login to comment

[hide] Fluorescent multiplex microsatellites used to defi... Hum Mutat. 1996;8(3):229-35. Hughes D, Wallace A, Taylor J, Tassabehji M, McMahon R, Hill A, Nevin N, Graham C
Fluorescent multiplex microsatellites used to define haplotypes associated with 75 CFTR mutations from the UK on 437 CF chromosomes.
Hum Mutat. 1996;8(3):229-35., [PMID:8889582]

Abstract [show]
The cystic fibrosis (CF) transmembrane conductance regulator (CFTR) gene contains three highly informative microsatellites: IVS8CA, IVS17bTA, and IVS17bCA. Their analysis improves prenatal/ carrier diagnosis and generates haplotypes from CF chromosomes that are strongly associated with specific mutations. Microsatellite haplotypes were defined for 75 CFTR mutations carried on 437 CF chromosomes (220 for delta F508, 217 for other mutations) from Northern Ireland and three English regions: the North-West, East Anglia, and the South. Fluorescently labelled microsatellites were amplified in a triplex PCR reaction and typed using an ABI 373A fluorescent fragment analyser. These mutations cover all the common and most of the rare CF defects found in the UK, and their corresponding haplotypes and geographic region are tabulated here. Ancient mutations, delta F508, G542X, N1303K, were associated with several related haplotypes due to slippage during replication, whereas other common mutations were associated with the one respective haplotype (e.g., G551D and R560T with 16-7-17, R117H with 16-30-13, 621 + 1G > T with 21-31-13, 3659delC with 16-35-13). This simple, fast, and automated method for fluorescent typing of these haplotypes will help to direct mutation screening for uncharacterised CF chromosomes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 CF 8CA-17bTA-17bCA Mutation chromosomes % Normal Laboratoryb Reference' HaplotVpe 1)15-29-13 557delT Nl Graham et al.. 1992 21 16-07-17 MU (G>T) 3) 16-24-13 4) 16-25-13 5) 16-29-13 6) 16-30-13 7) 16-30-14 8) 16-31-13 9) 16-31-14 10) 16-32-13 12) 16-33-13 13) 16-34-13 14) 16-35-13 11)16-32-17 15)1645-13 16) 1646-13 17) 1646-14 19) 17-07-17 18)16-53-13 20)17-29-14 21) 17-31-13 22) 17-32-13 23) 17-35-13 24) 17-51-11 25) 17-55-13 27) 17-58-13 28) 21-31-13 29) 22-31-13 31)23-22-17 26) 17-56-13 30) 22-33-13 32) 23-29-13 33)23-31-13 34)23-32-13 35)23-33-13 36)23-34-13 37) 23-36-13 38)24-22-17 39) 24-31-13 182delT P67L R75X L206W 1154insTC 146linsAGAT Q493x V520F 1717-1G>A G551D R560T V562L R709X S1196X L1254X R1283M G85E 2184insA 711+lG>T 3495delA 4279insA SlOR L88S R117C R117H G178R 1717-1G>A Y563N W1098R G1123R 3850- 1G>A E6OX %%deIT 1138insG R34P 2183AA>G 2184delA R1158X 1078delT R1162X 3849G>A Q141W R347P Y917C G2iX 711+3A>G 441delA 3130de115 3659delC 1898+1G>A R709X 2711delT R1158X E92K 3849+lOkbC>T 2118delAACT 4048insCC 296+1 2 T S Q22OX R297Q A1507 2789+5G>A 3120+1G>A W128W 1811+lG>C AF508 E831X R116W AF508 W846X1 3120G>A R785X R553X R553X R553X 621+1G>T G542X G542X Y1182X N1303K AF508 G54W 3041delG 1525-1G>A N1303K G542X G542X G542X 394delTT R709X N1303K 1 1 1 2 1 1 4 2 3 4 2 26 8 1 1 1 1 1 8 1 1 1 1 1 1 1 19 1 2 1 1 1 1 7 1 1 2 1 1 2 1 1 1 1 1 1 1 1 2 1 1 7 4 1 2 1 1 2 1 1 4 Asian 1 2 1Asian 5 4 i Afro-Caribbean 5 1 42 (19%) 1 1 57 (26%) 1 2 1 1 1 2 12 2 11.4 0.4 4.9 16.3 1.1 3.8 1.9 10.6 2.3 1.5 2.3 1.5 2.7 4.5 0.4 0.8 0.8 0.4 0.8 0.4 1 2 1 7 1 1 1Asian 1 1.5 0.8 0.8 NI G NI, M M NI NI. Login to comment

[hide] Screening Young syndrome patients for CFTR mutatio... Am J Respir Crit Care Med. 1995 Oct;152(4 Pt 1):1353-7. Friedman KJ, Teichtahl H, De Kretser DM, Temple-Smith P, Southwick GJ, Silverman LM, Highsmith WE Jr, Boucher RC, Knowles MR
Screening Young syndrome patients for CFTR mutations.
Am J Respir Crit Care Med. 1995 Oct;152(4 Pt 1):1353-7., [PMID:7551394]

Abstract [show]
Young syndrome is characterized by obstructive azoospermia associated with chronic sinobronchial disease of an infectious nature, but normal sweat-gland and pancreatic function as well as normal nasal potential differences. Congenital bilateral absence of the vas deferens (CBAVD) in some patients arises from mutations within the cystic fibrosis (CF) transmembrane regulator (CFTR) gene. Because of some similarities between Young syndrome, CF, and CBAVD, we evaluated 13 patients with Young syndrome, including screening for more than 30 different mutations within the CFTR gene. The mean age of the patients was 43 yr (range, 32 to 50 yr), and all were of northern European extraction. The sweat chloride concentration was normal in all patients (mean = 29 mEq/L; range, 8 to 43 mEq/L). Most had intermittent bronchial and sinus infections, but none was chronically colonized with Staphylococcus aureus or Pseudomonas aeruginosa. The FEV1 was normal or only mildly reduced in most patients (mean = 74%; range, 48 to 100% predicted). Of 26 Young syndrome chromosomes, we identified one with the recognized CF mutation delta F508. The incidence of CFTR mutations (1 in 26) did not differ significantly from the expected carrier frequency in this population. In summary, it is unlikely that the typical Young syndrome patient has a clinical disease associated with CFTR mutation on both alleles.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
78 Of the 13 Young syndrome patients, we identified one (Patient 5) who was het- CBAVD Dl152H D1270N G576A* R75Q* P67L Rl17H 3849 + 10 KB C > T G551S Rl17H Pancreatic Sufficient, Moderate Pulmonary Symptoms, Normal Sweat Chloride Concentrations Pancreatic Sufficient, Moderate Pulmonary Symptoms R347P 2789 + 5 G > A R334W G85E R347H R347L Rl17H G91R A455E S945L Y563N Q1291H R297Q R352Q L1065P 3850-3 T > G F1286S 3849 + 10 KB C > T TABLE 1 CFTR MUTATION SCREENING PANEL Severe M508 G551D R553X N1303K W1282X G542X 1717-1 G > A ~1507 R560T 3659deiC 621 + 1 G > T S549N TABLE 2 CLINICAL FEATURES OF YOUNG SYNDROME PATIENTS Patient Age Sweat CI- FEV, Paranasal Sputum No. Login to comment

[hide] Analysis of the 27 exons and flanking regions of t... Hum Mol Genet. 1993 Aug;2(8):1209-13. Claustres M, Laussel M, Desgeorges M, Giansily M, Culard JF, Razakatsara G, Demaille J
Analysis of the 27 exons and flanking regions of the cystic fibrosis gene: 40 different mutations account for 91.2% of the mutant alleles in southern France.
Hum Mol Genet. 1993 Aug;2(8):1209-13., [PMID:7691344]

Abstract [show]
In order to characterize the non-delta F508 mutations that account for 36% of cystic fibrosis (CF) chromosomes in Southern France in a sample of 137 patients, we have systematically screened the entire coding region and adjacent sequences of the cystic fibrosis transmembrane conductance regulator (CFTR) gene by the single strand conformation polymorphism (SSCP) technique followed by direct sequencing of the mutant DNAs. We identified 13 novel mutations (9 reported in this paper) and 4 novel rare nucleotide sequence variations. Forty different mutations including delta F508, located in 15 exons, account for only 91.2% of mutants in a population originating from Southern France, in contrast with a recent report on the Celtic population of Brittany demonstrating that 90% of mutations can be detected with only three mutations. We present a very large spectrum of different CF mutations identified in a small geographical area.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 Mutations identified in a Southern french population mutation AF5O8 M1K 300delA P67L R74W G85E 394detTT 406-6 (T-C) Y122X I148T 621 + 1G-T 62/+2T-G L206W 1078deIT R334W R347H R347P AI507 1717-1G-A G542X R553X S549N G551D E585X 2184delA K710X R792X S945L Y1092X 3272-26A-G R1158X R1162X 3737delA 3659delC 11234V D1270N W1282X N13O3H N13O3K 4382delA Exon 10 1 3 3 3 3 3 intron 3 4 4 intron 4 intron 4 6a 7 7 7 7 10 intron 10 11 11 11 11 , 12 13 13 13 15 17b intron 17a 19 19 19 19 19 20 20 21 21 24 Amino acid change 3 bp deletion start-Lys at 1 frameshift Pro-Leu at67 Arg-Trp at 74 Gly-Glu at 85 frameshift splice mutation? Login to comment

[hide] Effect of ivacaftor on CFTR forms with missense mu... J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23. Van Goor F, Yu H, Burton B, Hoffman BJ
Effect of ivacaftor on CFTR forms with missense mutations associated with defects in protein processing or function.
J Cyst Fibros. 2014 Jan;13(1):29-36. doi: 10.1016/j.jcf.2013.06.008. Epub 2013 Jul 23., [PMID:23891399]

Abstract [show]
BACKGROUND: Ivacaftor (KALYDECO, VX-770) is a CFTR potentiator that increased CFTR channel activity and improved lung function in patients age 6 years and older with CF who have the G551D-CFTR gating mutation. The aim of this in vitro study was to evaluate the effect of ivacaftor on mutant CFTR protein forms with defects in protein processing and/or channel function. METHODS: The effect of ivacaftor on CFTR function was tested in electrophysiological studies using a panel of Fischer rat thyroid (FRT) cells expressing 54 missense CFTR mutations that cause defects in the amount or function of CFTR at the cell surface. RESULTS: Ivacaftor potentiated multiple mutant CFTR protein forms that produce functional CFTR at the cell surface. These included mutant CFTR forms with mild defects in CFTR processing or mild defects in CFTR channel conductance. CONCLUSIONS: These in vitro data indicated that ivacaftor is a broad acting CFTR potentiator and could be used to help stratify patients with CF who have different CFTR genotypes for studies investigating the potential clinical benefit of ivacaftor.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
39 However, a significantly higher level (P b 0.05; ANOVA followed by Tukey's multiple comparisons test; n = 3-6) of mRNA expression was measured for P67L-, E92K-, and A455E-CFTR (Fig. 1). Login to comment
43 Mutations such as P67L-, E56K-, and A455E-CFTR exhibited intermediate levels of mature CFTR, which are consistent with less severe defects in CFTR processing (mature CFTR protein for P67L-, E56K-, and A455E-CFTR were 28.4&#b1; 6.8, 12.2&#b1;1.5, and 11.5&#b1;2.5% of normal, respectively). Login to comment
44 None M1V A46D E56K P67L R74W G85E E92K D110E D110H R117C R117H E193K L206W R334W I336K T338I S341P R347H R347P R352Q A455E L467P S492F F508del V520F A559T R560S R560T A561E Y569D D579G R668C L927P S945L S977F L997F F1052V H1054D K1060T L1065P R1066C R1066H R1066M A1067T R1070Q R1070W F1074L L1077P H1085R M1101K D1152H S1235R D1270N N1303K 0 100 200 300 400 500 600 * * * CFTR Mutation mRNA (% Normal CFTR) Fig. 1. Login to comment
64 Mutant CFTR form CFTR processing Mature/total % Normal CFTR Normal 0.89 &#b1; 0.01 100.0 &#b1; 18.5 G85E -0.05 &#b1; 0.04 -1.0 &#b1; 0.9 R560S 0.00 &#b1; 0.00 0.0 &#b1; 0.0 R1066C 0.02 &#b1; 0.01 0.0 &#b1; 0.0 S492F 0.00 &#b1; 0.00 0.1 &#b1; 0.1 R560T 0.01 &#b1; 0.01 0.2 &#b1; 0.1 V520F 0.05 &#b1; 0.03 0.3 &#b1; 0.2 M1101K 0.05 &#b1; 0.03 0.3 &#b1; 0.1 A561E 0.08 &#b1; 0.04 0.5 &#b1; 0.2 R1066M 0.02 &#b1; 0.02 0.5 &#b1; 0.4 N1303K 0.02 &#b1; 0.02 0.5 &#b1; 0.3 A559T 0.16 &#b1; 0.09 0.6 &#b1; 0.2 M1V 0.06 &#b1; 0.06 0.7 &#b1; 0.6 Y569D 0.11 &#b1; 0.04 0.6 &#b1; 0.2 R1066H 0.08 &#b1; 0.02a 0.7 &#b1; 0.2a L1065P 0.05 &#b1; 0.05 1.0 &#b1; 0.8 L467P 0.10 &#b1; 0.07 1.2 &#b1; 0.8 L1077P 0.08 &#b1; 0.04 1.5 &#b1; 0.6 A46D 0.21 &#b1; 0.08 1.9 &#b1; 0.5a E92K 0.06 &#b1; 0.05 1.9 &#b1; 1.3 H1054D 0.09 &#b1; 0.04 1.9 &#b1; 0.8 F508del 0.09 &#b1; 0.02a 2.3 &#b1; 0.5a H1085R 0.06 &#b1; 0.01a 3.0 &#b1; 0.7a I336K 0.42 &#b1; 0.05a 6.5 &#b1; 0.7a L206W 0.35 &#b1; 0.10a 6.8 &#b1; 1.7a F1074L 0.52 &#b1; 0.03a 10.9 &#b1; 0.6a A455E 0.26 &#b1; 0.10a 11.5 &#b1; 2.5a E56K 0.29 &#b1; 0.04a 12.2 &#b1; 1.5a R347P 0.48 &#b1; 0.04a 14.6 &#b1; 1.8a R1070W 0.61 &#b1; 0.04a 16.3 &#b1; 0.6a P67L 0.36 &#b1; 0.04a 28.4 &#b1; 6.8a R1070Q 0.90 &#b1; 0.01a 29.5 &#b1; 1.4a S977F 0.97 &#b1; 0.01a 37.3 &#b1; 2.4a A1067T 0.78 &#b1; 0.03a 38.6 &#b1; 6.1a D579G 0.72 &#b1; 0.02a 39.3 &#b1; 3.1a D1270N 1.00 &#b1; 0.00a,c 40.7 &#b1; 1.2a S945L 0.65 &#b1; 0.04a 42.4 &#b1; 8.9a L927P 0.89 &#b1; 0.01a,b 43.5 &#b1; 2.5a,b R117C 0.87 &#b1; 0.02a,b 49.1 &#b1; 2.9a,b T338I 0.93 &#b1; 0.03a,b 54.2 &#b1; 3.7a,b L997F 0.90 &#b1; 0.04a,b 59.8 &#b1; 10.4a,b D110H 0.97 &#b1; 0.01a,b 60.6 &#b1; 1.5a,b S341P 0.79 &#b1; 0.02a 65.0 &#b1; 4.9a,b R668C 0.94 &#b1; 0.03a,b 68.5 &#b1; 1.9a,b R74W 0.78 &#b1; 0.01a 69.0 &#b1; 2.7a,b D110E 0.92 &#b1; 0.05a,b 87.5 &#b1; 9.5a,b R334W 0.91 &#b1; 0.05a,b 97.6 &#b1; 10.0a,b K1060T 0.87 &#b1; 0.02a,b 109.9 &#b1; 28.0a,b R347H 0.96 &#b1; 0.02a,c 120.7 &#b1; 2.8a,b S1235R 0.96 &#b1; 0.00a,c 139.0 &#b1; 9.0a,b E193K 0.84 &#b1; 0.02a,b 143.0 &#b1; 17.1a,b R117H 0.86 &#b1; 0.01a,b 164.5 &#b1; 34.2a,b R352Q 0.98 &#b1; 0.01a,b 179.9 &#b1; 8.0a,c F1052V 0.90 &#b1; 0.01a,b 189.9 &#b1; 33.1a,b D1152H 0.96 &#b1; 0.02a,c 312.0 &#b1; 45.5a,b Notes to Table 1: Quantification of steady-state CFTR maturation expressed as the mean (&#b1;SEM; n = 5-9) ratio of mature CFTR to total CFTR (immature plus mature) or level of mature mutant CFTR relative to mature normal-CFTR (% normal CFTR) in FRT cells individually expressing CFTR mutations. Login to comment
74 Because the level of CFTR mRNA was similar across the panel of cell lines tested, the range in baseline activity and ivacaftor response likely reflects the severity of the functional defect and/or the 0 50 100 150 200 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L E56K P67L R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V Baseline With ivacaftor * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Chloride transport (% Normal) Mutant CFTR form 0 100 200 300 400 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L P67L E56K R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Mature CFTR (% Normal) Mutant CFTR form A B Fig. 2. Login to comment
82 Mutation Patientsa Chloride transport (bc;A/cm2 ) Chloride transport (% normal) EC50 Baseline With ivacaftor Baseline With ivacaftor Fold increase over baselineb Normal 204.5 &#b1; 33.3 301.3 &#b1; 33.8c 100.0 &#b1; 16.3 147.3 &#b1; 16.5c 1.5 266 &#b1; 42 G551D 1282 1.5 &#b1; 0.7 113.2 &#b1; 13.0c 1.0 &#b1; 0.5 55.3 &#b1; 6.3c 55.3 312 &#b1; 73 F1052V 12 177.3 &#b1; 13.7 410.2 &#b1; 11.3c 86.7 &#b1; 6.7 200.7 &#b1; 5.6c 2.3 177 &#b1; 14 S1235R ND 160.6 &#b1; 25.7 352.1 &#b1; 43.4c 78.5 &#b1; 12.6 172.2 &#b1; 21.2c 2.2 282 &#b1; 104 D1152H 185 117.3 &#b1; 23.0 282.7 &#b1; 46.9c 57.4 &#b1; 11.2 138.2 &#b1; 22.9c 2.4 178 &#b1; 67 D1270N 32 109.5 &#b1; 20.5 209.5 &#b1; 27.4c 53.6 &#b1; 10.0 102.4 &#b1; 13.4c 1.9 254 &#b1; 56 R668C 45 99.0 &#b1; 9.4 217.6 &#b1; 11.7c 48.4 &#b1; 4.6 106.4 &#b1; 5.7c 2.2 517 &#b1; 105 K1060T ND 89.0 &#b1; 9.8 236.4 &#b1; 20.3c 43.5 &#b1; 4.8 115.6 &#b1; 9.9c 2.7 131 &#b1; 73 R74W 25 86.8 &#b1; 26.9 199.1 &#b1; 16.8c 42.5 &#b1; 13.2 97.3 &#b1; 8.2c 2.3 162 &#b1; 17 R117H 739 67.2 &#b1; 13.3 274.1 &#b1; 32.2c 32.9 &#b1; 6.5 134.0 &#b1; 15.7c 4.1 151 &#b1; 14 E193K ND 62.2 &#b1; 9.8 379.1 &#b1; 1.1c 30.4 &#b1; 4.8 185.4 &#b1; 1.0c 6.1 240 &#b1; 20 A1067T ND 55.9 &#b1; 3.2 164.0 &#b1; 9.7c 27.3 &#b1; 1.6 80.2 &#b1; 4.7c 2.9 317 &#b1; 214 L997F 27 43.7 &#b1; 3.2 145.5 &#b1; 4.0c 21.4 &#b1; 1.6 71.2 &#b1; 2.0c 3.3 162 &#b1; 12 R1070Q 15 42.0 &#b1; 0.8 67.3 &#b1; 2.9c 20.6 &#b1; 0.4 32.9 &#b1; 1.4c 1.6 164 &#b1; 20 D110E ND 23.3 &#b1; 4.7 96.4 &#b1; 15.6c 11.4 &#b1; 2.3 47.1 &#b1; 7.6c 4.1 213 &#b1; 51 D579G 21 21.5 &#b1; 4.1 192.0 &#b1; 18.5c 10.5 &#b1; 2.0 93.9 &#b1; 9.0c 8.9 239 &#b1; 48 D110H 30 18.5 &#b1; 2.2 116.7 &#b1; 11.3c 9.1 &#b1; 1.1 57.1 &#b1; 5.5c 6.2 249 &#b1; 59 R1070W 13 16.6 &#b1; 2.6 102.1 &#b1; 3.1c 8.1 &#b1; 1.3 49.9 &#b1; 1.5c 6.2 158 &#b1; 48 P67L 53 16.0 &#b1; 6.7 88.7 &#b1; 15.7c 7.8 &#b1; 3.3 43.4 &#b1; 7.7c 5.6 195 &#b1; 40 E56K ND 15.8 &#b1; 3.1 63.6 &#b1; 4.4c 7.7 &#b1; 1.5 31.1 &#b1; 2.2c 4.0 123 &#b1; 33 F1074L ND 14.0 &#b1; 3.4 43.5 &#b1; 5.4c 6.9 &#b1; 1.6 21.3 &#b1; 2.6c 3.1 141 &#b1; 19 A455E 120 12.9 &#b1; 2.6 36.4 &#b1; 2.5c 6.3 &#b1; 1.2 17.8 &#b1; 1.2c 2.8 170 &#b1; 44 S945L 63 12.3 &#b1; 3.9 154.9 &#b1; 47.6c 6.0 &#b1; 1.9 75.8 &#b1; 23.3c 12.6 181 &#b1; 36 S977F 9 11.3 &#b1; 6.2 42.5 &#b1; 19.1c 5.5 &#b1; 3.0 20.8 &#b1; 9.3c 3.8 283 &#b1; 36 R347H 65 10.9 &#b1; 3.3 106.3 &#b1; 7.6c 5.3 &#b1; 1.6 52.0 &#b1; 3.7c 9.8 280 &#b1; 35 L206W 81 10.3 &#b1; 1.7 36.4 &#b1; 2.8c 5.0 &#b1; 0.8 17.8 &#b1; 1.4c 3.6 101 &#b1; 13 R117C 61 5.8 &#b1; 1.5 33.7 &#b1; 7.8c 2.9 &#b1; 0.7 16.5 &#b1; 3.8c 5.7 380 &#b1; 136 R352Q 46 5.5 &#b1; 1.0 84.5 &#b1; 7.8c 2.7 &#b1; 0.5 41.3 &#b1; 3.8c 15.2 287 &#b1; 75 R1066H 29 3.0 &#b1; 0.3 8.0 &#b1; 0.8c 1.5 &#b1; 0.1 3.9 &#b1; 0.4c 2.6 390 &#b1; 179 T338I 54 2.9 &#b1; 0.8 16.1 &#b1; 2.4c 1.4 &#b1; 0.4 7.9 &#b1; 1.2c 5.6 334 &#b1; 38 R334W 150 2.6 &#b1; 0.5 10.0 &#b1; 1.4c 1.3 &#b1; 0.2 4.9 &#b1; 0.7c 3.8 259 &#b1; 103 G85E 262 1.6 &#b1; 1.0 1.5 &#b1; 1.2 0.8 &#b1; 0.5 0.7 &#b1; 0.6 NS NS A46D ND 2.0 &#b1; 0.6 1.1 &#b1; 1.1 1.0 &#b1; 0.3 0.5 &#b1; 0.6 NS NS I336K 29 1.8 &#b1; 0.2 7.4 &#b1; 0.1c 0.9 &#b1; 0.1 3.6 &#b1; 0.1c 4 735 &#b1; 204 H1054D ND 1.7 &#b1; 0.3 8.7 &#b1; 0.3c 0.8 &#b1; 0.1 4.2 &#b1; 0.1c 5.3 187 &#b1; 20 F508del 29,018 0.8 &#b1; 0.6 12.1 &#b1; 1.7c 0.4 &#b1; 0.3 5.9 &#b1; 0.8c 14.8 129 &#b1; 38 M1V 9 0.7 &#b1; 1.4 6.5 &#b1; 1.9c 0.4 &#b1; 0.7 3.2 &#b1; 0.9c 8.0 183 &#b1; 85 E92K 14 0.6 &#b1; 0.2 4.3 &#b1; 0.8c 0.3 &#b1; 0.1 2.1 &#b1; 0.4c 7.0 198 &#b1; 46 V520F 58 0.4 &#b1; 0.2 0.5 &#b1; 0.2 0.2 &#b1; 0.1 0.2 &#b1; 0.1 NS NS H1085R ND 0.3 &#b1; 0.2 2.1 &#b1; 0.4 0.2 &#b1; 0.1 1.0 &#b1; 0.2 NS NS R560T 180 0.3 &#b1; 0.3 0.5 &#b1; 0.5 0.1 &#b1; 0.1 0.2 &#b1; 0.2 NS NS L927P 15 0.2 &#b1; 0.1 10.7 &#b1; 1.7c 0.1 &#b1; 0.1 5.2 &#b1; 0.8c 52.0 313 &#b1; 66 R560S ND 0.0 &#b1; 0.1 -0.2 &#b1; 0.2 0.0 &#b1; 0.0 -0.1 &#b1; 0.1 NS NS N1303K 1161 0.0 &#b1; 0.0 1.7 &#b1; 0.3 0.0 &#b1; 0.0 0.8 &#b1; 0.2 NS NS M1101K 79 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1077P 42 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066M ND 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066C 100 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1065P 25 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS Y569D 9 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS A561E ND 0.0 &#b1; 0.1 0.0 &#b1; 0.1 0.0 &#b1; 0.0 0.0 &#b1; 0.1 NS NS A559T 43 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S492F 16 0.0 &#b1; 0.0 1.7 &#b1; 1.2 0.0 &#b1; 0.0 0.8 &#b1; 0.6 NS NS L467P 16 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R347P 214 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S341P 9 0.0 &#b1; 0.0 0.2 &#b1; 0.2 0.0 &#b1; 0.0 0.1 &#b1; 0.1 NS NS a Number of individuals with the individual mutation in the CFTR-2 database (www.CFTR2.org). Login to comment
86 For example, the baseline level of chloride transport and ivacaftor response was higher for mutant CFTR forms associated with mild defects in CFTR processing (e.g., E56K, P67L, L206W, A455E, D579G, S945L, S977F, A1067T, R1070Q, R1070W, F1074L, and D1270N) than for those associated with severe defects in CFTR processing (e.g., F508del, H1054D, R1066H). Login to comment
92 Mutant CFTR forms that did not significantly respond to ivacaftor under the experimental conditions used in this study were generally associated with severe defects in CFTR processing A B C D E F 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 S1235R D1152H F1052V D1270N ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 R668C K1060T R74W R117H ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 E193K A1067T L997F R1070Q ivacaftor [Log M] Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) Chloride Transport ( &#b5;A/cm 2 ) 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 D110E D579G D110H R1070W ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 F1074L E56K P67L A455E ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 R347H S945L L206W S977F ivacaftor [Log M] 0 100 200 300 400 -8 -6 -4 0 T338I R1066H R117C R352Q ivacaftor [Log M] 0 100 200 300 400 -9 -8 -7 -6 -5 -4 0 F508del R334W H1054D E92K ivacaftor [Log M] 0 5 10 15 20 -9 -8 -7 -6 -5 -4 0 F508del R334W H1054D E92K R1066H T338I ivacaftor [Log M] G H I Fig. 3. Login to comment
106 For example, patients with CF who have the class II mutation, P67L, along with a severe CF-causing mutation (most commonly F508del), have a mean sweat chloride concentration of 57 mmol/L [21], which is lower than that in patients with CF who carry two copies of the most common class II mutation, F508del (~100 mmol/L). Login to comment

[hide] VX-809 corrects folding defects in cystic fibrosis... Mol Biol Cell. 2013 Oct;24(19):3016-24. doi: 10.1091/mbc.E13-05-0240. Epub 2013 Aug 7. Ren HY, Grove DE, De La Rosa O, Houck SA, Sopha P, Van Goor F, Hoffman BJ, Cyr DM
VX-809 corrects folding defects in cystic fibrosis transmembrane conductance regulator protein through action on membrane-spanning domain 1.
Mol Biol Cell. 2013 Oct;24(19):3016-24. doi: 10.1091/mbc.E13-05-0240. Epub 2013 Aug 7., [PMID:23924900]

Abstract [show]
Cystic fibrosis (CF) is a fatal genetic disorder associated with defective hydration of lung airways due to the loss of chloride transport through the CF transmembrane conductance regulator protein (CFTR). CFTR contains two membrane-spanning domains (MSDs), two nucleotide-binding domains (NBDs), and a regulatory domain, and its channel assembly requires multiple interdomain contacts. The most common CF-causing mutation, F508del, occurs in NBD1 and results in misfolding and premature degradation of F508del-CFTR. VX-809 is an investigational CFTR corrector that partially restores CFTR function in people who are homozygous for F508del-CFTR. To identify the folding defect(s) in F508del-CFTR that must be repaired to treat CF, we explored the mechanism of VX-809 action. VX-809 stabilized an N-terminal domain in CFTR that contains only MSD1 and efficaciously restored function to CFTR forms that have missense mutations in MSD1. The action of VX-809 on MSD1 appears to suppress folding defects in F508del-CFTR by enhancing interactions among the NBD1, MSD1, and MSD2 domains. The ability of VX-809 to correct F508del-CFTR is enhanced when combined with mutations that improve F508del-NBD1 interaction with MSD2. These data suggest that the use of VX-809 in combination with an additional CFTR corrector that suppresses folding defects downstream of MSD1 may further enhance CFTR function in people with F508del-CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
60 There are several CF-associated mutations in MSD1 that cause defects in CFTR processing and function: N-terminal tail (E56K and P67L), TM1 (E92K), TM2 (L206W), and TM4 (V232D) (Figure 4, A-E). Login to comment
61 The severe folding (Figure 4, A-B) and functional (Figure 4E) defects exhibited by E56L, P67L and L206W were completely corrected by 5 bc;M VX-809. Login to comment
194 (C-D): n = 3 &#b1; SE. _ _ _ _ + + + _ + E56K P67L E92K L206W Wt _ _ + V232D Wt -C- -BC- BTub- CFTR . Login to comment
196 D. E92K F508 -B C -B C VX-809 0 3 10 30 M CFTR CFTR B17 15 14 17 C0 25 66 95 B18 30 28 27 C 1 8 9 8 % Norm VX-809 0 3 10 30 M C-100 1 81 1 83 N.D. 24 5 78 100 N.D. 15 B14 4 6 4 7 1 1 6 12 16 3 2 C. B11 10 11 12 C 1 1 1 7 VX-809 0 3 10 30 M -B C F508 CFTR E92K % Norm % Norm E. VX-809 0 50 100 150 200 250 -10 -9 -8 -7 -6 -5 -4 Chloride Transport ( A/cm 2 ) VX-809 (Log M) E92K-CFTR Normal 0 50 100 150 200 250 DMSO VX-809 Corr-4a Chloride Transport ( A/cm2) E92K-CFTR 0 100 200 300 400 E56K P67L E92K L206W V232V dF508 I SC ( A/cm 2 ) DMSO VX-809 Normal VX-809 on MSD1 has potential to promote high-level functional correction of CFTR in people with CF who harbor mutations other than F508del (Bobadilla et al., 2002). Login to comment

[hide] Ivacaftor: a review of its use in patients with cy... Drugs. 2013 Sep;73(14):1595-604. doi: 10.1007/s40265-013-0115-2. Deeks ED
Ivacaftor: a review of its use in patients with cystic fibrosis.
Drugs. 2013 Sep;73(14):1595-604. doi: 10.1007/s40265-013-0115-2., [PMID:24030637]

Abstract [show]
Ivacaftor (Kalydeco) is a potentiator of the cystic fibrosis transmembrane conductance regulator (CFTR) and is the first drug that treats an underlying cause of cystic fibrosis to be licensed for use. Ivacaftor increases the open probability (i.e. gating) of CFTR channels with the G551D mutation, thus enhancing chloride transport, and is indicated in a number of countries for the treatment of cystic fibrosis in patients aged >/=6 years who carry this mutation. This review focuses on pharmacological, clinical efficacy and tolerability data relevant to the use of ivacaftor in this indication. In two 48-week, double-blind, phase III trials in patients aged >/=12 (STRIVE) or 6-11 (ENVISION) years with cystic fibrosis and the G551D mutation, oral ivacaftor 150 mg every 12 h significantly improved lung function relative to placebo, when used in combination with standard care. Significant improvements in pulmonary exacerbation risk (in STRIVE) as well as bodyweight and some aspects of health-related quality of life (both studies) were also seen with the drug versus placebo. Moreover, the beneficial effects of ivacaftor on parameters such as lung function and bodyweight were maintained over up to 96 weeks of treatment in an ongoing open-label extension of these studies. Ivacaftor was generally well tolerated, with headache, oropharyngeal pain, upper respiratory tract infection and nasal congestion being among the most common adverse events. Thus, ivacaftor expands the current treatment options for patients with cystic fibrosis who have the G551D mutation. Its potential for use in patients with other CFTR mutations is also of interest.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
36 Further in vitro data suggest that other CFTR proteins with residual function may also be potentiated by ivacaftor, including those with mutations that affect conductance (e.g. R117H, D110H), mildly affect CFTR processing (e.g. E56K, P67L) or have uncharacterized effects (e.g. D110E, S1235R) [5, 16]. Login to comment

[hide] Mechanisms of CFTR functional variants that impair... PLoS Genet. 2014 Jul 17;10(7):e1004376. doi: 10.1371/journal.pgen.1004376. eCollection 2014 Jul. LaRusch J, Jung J, General IJ, Lewis MD, Park HW, Brand RE, Gelrud A, Anderson MA, Banks PA, Conwell D, Lawrence C, Romagnuolo J, Baillie J, Alkaade S, Cote G, Gardner TB, Amann ST, Slivka A, Sandhu B, Aloe A, Kienholz ML, Yadav D, Barmada MM, Bahar I, Lee MG, Whitcomb DC
Mechanisms of CFTR functional variants that impair regulated bicarbonate permeation and increase risk for pancreatitis but not for cystic fibrosis.
PLoS Genet. 2014 Jul 17;10(7):e1004376. doi: 10.1371/journal.pgen.1004376. eCollection 2014 Jul., [PMID:25033378]

Abstract [show]
CFTR is a dynamically regulated anion channel. Intracellular WNK1-SPAK activation causes CFTR to change permeability and conductance characteristics from a chloride-preferring to bicarbonate-preferring channel through unknown mechanisms. Two severe CFTR mutations (CFTRsev) cause complete loss of CFTR function and result in cystic fibrosis (CF), a severe genetic disorder affecting sweat glands, nasal sinuses, lungs, pancreas, liver, intestines, and male reproductive system. We hypothesize that those CFTR mutations that disrupt the WNK1-SPAK activation mechanisms cause a selective, bicarbonate defect in channel function (CFTRBD) affecting organs that utilize CFTR for bicarbonate secretion (e.g. the pancreas, nasal sinus, vas deferens) but do not cause typical CF. To understand the structural and functional requirements of the CFTR bicarbonate-preferring channel, we (a) screened 984 well-phenotyped pancreatitis cases for candidate CFTRBD mutations from among 81 previously described CFTR variants; (b) conducted electrophysiology studies on clones of variants found in pancreatitis but not CF; (c) computationally constructed a new, complete structural model of CFTR for molecular dynamics simulation of wild-type and mutant variants; and (d) tested the newly defined CFTRBD variants for disease in non-pancreas organs utilizing CFTR for bicarbonate secretion. Nine variants (CFTR R74Q, R75Q, R117H, R170H, L967S, L997F, D1152H, S1235R, and D1270N) not associated with typical CF were associated with pancreatitis (OR 1.5, p = 0.002). Clones expressed in HEK 293T cells had normal chloride but not bicarbonate permeability and conductance with WNK1-SPAK activation. Molecular dynamics simulations suggest physical restriction of the CFTR channel and altered dynamic channel regulation. Comparing pancreatitis patients and controls, CFTRBD increased risk for rhinosinusitis (OR 2.3, p<0.005) and male infertility (OR 395, p<<0.0001). WNK1-SPAK pathway-activated increases in CFTR bicarbonate permeability are altered by CFTRBD variants through multiple mechanisms. CFTRBD variants are associated with clinically significant disorders of the pancreas, sinuses, and male reproductive system.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
269 67 SNPs (125GtoC, 1716G.A, 1717-1G.A, 1898+1G.A, 2183AA.G, 2184delA, 2789+5G.A, 3120+1G.A, 3659delC, 3849+10kbC.T, 621+ 1G.T, 711+5G.A, A455E, D110H, D1152H, D1270N, D443Y, D579G, F1052V, F1074L, F508C, F508del, G1069R, G1244E, G1349D, G178R, G542X, G551D, G551S, I1131L/V, I148T, I336K/T, I507del, I807M, IVS8T5, K1180T, L1065P, L967S, L997F, M1V, M470V, M952I, M952T, N1303K, P67L, Q1463Q, R1070Q, R1162X, R117C, R117H, R170H, R258G, R297Q, R31C, R352Q, R553X, R668C, R74W, R75Q, S1235R, S1255P, S485R, S977F, T338I, T854T, V201M, W1282X) were multiplexed into 6 wells; 14 SNPs (S492F, S945L, R74Q, R560T, R1162L, G85E, I1027T, R334W, R347P, G576A, 711+1G.T, 1001+11C.T, P1290P, 3199del6) were ascertained separately via TaqMan Gene Expression Assays, with repeat confirmation of all positive results. Login to comment

[hide] Function, pharmacological correction and maturatio... J Cyst Fibros. 2015 Jan;14(1):34-41. doi: 10.1016/j.jcf.2014.06.008. Epub 2014 Jul 16. Sharma H, Jollivet Souchet M, Callebaut I, Prasad R, Becq F
Function, pharmacological correction and maturation of new Indian CFTR gene mutations.
J Cyst Fibros. 2015 Jan;14(1):34-41. doi: 10.1016/j.jcf.2014.06.008. Epub 2014 Jul 16., [PMID:25042876]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is rare in India. Most CF mutations identified are not yet functionally characterized. Hence, genetic counseling and adoption of therapeutic approach are particularly difficult. Our aim was to study the function and maturation of a spectrum of eleven Indian CFTR mutations from classical CF and infertile male patients with CBAVD. METHODS: We used Western blot, pharmacology and iodide efflux to study CFTR maturation and chloride transport in BHK cells expressing pEGFP-CFTR constructs for L69H, F87I, S118P, G126S, H139Q, F157C, F494L, E543A, S549N, Y852F and D1270E. RESULTS: Among these CFTR mutants, only L69H is not processed as a c-band and not functional at 37 degrees C. However, the functions of L69H and S549N and the maturation of L69H are corrected at 27 degrees C and by the investigational drug VX809. CONCLUSION: These data should help in developing counseling and therapeutic approaches in India. We identified L69H as a novel class II CF mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
116 Supporting this hypothesis is the fact that VX-809 has been shown to act on MSD1 folding and that it also rescues functional defects in CFTR caused by disease-related mutations in the vicinity of the three amino acids highlighted here (P67L, L206W) [16]. Login to comment

[hide] Full-open and closed CFTR channels, with lateral t... Cell Mol Life Sci. 2015 Apr;72(7):1377-403. doi: 10.1007/s00018-014-1749-2. Epub 2014 Oct 7. Mornon JP, Hoffmann B, Jonic S, Lehn P, Callebaut I
Full-open and closed CFTR channels, with lateral tunnels from the cytoplasm and an alternative position of the F508 region, as revealed by molecular dynamics.
Cell Mol Life Sci. 2015 Apr;72(7):1377-403. doi: 10.1007/s00018-014-1749-2. Epub 2014 Oct 7., [PMID:25287046]

Abstract [show]
In absence of experimental 3D structures, several homology models, based on ABC exporter 3D structures, have provided significant insights into the molecular mechanisms underlying the function of the cystic fibrosis transmembrane conductance regulator (CFTR) protein, a chloride channel whose defects are associated with cystic fibrosis (CF). Until now, these models, however, did not furnished much insights into the continuous way that ions could follow from the cytosol to the extracellular milieu in the open form of the channel. Here, we have built a refined model of CFTR, based on the outward-facing Sav1866 experimental 3D structure and integrating the evolutionary and structural information available today. Molecular dynamics simulations revealed significant conformational changes, resulting in a full-open channel, accessible from the cytosol through lateral tunnels displayed in the long intracellular loops (ICLs). At the same time, the region of nucleotide-binding domain 1 in contact with one of the ICLs and carrying amino acid F508, the deletion of which is the most common CF-causing mutation, was found to adopt an alternative but stable position. Then, in a second step, this first stable full-open conformation evolved toward another stable state, in which only a limited displacement of the upper part of the transmembrane helices leads to a closure of the channel, in a conformation very close to that adopted by the Atm1 ABC exporter, in an inward-facing conformation. These models, supported by experimental data, provide significant new insights into the CFTR structure-function relationships and into the possible impact of CF-causing mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
349 P67L lies in the loop between the N-terminal segment and the N-helix. Login to comment

[hide] Improving newborn screening for cystic fibrosis us... Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209. Baker MW, Atkins AE, Cordovado SK, Hendrix M, Earley MC, Farrell PM
Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study.
Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209., [PMID:25674778]

Abstract [show]
Purpose:Many regions have implemented newborn screening (NBS) for cystic fibrosis (CF) using a limited panel of cystic fibrosis transmembrane regulator (CFTR) mutations after immunoreactive trypsinogen (IRT) analysis. We sought to assess the feasibility of further improving the screening using next-generation sequencing (NGS) technology.Methods:An NGS assay was used to detect 162 CFTR mutations/variants characterized by the CFTR2 project. We used 67 dried blood spots (DBSs) containing 48 distinct CFTR mutations to validate the assay. NGS assay was retrospectively performed on 165 CF screen-positive samples with one CFTR mutation.Results:The NGS assay was successfully performed using DNA isolated from DBSs, and it correctly detected all CFTR mutations in the validation. Among 165 screen-positive infants with one CFTR mutation, no additional disease-causing mutation was identified in 151 samples consistent with normal sweat tests. Five infants had a CF-causing mutation that was not included in this panel, and nine with two CF-causing mutations were identified.Conclusion:The NGS assay was 100% concordant with traditional methods. Retrospective analysis results indicate an IRT/NGS screening algorithm would enable high sensitivity, better specificity and positive predictive value (PPV). This study lays the foundation for prospective studies and for introducing NGS in NBS laboratories.Genet Med advance online publication 12 February 2015Genetics in Medicine (2015); doi:10.1038/gim.2014.209.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
15 Correspondence: Mei W. Baker (mwbaker@wisc.edu) Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study Mei W. Baker, MD1,2 , Anne E. Atkins, MPH2 , Suzanne K. Cordovado, PhD3 , Miyono Hendrix, MS3 , Marie C. Earley, PhD3 and Philip M. Farrell, MD, PhD1,4 Table 1ߒ CF-causing or varying consequences mutations in the MiSeqDx IUO Cystic Fibrosis System c.1521_1523delCTT (F508del) c.2875delG (3007delG) c.54-5940_273ߙ+ߙ10250del21kb (CFTRdele2,3) c.3909C>G (N1303K) c.3752G>A (S1251N) Mutations that cause CF when combined with another CF-causing mutation c.1624G>T (G542X) c.2988ߙ+ߙ1G>A (3120ߙ+ߙ1G->A) c.3964-78_4242ߙ+ߙ577del (CFTRdele22,23) c.613C>T (P205S) c.1021T>C (S341P) c.948delT (1078delT) c.2988G>A (3120G->A) c.328G>C (D110H) c.200C>T (P67L) c.1397C>A (S466X(C>A)) c.1022_1023insTC (1154insTC) c.2989-1G>A (3121-1G->A) c.3310G>T (E1104X) c.3937C>T (Q1313X) c.1397C>G (S466X(C>G)) c.1081delT (1213delT) c.3140-26A>G (3272-26A->G) c.1753G>T (E585X) c.658C>T (Q220X) c.1466C>A (S489X) c.1116ߙ+ߙ1G>A (1248ߙ+ߙ1G->A) c.3528delC (3659delC) c.178G>T (E60X) c.115C>T (Q39X) c.1475C>T (S492F) c.1127_1128insA (1259insA) c.3659delC (3791delC) c.2464G>T (E822X) c.1477C>T (Q493X) c.1646G>A (S549N) c.1209ߙ+ߙ1G>A (1341ߙ+ߙ1G->A) c.3717ߙ+ߙ12191C>T (3849ߙ+ߙ10kbC->T) c.2491G>T (E831X) c.1573C>T (Q525X) c.1645A>C (S549R) c.1329_1330insAGAT (1461ins4) c.3744delA (3876delA) c.274G>A (E92K) c.1654C>T (Q552X) c.1647T>G (S549R) c.1393-1G>A (1525-1G->A) c.3773_3774insT (3905insT) c.274G>T (E92X) c.2668C>T (Q890X) c.2834C>T (S945L) c.1418delG (1548delG) c.262_263delTT (394delTT) c.3731G>A (G1244E) c.292C>T (Q98X) c.1013C>T (T338I) c.1545_1546delTA (1677delTA) c.3873ߙ+ߙ1G>A (4005ߙ+ߙ1G->A) c.532G>A (G178R) c.3196C>T (R1066C) c.1558G>T (V520F) c.1585-1G>A (1717-1G->A) c.3884_3885insT (4016insT) c.988G>T (G330X) c.3197G>A (R1066H) c.3266G>A (W1089X) c.1585-8G>A (1717-8G->A) c.273ߙ+ߙ1G>A (405ߙ+ߙ1G->A) c.1652G>A (G551D) c.3472C>T (R1158X) c.3611G>A (W1204X) c.1679ߙ+ߙ1.6kbA>G (1811ߙ+ߙ1.6kbA->G) c.274-1G>A (406-1G->A) c.254G>A (G85E) c.3484C>T (R1162X) c.3612G>A (W1204X) c.1680-1G>A (1812-1G->A) c.4077_4080delTGTTinsAA (4209TGTT->AA) c.2908G>C (G970R) c.349C>T (R117C) c.3846G>A (W1282X) c.1766ߙ+ߙ1G>A (1898ߙ+ߙ1G->A) c.4251delA (4382delA) c.595C>T (H199Y) c.1000C>T (R334W) c.1202G>A (W401X) c.1766ߙ+ߙ3A>G (1898ߙ+ߙ 3A->G) c.325_327delTATinsG (457TAT->G) c.1007T>A (I336K) c.1040G>A (R347H) c.1203G>A (W401X) c.2012delT (2143delT) c.442delA (574delA) c.1519_1521delATC (I507del) c.1040G>C (R347P) c.2537G>A (W846X) c.2051_2052delAAinsG (2183AA->G) c.489ߙ+ߙ1G>T (621ߙ+ߙ 1G->T) c.2128A>T (K710X) c.1055G>A (R352Q) c.3276C>A (Y1092X (C>A)) c.2052delA (2184delA) c.531delT (663delT) c.3194T>C (L1065P) c.1657C>T (R553X) c.3276C>G (Y1092X (C>G)) c.2052_2053insA (2184insA) c.579ߙ+ߙ1G>T (711ߙ+ߙ 1G->T) c.3230T>C (L1077P) c.1679G>A (R560K) c.366T>A (Y122X) c.2175_2176insA (2307insA) c.579ߙ+ߙ3A>G (711ߙ+ߙ 3A->G) c.617T>G (L206W) c.1679G>C (R560T) - c.2215delG (2347delG) c.579ߙ+ߙ5G>A (711ߙ+ߙ 5G->A) c.1400T>C (L467P) c.2125C>T (R709X) - c.2453delT (2585delT) c.580-1G>T (712-1G->T) c.2195T>G (L732X) c.223C>T (R75X) - c.2490ߙ+ߙ1G>A (2622ߙ+ߙ1G->A) c.720_741delAGGGAG AATGATGATGAAGTAC (852del22) c.2780T>C (L927P) c.2290C>T (R764X) - c.2583delT (2711delT) c.1364C>A (A455E) c.3302T>A (M1101K) c.2551C>T (R851X) - c.2657ߙ+ߙ5G>A (2789ߙ+ߙ5G->A) c.1675G>A (A559T) c.1A>G (M1V) c.3587C>G (S1196X) - Mutations/variants that were validated in this study are in bold. CF, cystic fibrosis. Table 1ߒ Continued on next page reduce carrier detection and potentially improve the positive predictive value (PPV), the NBS goals of equity and the highest possible sensitivity become more difficult to achieve. Login to comment

[hide] Improved clinical and radiographic outcomes after ... Chest. 2015 Mar;147(3):e79-82. doi: 10.1378/chest.14-1198. Yousef S, Solomon GM, Brody A, Rowe SM, Colin AA
Improved clinical and radiographic outcomes after treatment with ivacaftor in a young adult with cystic fibrosis with the P67L CFTR mutation.
Chest. 2015 Mar;147(3):e79-82. doi: 10.1378/chest.14-1198., [PMID:25732475]

Abstract [show]
The underlying cause of cystic fibrosis (CF) is the loss of epithelial chloride and bicarbonate transport due to mutations in the CF transmembrane conductance regulator (CFTR) gene encoding the CFTR protein. Ivacaftor is a gene-specific CFTR potentiator that augments in vivo chloride transport in CFTR mutations affecting channel gating. Originally approved for the G511D CFTR mutation, ivacaftor is now approved for eight additional alleles exhibiting gating defects and has also been tested in R117H, a CFTR mutation with residual function that exhibits abnormal gating. P67L is a class 4 conductance (nongating) mutation exhibiting residual CFTR function. We report marked clinical improvement, normalization of spirometry, and dramatic reduction in radiographic structural airway changes after > 1 year of treatment with ivacaftor in a young adult with the compound heterozygous genotype P67L/F508del CFTR. The case suggests that ivacaftor may have a potential benefit for patients with CF with nongating mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 e journal.publications.chestnet.org Improved Clinical and Radiographic Outcomes After Treatment With Ivacaftor in a Young Adult With Cystic Fibrosis With the P67L CFTR Mutation Shatha Yousef, MD; George M. Solomon, MD; Alan Brody, MD; Steven M. Rowe, MD, MSPH; and Andrew A. Colin, MD The underlying cause of cystic fibrosis (CF) is the loss of epithelial chloride and bicarbonate transport due to mutations in the CF transmembrane conductance regulator (CFTR) gene encoding the CFTR protein. Login to comment
3 P67L is a class 4 conductance (nongating) mutation exhibiting residual CFTR function. Login to comment
4 We report marked clinical improvement, normalization of spirometry, and dramatic reduction in radiographic structural airway changes after .1 year of treatment with ivacaftor in a young adult with the compound heterozygous genotype P67L/F508del CFTR. Login to comment
13 This includes P67L, a class 4 conductance mutation that exhibits residual CFTR function and relatively preserved CFTR expression, has a worldwide prevalence of 0.2%, and is the sixth most common mutation in Scotland.9 We report a case of a patient with CF who is a complex heterozygote for P67L/F508del with severe CF lung disease who improved significantly shortly after starting treatment with ivacaftor, including evidence of resolving structural lung disease. Login to comment
14 Case Report The patient is an 18-year-old woman of Scottish descent with genotype F508del/P67L. Login to comment
34 P67L is generally considered a CFTR mutation with reduced conductance.12 Furthermore, Sosnay and colleagues13 reported lower levels of mature glycosylated protein compared with wild-type CFTR (low band C/B ratio), suggesting an additional abnormality caused by ineffective maturation of P67L. Login to comment
35 Van Goor et al12 studied the in vitro effect of ivacaftor on multiple mutant CFTR forms due to missense mutations, including mutations that cause abnormal protein processing and reduced CFTR activity at the plasma membrane, such as P67L. Login to comment
36 In vitro, ivacaftor caused a significant increase in chloride current in epithelial cells expressing these mutations.12 Combined with data illustrated by this case, results strongly indicate that P67L is among the mutations that can Figure 1 - Comparison of the average FEV1 of all available measurements obtained during the years prior to ivacaftor and after the start of ivacaftor treatment. Login to comment
39 Moreover, the observed course of this patient supports the notion that ivacaftor could exhibit a class effect on CFTR mutations with decreased conductance but residual function and expression, such as P67L. Login to comment
44 Currently, evaluation of conductance mutations has been limited to the R117H mutation, which also exhibits abnormal gating.15 Although ivacaftor has been reported to reduce the stability of some CFTR forms in vitro, including P67L, any detrimental effect on cell surface levels was not apparent based on a robust and sustained clinical response in this individual.16,17 Our positive experience emphasizes the need for definitive studies to test the potential benefit of ivacaftor for patients with CF with nongating missense mutations. Login to comment

[hide] Inconclusive diagnosis of cystic fibrosis after ne... Pediatrics. 2015 Jun;135(6):e1377-85. doi: 10.1542/peds.2014-2081. Epub 2015 May 11. Ooi CY, Castellani C, Keenan K, Avolio J, Volpi S, Boland M, Kovesi T, Bjornson C, Chilvers MA, Morgan L, van Wylick R, Kent S, Price A, Solomon M, Tam K, Taylor L, Malitt KA, Ratjen F, Durie PR, Gonska T
Inconclusive diagnosis of cystic fibrosis after newborn screening.
Pediatrics. 2015 Jun;135(6):e1377-85. doi: 10.1542/peds.2014-2081. Epub 2015 May 11., [PMID:25963003]

Abstract [show]
OBJECTIVES: To prospectively study infants with an inconclusive diagnosis of cystic fibrosis (CF) identified by newborn screening (NBS; "CF screen positive, inconclusive diagnosis" [CFSPID]) for disease manifestations. METHODS: Infants with CFSPID and CF based on NBS from 8 CF centers were prospectively evaluated and monitored. Genotype, phenotype, repeat sweat test, serum trypsinogen, and microbiology data were compared between subjects with CF and CFSPID and between subjects with CFSPID who did (CFSPID-->CF) and did not (CFSPID-->CFSPID) fulfill the criteria for CF during the first 3 years of life. RESULTS: Eighty-two subjects with CFSPID and 80 subjects with CF were enrolled. The ratio of CFSPID to CF ranged from 1:1.4 to 1:2.9 in different centers. CFTR mutation rates did not differ between groups; 96% of subjects with CFSPID and 93% of subjects with CF had 2 mutations. Subjects with CFSPID had significantly lower NBS immunoreactive trypsinogen (median [interquartile range]:77 [61-106] vs 144 [105-199] mug/L; P < .0001) than did subjects with CF. Pseudomonas aeruginosa and Stenotrophomonas maltophilia were isolated in 12% and 5%, respectively, of subjects with CFSPID. CF was diagnosed in 9 of 82 (11%) subjects with CFSPID (genotype and abnormal sweat chloride = 3; genotype alone = 4; abnormal sweat chloride only = 2). Sweat chloride was abnormal in CFSPID-->CF patients at a mean (SD) age of 21.3 (13.8) months. CFSPID-->CF patients had significantly higher serial sweat chloride (P < .0001) and serum trypsinogen (P = .009) levels than did CFSPID-->CFSPID patients. CONCLUSIONS: A proportion of infants with CFSPID will be diagnosed with CF within the first 3 years. These findings underscore the need for clinical monitoring, repeat sweat testing at age 2 to 3 years, and extensive genotyping.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
108 TABLE 3 Characteristics of Subjects With CFSPID Who Later Met Diagnostic Criteria of CF Subject Number Allele 1 Allele 2 Ethnicity NBS IRT, mg/L Initial Sweat Chloride, mmol/L Highest Sweat Chloride, mmol/L Country 1 F508del R117C White 105.8 36 61 Canada 2 F508del S1455X White 66.6 46 74 Canada 3 F508del P67L White 151.2 38 38 Canada 4 F508del L206W White 83.8 58 64 Canada 5 G542X L206W White 67 49 66 Canada 6 F508del L206W White 59.9 45 45 Canada 7 R1162X R117H-7T White 126 36 70 Italy 8 2183AA.G R117C White 129 32 32 Italy 9 F508del R117C White 80.4 48 56 Canada e OOI et al including in newborn-screened infants with equivocal CF diagnosis and in older individuals with single-organ manifestations of CF.17,18,20-22 As in the case of the 7 subjects who were initially classified as CFSPID but who were subsequently recognized to carry 2 disease-causing mutations on the basis of the CFTR2 project, the diagnostic consequences (benign versus disease-causing) of the CFTR mutations identified in all of the other subjects with CFSPID may not be apparent until later on, when new genetic information becomes available and classification of CFTR mutations currently considered to be of "unknown" consequences is updated. Login to comment

[hide] The improvement of the best practice guidelines fo... Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99. Girardet A, Viart V, Plaza S, Daina G, De Rycke M, Des Georges M, Fiorentino F, Harton G, Ishmukhametova A, Navarro J, Raynal C, Renwick P, Saguet F, Schwarz M, SenGupta S, Tzetis M, Roux AF, Claustres M
The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus.
Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99., [PMID:26014425]

Abstract [show]
Cystic fibrosis (CF) is one of the most common indications for preimplantation genetic diagnosis (PGD) for single gene disorders, giving couples the opportunity to conceive unaffected children without having to consider termination of pregnancy. However, there are no available standardized protocols, so that each center has to develop its own diagnostic strategies and procedures. Furthermore, reproductive decisions are complicated by the diversity of disease-causing variants in the CFTR (cystic fibrosis transmembrane conductance regulator) gene and the complexity of correlations between genotypes and associated phenotypes, so that attitudes and practices toward the risks for future offspring can vary greatly between countries. On behalf of the EuroGentest Network, eighteen experts in PGD and/or molecular diagnosis of CF from seven countries attended a workshop held in Montpellier, France, on 14 December 2011. Building on the best practice guidelines for amplification-based PGD established by ESHRE (European Society of Human Reproduction and Embryology), the goal of this meeting was to formulate specific guidelines for CF-PGD in order to contribute to a better harmonization of practices across Europe. Different topics were covered including variant nomenclature, inclusion criteria, genetic counseling, PGD strategy and reporting of results. The recommendations are summarized here, and updated information on the clinical significance of CFTR variants and associated phenotypes is presented.European Journal of Human Genetics advance online publication, 27 May 2015; doi:10.1038/ejhg.2015.99.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
79 (unknown) Q39X c.115C4T p.Gln39* P67L c.200C4T p.Pro67Leu R75X c.223C4T p.Arg75* 405+1G4A c.273+1G4A 406-1G4A c.274-1G4A E92X c.274G4T p.Glu92* E92K c.274G4A p.Glu92Lys Q98X c.292C4T p.Gln98* 457TAT4G c.325_327delTATinsG p.Tyr109Glyfs*4 D110H c.328G4C p.Asp110His R117C c.349C4T p.Arg117Cys Y122X c.366 T4A p.Tyr122* 574delA c.442delA p.Ile148Leufs*5 444delA c.313delA p.Ile105Serfs*2 663delT c.531delT p.Ile177Metfs*12 G178R c.532G4A p.Gly178Arg 711+3 A4G c.579+3 A4G 711+5G4A c.579+5G4A 712-1G4T c.580-1G4T H199Y c.595C4T p.His199Tyr P205S c.613C4T p.Pro205Ser L206W c.617 T4G p.Leu206Trp Q220X c.658C4T p.Gln220* 852del22 c.720_741delAGGGAGAAT GATGATGAAGTAC p.Gly241Glufs*13 1078delT c.948delT p.Phe316Leufs*12 G330X c.988G4T p.Gly330* Table 1 (Continued ) HGVS nomenclature Legacy name cDNA nucleotide name Protein name R334W c.1000C4T p.Arg334Trp I336K c.1007 T4A p.Ile336Lys T338I c.1013C4T p.Thr338Ile 1154insTC c.1021_1022dupTC p.Phe342Hisfs*28 S341P c.1021 T4C p.Ser341Pro R347H c.1040G4A p.Arg347His 1213delT c.1081delT p.Trp361Glyfs*8 1248+1G4A c.1116+1G4A 1259insA c.1130dupA p.Gln378Alafs*4 W401X(TAG) c.1202G4A p.Trp401* W401X(TGA) c.1203G4A p.Trp401* 1341+1G4A c.1209+1G4A 1461ins4 c.1329_1330insAGAT p.Ile444Argfs*3 1525-1G4A c.1393-1G4A S466X c.1397C4A or c.1397C4G p.Ser466* L467P c.1400 T4C p.Leu467Pro S489X c.1466C4A p.Ser489* S492F c.1475C4T p.Ser492Phe 1677delTA c.1545_1546delTA p.Tyr515* V520F c.1558G4T p.Val520Phe 1717-1G4A c.1585-1G4A 1717-8G4A c.1585-8G4A S549R c.1645 A4C p.Ser549Arg S549N c.1646G4A p.Ser549Asn S549R c.1647 T4G p.Ser549Arg Q552X c.1654C4T p.Gln552* A559T c.1675G4A p.Ala559Thr 1811+1.6kbA4G c.1680-886 A4G 1812-1G4A c.1680-1G4A R560K c.1679G4A p.Arg560Lys E585X c.1753G4T p.Glu585* 1898+3 A4G c.1766+3 A4G 2143delT c.2012delT p.Leu671* 2184insA c.2052_2053insA p.Gln685Thrfs*4 2184delA c.2052delA p.Lys684Asnfs*38 R709X c.2125C4T p.Arg709* K710X c.2128 A4T p.Lys710* 2307insA c.2175dupA p.Glu726Argfs*4 L732X c.2195 T4G p.Leu732* 2347delG c.2215delG p.Val739Tyrfs*16 R764X c.2290C4T p.Arg764* 2585delT c.2453delT p.Leu818Trpfs*3 E822X c.2464G4T p.Glu822* 2622+1G4A c.2490+1G4A E831X c.2491G4T p.Glu831* W846X c.2537G4A p.Trp846* W846X (2670TGG4TGA) c.2538G4A p.Trp846* R851X c.2551C4T p.Arg851* 2711delT c.2583delT p.Phe861Leufs*3 S945L c.2834C4T p.Ser945Leu 2789+2insA c.2657+2_2657+3insA Q890X c.2668C4T p.Gln890* L927P c.2780 T4C p.Leu927Pro 3007delG c.2875delG p.Ala959Hisfs*9 G970R c.2908G4C p.Gly970Arg 3120G4A c.2988G4A function variants that cause CF disease when paired together; (ii) variants that retain residual CFTR function and are compatible with milder phenotypes such as CFTR-RD; (iii) variants with no clinical consequences; and (iv) variants of unproven or uncertain clinical relevance. Login to comment

[hide] Prevalence of meconium ileus marks the severity of... Genet Med. 2015 Jun 18. doi: 10.1038/gim.2015.79. Dupuis A, Keenan K, Ooi CY, Dorfman R, Sontag MK, Naehrlich L, Castellani C, Strug LJ, Rommens JM, Gonska T
Prevalence of meconium ileus marks the severity of mutations of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene.
Genet Med. 2015 Jun 18. doi: 10.1038/gim.2015.79., [PMID:26087176]

Abstract [show]
RATIONALE: Meconium ileus (MI) is a perinatal complication in cystic fibrosis (CF), which is only minimally influenced by environmental factors. We derived and examined MI prevalence (MIP) scores to assess CFTR phenotype-phenotype correlation for severe mutations. METHOD: MIP scores were established using a Canadian CF population (n = 2,492) as estimates of the proportion of patients with MI among all patients carrying the same CFTR mutation, focusing on patients with p.F508del as the second allele. Comparisons were made to the registries from the US CF Foundation (n = 43,432), Italy (Veneto/Trentino/Alto Adige regions) (n = 1,788), and Germany (n = 3,596). RESULTS: The prevalence of MI varied among the different registries (13-21%). MI was predominantly prevalent in patients with pancreatic insufficiency carrying "severe" CFTR mutations. In this severe spectrum MIP scores further distinguished between mutation types, for example, G542X (0.31) with a high, F508del (0.22) with a moderate, and G551D (0.08) with a low MIP score. Higher MIP scores were associated with more severe clinical phenotypes, such as a lower forced expiratory volume in 1 second (P = 0.01) and body mass index z score (P = 0.04). CONCLUSIONS: MIP scores can be used to rank CFTR mutations according to their clinical severity and provide a means to expand delineation of CF phenotypes.Genet Med advance online publication 18 June 2015Genetics in Medicine (2015); doi:10.1038/gim.2015.79.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 Canadian studies for CF modfier genes 2,492 3,153 43,432 3,596 1,788 2,230 23,397 16,023 3 716 3,438 860 15% (19%) 1,902 2,576 PIP and MIP derivation FEV1 and zBMI modeling MIP calculation following correction of MI variable 23,301 2,413 510 21% (25%) 20% (23%) 13% (15%) Total F508del/others MI prevalence uncorrected (estimated) Missing or incomplete genotype Available for analysis Canadian CF patient registry, born after 1980 US CF patient registry German CF patient registry CF patient registry, North Italy Table 1ߒ Meconium ileus prevalence scores for the most common cystic fibrosis-causing variants p. F508del/other variants Class PIP Canada, (n) MIP, (n) Canada United States Germany Italy HGVS Legacy name c.262_263delTT 394delTT I 0.38 (50) c.3472C>T R1158X I 0.37 (35) c.1558G>T V520F 0.35 (43) c.3484C>T R1162X I 0.34 (135) 0.17 (14) 0.22 (45) c.2012delT 2143delT I 0.33 (13) c.3276C>A or G Y1092X I 0.92 (13) 0.09 (12) 0.33 (55) c.3846G>A W1282X I 1.00 (13) 0.29 (13) 0.32 (442) 0.17 (20) c.1477C>T Q493X I 1.00 (11) 0.19 (11) 0.32 (102) c.3528delC 3659delC I 0.31 (139) c.579ߙ+ߙ1G>T 711ߙ+ߙ1G>T 0.97 (39) 0.30 (38) 0.31 (54) c.178G>T E60X I 0.30 (66) c.1657C>T R553X I 1.00 (16) 0.28 (16) 0.30 (415) 0.24 (107) c.1585-1G>A 1717-1G>A I 1.00 (12) 0.23 (12) 0.29 (367) 0.22 (38) 0.16 (22) c.1766ߙ+ߙ1G>A 1898ߙ+ߙ1G>A 0.29 (139) c.1624G>T G542X I 0.99 (73) 0.31 (72) 0.29 (976) 0.21 (79) 0.22 (33) c.1521_1523delCTT F508del II 0.99 (1292) 0.22 (1260) 0.27 (15391) 0.21 (1910) 0.20 (230) c.1679G>C R560T II 0.27 (123) c.3744delA 3876delA 0.27 (22) c.2128A>T K710X I 0.26 (12) c.1519_1521delATC I507del II 1.00 (20) 0.21 (19) 0.25 (162) c.3909C>G N1303K II 0.98 (40) 0.13 (39) 0.25 (534) 0.23 (80) 0.14 (62) c.489ߙ+ߙ1G>T 621ߙ+ߙ1G>T I 1.00 (90) 0.24 (88) 0.25 (369) 0.21 (11) c.3266G>A W1089X I 0.25 (17) c.1675G>A A559T 0.24 (21) c.988G>T G330X 0.24 (10) c.3773_3774insT 3905insT 0.23 (78) c.2988ߙ+ߙ1G>A 3120ߙ+ߙ1G>A 0.22 (121) c.443T>C I148T;3199del6 1.00 (15) 0.22 (15) c.2052delA 2184delA I 0.21 (89) 0.22 (10) c.2051_2052delAAinsG 2183AA>G 0.20 (73) 0.20 (42) c.948delT 1078delT 0.19 (20) c.1652G>A G551D III 0.96 (54) 0.08 (53) 0.15 (979) 0.09 (84) c.254G>A G85E 0.50 (24) 0.06 (24) 0.14 (137) 0.00 (10) c.3196C>T R1066C 0.14 (42) c.1466C>A S489X 1.00 (14) 0.14 (14) c.3808G>A D1270N 0.13 (19) c.1055G>A R352Q 0.12 (18) c.579ߙ+ߙ5G>A 711ߙ+ߙ5G>A 0.12 (30) c.2175_2176insA 2307insA 0.11 (24) c.349C>T R117C 0.10 (37) c.1040G>C R347P IV 0.18 (11) 0.19 (11) 0.10 (130) 0.02 (56) c.350G>A R117H IV 0.05 (21) 0.00 (21) 0.07 (666) 0.02 (19) c.2657ߙ+ߙ5G>A 2789ߙ+ߙ5G>A V 0.25 (20) 0.00 (20) 0.06 (271) 0.01 (21) c.1040G>A R347H 0.06 (55) c.2988G>A 3120G->A 0.06 (36) c.328G>C D1152H IV 0.06 (124) c.3717ߙ+ߙ12191C>T 3849ߙ+ߙ10kbC>T V 0.07 (14) 0.00 (14) 0.05 (299) 0.01 (42) 0.00 (15) c.1364C>A A455E V 0.16 (45) 0.01 (41) 0.05 (109) c.1000C>T R334W IV 0.18 (11) 0.00 (10) 0.05 (92) c.617T>G L206W 0.06 (18) 0.05 (17) 0.04 (52) c.3302T>A M1101K 0.04 (17) c.200C>T P67L V 0.07 (14) 0.00 (14) Meconium ileus prevalence (MIP) and pancreas insufficiency prevalence (PIP) scores are presented. Login to comment
109 While non-CFTR modifier genes as well as environmental factors largely influence the development and progression of lung disease and nutritional decline,33-36 we demonstrate that the severity of the underlying CFTR genotype Table 2ߒ Meconium ileus prevalence scores and CFTR function CFTR mutation MIP score CFTR function (%wt) High MIP score ߓ V520F 0.38 0.2 ߓ N1303K 0.25 0.5 ߓ F508del 0.27 0.4 ߓ R560T 0.27 0.1 ߓ A559T 0.24 0 ߓ G551D 0.15 1 ߓ G85E 0.14 0.8 ߓ R1066C 0.13 0 Low MIP score ߓ R347P 0.1 0 ߓ R117C 0.1 2.9 ߓ R117H 0.07 33 ߓ R347H 0.06 5 ߓ R334W 0.05 1.3 ߓ A455E 0.05 6 ߓ L206W 0.04 5 ߓ M1101K 0.04 0 ߓ P67L 0.0 8 The table compares meconium ileus prevalence (MIP) scores and measured cystic fibrosis transmembrane conductance regulator (CFTR) function in Fisher rat thyroid determined by VanGoor et al.24 for the major and missense cystic fibrosis-causing variants for which patient group size was ࣙ10 in at least the US group. Login to comment