ABCMdb

ABCC7 p.Pro205Ser

Admin's notes:	Class II-III (maturation defect, gating defect) Veit et al.
ClinVar:	c.614C>G , p.Pro205Arg ? , not provided c.613C>T , p.Pro205Ser D , Pathogenic
CF databases:	c.613C>T , p.Pro205Ser D , CF-causing ; CFTR1: This mutation was detected by SSCP analysism followed by direct sequencing. Mutation P205S was found in 3/270 unrelated Spanish CF non-[delta]F508 chromosomes. P205S is associated with haplotype 16/44/13. c.614C>G , p.Pro205Arg (CFTR1) D , c.614C>T , p.Pro205Leu (CFTR1) ? ,
Predicted by SNAP2:	A: D (95%), C: D (95%), D: D (95%), E: D (95%), F: D (95%), G: D (95%), H: D (95%), I: D (95%), K: D (95%), L: D (95%), M: D (95%), N: D (95%), Q: D (95%), R: D (95%), S: N (53%), T: D (95%), V: D (95%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

II-III (maturation defect, gating defect) <a href="https://www.ncbi.nlm.nih.gov/pubmed/26823392">Veit et al.</a>
admin on 2016-08-19 15:16:22

Publications
[hide] Dynamic association of proteasomal machinery with ... J Cell Biol. 1999 May 3;145(3):481-90. Wigley WC, Fabunmi RP, Lee MG, Marino CR, Muallem S, DeMartino GN, Thomas PJ
Dynamic association of proteasomal machinery with the centrosome.
J Cell Biol. 1999 May 3;145(3):481-90., 1999-05-03 [PMID:10225950]

Abstract [show]
Although the number of pathologies known to arise from the inappropriate folding of proteins continues to grow, mechanisms underlying the recognition and ultimate disposition of misfolded polypeptides remain obscure. For example, how and where such substrates are identified and processed is unknown. We report here the identification of a specific subcellular structure in which, under basal conditions, the 20S proteasome, the PA700 and PA28 (700- and 180-kD proteasome activator complexes, respectively), ubiquitin, Hsp70 and Hsp90 (70- and 90-kD heat shock protein, respectively) concentrate in HEK 293 and HeLa cells. The structure is perinuclear, surrounded by endoplasmic reticulum, adjacent to the Golgi, and colocalizes with gamma-tubulin, an established centrosomal marker. Density gradient fractions containing purified centrosomes are enriched in proteasomal components and cell stress chaperones. The centrosome-associated structure enlarges in response to inhibition of proteasome activity and the level of misfolded proteins. For example, folding mutants of CFTR form large inclusions which arise from the centrosome upon inhibition of proteasome activity. At high levels of misfolded protein, the structure not only expands but also extensively recruits the cytosolic pools of ubiquitin, Hsp70, PA700, PA28, and the 20S proteasome. Thus, the centrosome may act as a scaffold, which concentrates and recruits the systems which act as censors and modulators of the balance between folding, aggregation, and degradation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
34 Several other CF-causing folding mutations (Gregory et al., 1991; Sheppard et al., 1996) including P205S which is located in the third membrane spanning helix (Wigley et al., 1998) of TMD1, also result in inefficient processing and maturation and increased degradation. Login to comment
35 Significantly, both the ⌬F508 and P205S folding mutants are functional when they assume a native conformation, thus raising the possibility that overcoming the maturation deficiency by correcting the underlying folding defect or by circumventing a proteolytic recognition step may be of therapeutic benefit. Login to comment
61 Preparation of P205S Mutant Expression Construct Oligonucleotide-directed mutagenesis as described (Andrews and Lesley, 1998) was used to generate the mutant CFTR from the parent expression vector pCMVNot6.2. Login to comment
63 The sequence of the mutagenic primer used to create P205S was 5Ј-CGTGTGGATCGCT- TCTTTGCAAGTGGC-3Ј. Login to comment
103 Analysis of Soluble and Insoluble Cellular Fractions 2.5 ϫ 105 HeLa cells per 3-cm dish were either mock-transfected or transfected with P205S mutant CFTR expression plasmid. Login to comment
152 To further test this hypothesis, we expressed in HEK 293 cells wild-type CFTR and two variants known to misfold, namely ⌬F508 and P205S, and examined their effect on the centrosome and the proteasome machinery. Login to comment
156 In sharp contrast, ⌬F508 and P205S mutant CFTR are detected predominantly in the ER of transfected cells as illustrated by the ER pattern of CFTR staining (Fig. 4, C and E) and the complete colocalization with BiP staining (Fig. 4, D and F). Login to comment
159 In striking contrast, expression of P205S (Fig. 5 B) or ⌬F508 (data not shown) expands the centrosome in a manner similar to that observed when cells are treated with lactacystin alone (Fig. 3). Login to comment
169 Recruitment of Proteasomal Components to a Centrosome-Associated Inclusion In cells overexpressing mutant CFTR (P205S) and treated with lactacystin, we observed the formation of large, perinuclear aggregates of misfolded CFTR which appear to arise from the centrosome as indicated by colocalization with ␥-tubulin (Fig. 6). Login to comment
179 However, in cells expressing P205S mutant CFTR and treated with lactacystin, ␥-tubulin was observed distributed between the soluble and insoluble fractions. Login to comment
186 When the cellular level of misfolded protein is high, either due to the overexpression of a misfolded mutant protein (such as ⌬F508 or P205S CFTR) or the inhibition of the proteasome, the cell responds by expanding the diame- Figure 3. Login to comment
204 Transiently transfected HEK 293 cells expressing either wild-type or mutant P205S CFTR (as indicated) were stained with antibodies against CFTR (red) and either PA28 (A) or 20S proteasome (B) (each in green). Login to comment
226 The expansion due to inhibition of the proteasome with lactacystin alone and lactacystin with low expression of wild-type, ⌬F508, and P205S CFTR was determined from at least eight measurements. Login to comment

[hide] Gastrointestinal, liver, and pancreatic involvemen... Pancreas. 2001 May;22(4):395-9. Modolell I, Alvarez A, Guarner L, De Gracia J, Malagelada JR
Gastrointestinal, liver, and pancreatic involvement in adult patients with cystic fibrosis.
Pancreas. 2001 May;22(4):395-9., [PMID:11345141]

Abstract [show]
BACKGROUND: The clinical prevalence of cystic fibrosis (CF) in adults continues to rise, with a consequent impact on adult gastroenterology practice. AIM: To characterize the gastrointestinal manifestations of CF in adult patients. PATIENTS AND METHODS: The clinical records of 89 adult CF patients treated at our institution from 1992 to 1999 were reviewed. Patients were distributed into two groups: group A (39 patients), which consisted of patients who were diagnosed with CF at when they were younger than 14 years old and who survived into adulthood; and group B (50 patients), who were diagnosed with CF at the age of 14 years or older. Data on CF genetic mutations, nutritional state, evidence of pulmonary, gastrointestinal, liver, or pancreatic involvement were collected for each patient. RESULTS: The most prevalent genetic mutation in our series was deltaF508, present in 50 patients (56.2%), 29 of whom belonged to group A and 21 who belonged to group B. In group A, the deltaF508 mutation was associated with exocrine pancreatic insufficiency (PI) in 26 of 29 patients (89.6%), whereas in group B it was associated with PI in only four patients (19%). Overall, PI was present in 33 of 39 patients (84.6%) in group A and in eight of 50 patients (16%) in group B. Four patients in group B had experienced previous episodes of acute pancreatitis; two of them had associated PI. Of the 89 patients, 12 (10 in group A) were malnourished. Malnutrition was invariably associated with PI. Hepatic and biliary tree abnormalities were particularly prevalent in patients in group A and was usually associated with PI. Intestinal manifestations were uncommon. CONCLUSIONS: Diagnosis of CF before the age of 14 years is associated with greater gastrointestinal compromise than diagnosis at an older age, particularly with regard to PI. CF carriers of the deltaF508 mutation have an increased risk of developing gastrointestinal manifestations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 Other genotypes present in our series ⌬F508/711+1G>T 2A 5T/5T 1B ⌬F508/5T 2B ⌬1507/- 1A ⌬F508/R117H 2B R1162X/1898+1G>A 1A ⌬F508/R1162X 1A 2183A/- 1A ⌬F508/N1303K 1A 1609-CA/1811+1.6kbA>G 1A ⌬F508/3272-26A>G 1B 1609-CA/R347P 1A ⌬F508/D836Y 1B Q890X/- 1A ⌬F508/1717-1G>A 1A R334W/- 1B G542X/W1282X 1A N1303K/2789+5G>A 1B G542X/2789+5G>A 1B 3659-C/- 1B G542X/P205S 1B G85E/- 1B G542X/D1270N 1B Negative 1A, 20B L206W/- 1B Unknown 2A creatic insufficiency was highly prevalent, affecting 33 patients (84.6%). Login to comment

[hide] Improved detection of CFTR mutations in Southern C... Hum Mutat. 2001 Oct;18(4):296-307. Wong LJ, Wang J, Zhang YH, Hsu E, Heim RA, Bowman CM, Woo MS
Improved detection of CFTR mutations in Southern California Hispanic CF patients.
Hum Mutat. 2001 Oct;18(4):296-307., [PMID:11668613]

Abstract [show]
Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene cause cystic fibrosis (CF), a common autosomal recessive disease in Caucasians. The broad mutation spectrum varies among different patient groups. Current molecular diagnoses are designed to detect 80-97% of CF chromosomes in Caucasians and Ashkenazi Jews but have a much lower detection rate in Hispanic CF patients. Grebe et al. [1994] reported a 58% detection rate in Hispanic patients. Since then, there has been no large-scale, complete mutational analysis of Hispanic CF patients. In this study, the mutations in 62 Hispanic patients from southern California were investigated. The entire coding and flanking intronic regions of the CFTR gene were analyzed by temporal temperature gradient gel electrophoresis (TTGE) followed by sequencing to identify the mutations. Eleven novel mutations were discovered in this patient group: 3876delA, 406-1G>A, 935delA, 663delT, 3271delGG, 2105-2117del13insAGAAA, 3199del6, Q179K, 2108delA, 3171delC, and 3500-2A>T. Among the mutations, seven were out-of-frame insertions and deletions that result in truncated proteins, two were splice-site mutations, one was an in-frame 6 bp deletion, and one was a missense mutation that involved the non-conservative change of glutamine-179 to lysine. All patients presented severe classical clinical course with pancreatic insufficiency and poor growth, consistent with the nature of truncation mutation. The results indicate that TTGE screening following the analysis of recurrent mutations will substantially improve the mutation detection rate for Hispanic CF patients from southern California.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
117 Summary of Mutations Found in This Group of Hispanic Patients Exon or Number of Mutation intron chromosomes Frequency % Mutations detected before full gene analysis 91 73.38% 1 F508 10 64 51.6 2 G542X 11 5 4 3 3849+10kb C>T Intron 19 5 4 4 S549N 11 3 2.4 5 I148T 4 2 1.6 6 3120+1G>A 16 2 1.6 7 R334W 7 2 1.6 8 G551D 11 1 0.8 9 N1303K 21 1 0.8 10 W1282X 20 1 0.8 11 R1162X 19 1 0.8 12 G85E 3 1 0.8 13 W1089X 17b 1 0.8 14 Y1092X 17b 1 0.8 15 P205S 6a 1 0.8 Mutations detected by full gene screening 26 20.97% 16 R1066Ca 17b 2 1.6 17 1949del84 13 1 0.8 18 2184delA 13 1 0.8 19 Q98R 4 1 0.8 20 R75X 3 1 0.8 21 G1244E 20 1 0.8 22 3876delA 20 7 5.65 23 935delA 6b 2 1.6 24 406-1G>A Intron 2 2 1.6 25 3271delGG 17a 1 0.8 26 2105-2117del13insAGAAA 13 1 0.8 27 663delT 5 1 0.8 28 3171delC 17a 1 0.8 29 2108delA 13 1 0.8 30 Q179K 5 1 0.8 31 3199del6 17a 1 0.8 32 3500-2 A->T Intron 17b 1 0.8 Total identified 117 (177)b 94.35 (97.5)b Unidentified 7 (3)b 5.65 (2.5)b Total 124 (120)b 100 (100)b a This mutation was also detected by SSCP. Login to comment

[hide] ATB(0)/SLC1A5 gene. Fine localisation and exclusio... Eur J Hum Genet. 2001 Nov;9(11):860-6. Larriba S, Sumoy L, Ramos MD, Gimenez J, Estivill X, Casals T, Nunes V
ATB(0)/SLC1A5 gene. Fine localisation and exclusion of association with the intestinal phenotype of cystic fibrosis.
Eur J Hum Genet. 2001 Nov;9(11):860-6., [PMID:11781704]

Abstract [show]
The Na+-dependent amino acid transporter named ATB(0) was previously found to be located in 19q13.3 by fluorescence in situ hybridisation. Genetic heterogeneity in the 19q13.2-13.4 region, syntenic to the Cystic Fibrosis Modulator Locus 1 (CFM1) in mouse, seemed to be associated to the intestinal phenotypic variation of cystic fibrosis (CF). We performed fine chromosomal mapping of ATB(0) on radiation hybrid (RH) panels G3 and TNG. Based on the most accurate location results from TNG-RH panel, mapping analysis evidenced that ATB(0) is localised between STS SHGC-13875 (D19S995) and STS SHGC-6138 in 19q13.3, that corresponds with the immediately telomeric/distal segment of the strongest linkage region within the human CFM1 (hCFM1) syntenic region. Regarding to the genomic structure and exon organisation, our results show that the ATB(0) gene is organised into eight exons. The knowledge of the genomic structure allowed us to perform an exhaustive mutational analysis of the gene. Evaluation of the possible implication of ATB(0) in the intestinal phenotype of CF was performed on the basis of the functional characteristics of the encoded protein, its apparent relevance to meconium ileus (MI) and position in relation to the hCFM1 syntenic region. We have analysed this gene in samples from CF patients with and without MI. Several sequence variations in the ATB(0) gene were identified, although none of them seemed to be related to the intestinal phenotype of CF. Even though no particular allele or haplotype in ATB(0) appears to be associated to CF-MI disease, new SNPs identified should be useful in segregation and linkage disequilibrium analyses in families affected by other disorders caused by the impairment of neutral amino acid transport.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
151 Statistical analysis showed that the higher incidence for P17A and the lower incidence for V512L observed in the general population Table 3 CFTR mutations of the CF patients under study with and without meconium ileus (MI) CF-non MI CF-MI CFTR mutations n CFTR mutations n F508del/R117H 2 F508del/F508del 7 F508del/R334W 3 F508del/L365P 1 F508del/R347P 1 F508del/G542X 1 F508del/621+1G4Ta 1 F508del/621+IG4Ta 1 F508del/M1101K 1 F508del/R1066C 1 F508del/1609delCAa 1 F508del/W1089X 1 F508del/2789+5G4Aa 3 F508del/R1162X 1 F508del/3849+10kbC4T 1 F508del/1609delCAa 1 G542X/G85E 1 F508del/Q1281X 1 G542X/V232D 1 F508del/1811+1.6kbA4G 1 G542X/1811+1.6kb A4Ga 1 F508del/2789+5G4Aa 1 G542X/2789+5G4A 1 F508del/2869insG 1 Q890X/L206W 1 F508del/unknown 1 1811+1.6kbA4G/P205S 1 I507del/I507del 1 R1162X/3272-26A4G 1 G542X/1078delT 1 N1303K/R347H 1 G542X/1811+1.6kbA4Ga 1 N1303K/A1006E+5T 1 S549R/CFTR50kbdel 1 2789+5G4A/405+1G4A 1 R1066C/R1066C 1 W1282X/712-1G4T 1 a CF patient with a sibling presenting identical CFTR genotype and discordance of intestinal phenotype. Login to comment

[hide] A protein sequence that can encode native structur... Nat Struct Biol. 2002 May;9(5):381-8. Wigley WC, Corboy MJ, Cutler TD, Thibodeau PH, Oldan J, Lee MG, Rizo J, Hunt JF, Thomas PJ
A protein sequence that can encode native structure by disfavoring alternate conformations.
Nat Struct Biol. 2002 May;9(5):381-8., [PMID:11938353]

Abstract [show]
The linear sequence of amino acids contains all the necessary information for a protein to fold into its unique three-dimensional structure. Native protein sequences are known to accomplish this by promoting the formation of stable, kinetically accessible structures. Here we describe a Pro residue in the center of the third transmembrane helix of the cystic fibrosis transmembrane conductance regulator that promotes folding by a distinct mechanism: disfavoring the formation of a misfolded structure. The generality of this mechanism is supported by genome-wide transmembrane sequence analyses. Furthermore, the results provide an explanation for the increased frequency of Pro residues in transmembrane alpha-helices. Incorporation by nature of such 'negative folding determinants', aimed at preventing the formation of off-pathway structures, represents an additional mechanism by which folding information is encoded within the evolved sequences of proteins.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
21 Correspondence should be addressed to P.J.T. email: Philip.Thomas@UTSouthwestern.edu nature structural biology • volume 9 number 5 • may 2002 381 WT P205S P205S + lac P205S∆FWT B C a b Fig. 1 P205S mutant CFTR misfolds and aggregates in vivo. Login to comment
22 a, The subcellular disposition of wild type and P205S CFTR transiently expressed in HEK293 cells was evaluated by indirect immunofluorescence. Login to comment
23 Staining with polyclonal antiserum R3194 (directed against the CFTR C-terminus; (red) demonstrates surface expression of mature wild type protein (left) and ER-retention of P205S (center)). Login to comment
25 Treatment of mutant expressing cells with the proteasome inhibitor lactacystin (lac, 10 µM for 12 h) results in the accumulation of P205S CFTR in a single perinuclear aggregate or inclusion (right). Login to comment
26 b, Maturation of wild type (WT) and mutant (both ∆F508 and P205S) CFTR expressed in HEK293 cells was evaluated by western blotting using monoclonal anti-CFTR M3A7. Login to comment
32 However, the CF mutation P205S, in the center of the third TM α-helix (m3), results in maturation-deficient molecules that fail to correctly fold and traffic to the plasma membrane (Fig. 1a). Login to comment
40 Under these conditions, the wild type peptide is predominantly α-helical, whereas the P205S mutant forms a non-native structure, with a significantly decreased α-helical component and increased non-native structure (Fig. 2a). Login to comment
49 CD spec- troscopy30 evaluated the seconday structure of peptides representing wild type m3, the CF-causing mutant P205S, and control peptides P205G, P205A and P205L solubilized in either micellar SDS (0.5% (w/v) SDS and 5mM phosphate buffer, pH 7.2) or polyfluorinated organic solvents (10% HFIP, 40% TFE and 50% (v/v) H2O). Login to comment
50 The lines used to represent each peptide are wild type m3, dashed red; P205S, dashed blue; P205G, solid green; P205A, solid light purple; and P205L, solid black. Login to comment
63 Wild type peptides integrated well (>18%) in a predominately α-helical conformation, as opposed to P205S, which did not measurably integrate (data not shown). Login to comment
72 Constructs are denoted as follows: P, TfR-m3 wt; S, TfR-m3 P205S; and L, TfR-m3 P205L. Login to comment
81 b, The secondary structure of misfolded peptide P205S aggregates was assessed by ATR-FTIR spectroscopy (see Methods). Login to comment
92 Consistent with the peptide results, the wild type chimera properly integrates better than either the P205S or P205L mutants (Fig. 3b). Login to comment
100 Consistent with this observation, the misfolded, aggregated P205S peptide binds thioflavin T (ThT), a fluorescent stain used to identify β-amyloid33 (data not shown). Login to comment
143 An effect on apparent stability of similar magnitude is also observed for the mutant P205S (not shown). Login to comment
187 TfR-m3 chimeras were then generated by replacing the single TfR TM span with that of wild type CFTR m3 (residues 190-220), followed by site-directed mutagenesis (QuickChange, Stratagene) to introduce the P205S and L missense mutations. Login to comment

[hide] Genotype-phenotype correlation in cystic fibrosis:... Am J Med Genet. 2002 Jul 22;111(1):88-95. Salvatore F, Scudiero O, Castaldo G
Genotype-phenotype correlation in cystic fibrosis: the role of modifier genes.
Am J Med Genet. 2002 Jul 22;111(1):88-95., 2002-07-22 [PMID:12124743]

Abstract [show]
More than 1,000 mutations have been identified in the cystic fibrosis (CF) transmembrane regulator (CFTR) disease gene. The impact of these mutations on the protein and the wide spectrum of CF phenotypes prompted a series of Genotype-Phenotype correlation studies. The CFTR genotype is invariably correlated with pancreatic status-in about 85% of cases with pancreatic insufficiency and in about 15% of cases with pancreatic sufficiency. The correlations between the CFTR genotype and pulmonary, liver, and gastrointestinal expression are debatable. The heterogeneous phenotype in CF patients bearing the same genotype or homozygotes for nonsense mutations implicated environmental and/or genetic factors in the disease. However, the discordant phenotype observed in CF siblings argued against a major role of environmental factors and suggested that genes other than CFTR modulate the CF phenotype. A locus that modulates gastrointestinal expression was identified in mice and subsequently in humans. By analyzing nine CF patients discordant for meconium ileus we were able to show that this locus had a dominant effect. Moreover, in a collaborative study we found a higher rate of polymorphisms in beta-defensin genes 1 and 2 in CF patients and in controls. In another multicenter study mutations in alpha-1 antitrypsin (A1AT) and mannose binding lectin genes were found to be independent risk factors for liver disease in CF patients. The body of evidence available suggests that the variegated CF phenotype results from complex interactions between numerous gene products.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
46 A series of mutations usually associated with pancreatic sufficiency have been identified and defined as ''mild`` with reference to pancreatic status [Kerem et al., 1989c]: G85E, G91R, R117H, E193K, P205S, R334W, T338I, R347H, R347L, R347P, R352Q, A455E, S492F, S549N, P574H, D579G, 711 þ 5 G > A, C866Y, F1052V, H1054D, R1066H, R1068H, H1085R, D1152H, S1159P, S1251N, F1286S, G1349D, 2789 þ 5 G > A, and 3849 þ 10kb C > T [Dean et al., 1990; Cutting et al., 1990a; Cremonesi et al., 1992; Highsmith et al., 1994]. Login to comment

[hide] Variant cystic fibrosis phenotypes in the absence ... N Engl J Med. 2002 Aug 8;347(6):401-7. Groman JD, Meyer ME, Wilmott RW, Zeitlin PL, Cutting GR
Variant cystic fibrosis phenotypes in the absence of CFTR mutations.
N Engl J Med. 2002 Aug 8;347(6):401-7., 2002-08-08 [PMID:12167682]

Abstract [show]
BACKGROUND: Cystic fibrosis is a life-limiting autosomal recessive disorder with a highly variable clinical presentation. The classic form involves characteristic findings in the respiratory tract, gastrointestinal tract, male reproductive tract, and sweat glands and is caused by loss-of-function mutations in the cystic fibrosis transmembrane conductance regulator (CFTR ) gene. Nonclassic forms of cystic fibrosis have been associated with mutations that reduce but do not eliminate the function of the CFTR protein. We assessed whether alteration in CFTR function is responsible for the entire spectrum of variant cystic fibrosis phenotypes. METHODS: Extensive genetic analysis of the CFTR gene was performed in 74 patients with nonclassic cystic fibrosis who had been referred by 34 medical centers. We evaluated two families that each included a proband without identified mutations and a sibling with nonclassic cystic fibrosis to determine whether there was linkage to the CFTR locus and to measure the extent of CFTR function in the sweat gland and nasal epithelium. RESULTS: Of the 74 patients studied, 29 had two mutations in the CFTR gene, 15 had one mutation, and 30 had no mutations. A final genotype of two mutations was more common among patients who had been referred after screening for common cystic fibrosis-causing mutations identified one mutation than among those who had been referred after screening had identified no such mutations (26 of 34 patients vs. 3 of 40 patients, P<0.001). Comparison of clinical features and sweat chloride concentrations revealed no significant differences among patients with two, one, or no CFTR mutations. Haplotype analysis in the two families revealed no linkage to CFTR. Although each of the affected siblings had elevated sweat chloride concentrations, measurements of cyclic AMP-mediated ion and fluid transport in the sweat gland and nasal epithelium demonstrated the presence of functional CFTR. CONCLUSIONS: Factors other than mutations in the CFTR gene can produce phenotypes clinically indistinguishable from nonclassic cystic fibrosis caused by CFTR dysfunction.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
71 MUTATION IDENTIFIED BY SCREENING FOR COMMON MUTATIONS MUTATION IDENTIFIED BY DNA SEQUENCING NO. OF PATIENTS ∆F508 5T* 3 ∆F508 D1152H 2 ∆F508 2789+2insA 2 ∆F508 R117C 2 ∆F508 D110H 1 ∆F508 2789+5G→A 1 ∆F508 P205S 1 ∆F508 L967S 1 ∆F508 I1027T 1 ∆F508 L206W 1 ∆F508 T1053I and 5T 1 ∆F508 V920M and 5T 1 ∆F508 R1070W 1 ∆F508 D579G 1 ∆F508 P67L 1 ∆F508 2811G→T†‡ 1 G85E F191V† 1 R117H G103X and 5T 1 I148T I556V 1 G542X R1162L 1 W1282X D1152H 1 None L138ins and 3272-26 A→G 1 None G463D† and 5T 1 None F693L and 5T 1 ∆F508 None 6 G551D None 1 W1282X None 1 None 5T 4 None 2307insA 1 None L997F 1 None V520I 1 None None 30 in Subject II-2 in Family 1. Login to comment

[hide] Extensive sequencing of the cystic fibrosis transm... Genet Med. 2003 Jan-Feb;5(1):9-14. Strom CM, Huang D, Chen C, Buller A, Peng M, Quan F, Redman J, Sun W
Extensive sequencing of the cystic fibrosis transmembrane regulator gene: assay validation and unexpected benefits of developing a comprehensive test.
Genet Med. 2003 Jan-Feb;5(1):9-14., [PMID:12544470]

Abstract [show]
PURPOSE: To develop a sequencing assay for the gene to identify mutations in patients with cystic fibrosis (CF). METHODS: An automated assay format was developed to sequence all exons and splice junctional sequences, the promotor region, and parts of introns 11 and 19. RESULTS: After validating the assay using 20 known samples, DNA of seven patients, four of whom were heterozygous for a known CF mutation, was sequenced. Known CF mutations were detected in seven of the eight chromosomes, and a novel missense mutation was detected in the eighth. In addition, this assay allowed 14 ambiguous results obtained using the Roche CF gold strips to be resolved. Three false-positive diagnoses were prevented; a different mutation at the same codon was identified in two patients and confirmation was provided in the remaining nine cases. CONCLUSIONS: Sequencing of the gene provides important information for CF patients and is a valuable adjunct to a carrier screening program to resolve ambiguities in panel testing.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
90 Table 4 Results of sequencing of patient samples Description Prior genotype Sequencing CommentAllele 1 Allele 2 Confirmed CF wt/delta F508 delta F508 P205S Known mutation Confirmed CF wt/3849 ϩ 10 kb 3849 ϩ 10 kb L1077P Known mutation C 3 T C 3 T Confirmed CF wt/delta F508 delta F508 R1066C Known mutation Confirmed CF wt/delta F508 delta F508 D806G Novel missense Confirmed CF wt/wt 3154delG 3154delG Both parents confirmed carriers Confirmed CF delta F508/wt delta F508 G1244E Known mutation Confirmed CF wt/wt wt F191L Novel missense Borderline sweat test wt/wt wt wt Table 5 Resolution of ambiguities on linear array assay using sequencing Linear array result Resolution Weak mutant A455E line 1508 C 3 T (S459F) polymorphism or novel mutation Weak mutant A455E line 1508 C 3 T (S459F) polymorphism or novel mutation Weak mutant A455E line wt/1496 C 3 T (A455V) polymorphism or novel mutation Weak mutant A455E line wt/1496 C 3 T (A455V) polymorphism or novel mutation Weak mutant A455E line wt/1520 G 3 A (G463D) polymorphism or novel mutation No A455E mutant or wt line Homozygous 1499 T 3 C (V456A) polymorphism or novel mutation No A455E mutant or wt line Homozygous 1497 C 3 A polymorphism (no amino acid change) Weak wt 1898 ϩ 1 G 3 A line wt/E587A novel missense mutation or polymorphism Weak 1898 ϩ 1 G 3 A line wt/1898 ϩ 1 G 3 C-different mutation; G 3 C NOT G 3 A DISCUSSION The ACMG recommended panel of CF mutations has rapidly become the standard of care for US carrier screening. Login to comment

[hide] CFTR, PRSS1 and SPINK1 mutations in the developmen... JOP. 2003 Sep;4(5):169-77. Bernardino AL, Guarita DR, Mott CB, Pedroso MR, Machado MC, Laudanna AA, Tani CM, Almeida FL, Zatz M
CFTR, PRSS1 and SPINK1 mutations in the development of pancreatitis in Brazilian patients.
JOP. 2003 Sep;4(5):169-77., [PMID:14526128]

Abstract [show]
CONTEXT: Mutations in cystic fibrosis transmembrane conductance regulator (CFTR), in cationic trypsinogen (PRSS1) and in serine protease inhibitor Kazal type 1 (SPINK1) genes have been associated with chronic pancreatitis (alcohol related, idiopathic and hereditary). However, the inheritance pattern is still not clear. PATIENTS: Eighty-two unrelated Brazilian patients with chronic pancreatitis (alcohol-related disease in 64, idiopathic disease in 16, and hereditary disease in 2). Two hundred unrelated individuals with an ethnic distribution comparable to the patients were studied as controls. MAIN OUTCOME MEASURE: Detection of mutations in CFTR, PRSS1, and SPINK1 genes. RESULTS: Mutations in the CFTR gene were found in 8 patients (9.8%) with chronic pancreatitis, 5 of them with idiopathic disease. Interestingly, the only clinical symptom in a male patient in the alcoholic group, who was a compound heterozygote (DeltaF508/R170C) for two CFTR mutations, was pancreatitis without infertility or pulmonary involvement. In the PRSS1 gene, the E79K change in exon 3 was found in one patient (1.2%) with alcohol-related chronic pancreatitis. Four different alterations were identified in the SPINK1 gene. CONCLUSIONS: Mutations in the CFTR gene represent the major cause of idiopathic chronic pancreatitis in Brazilian patients. No mutation was found in the PRSS1 gene among our patients suggesting further genetic heterogeneity for hereditary and idiopathic chronic pancreatitis. Interestingly, the most frequent SPINK1 N34S mutation was not present in patients or controls. Moreover, the -253C allele for the SPINK1 gene was significantly more frequent in patients than controls (P=0.004), suggesting that it might represent a risk factor for the development of pancreatitis in our population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
68 A total of 13 changes were found: 7 in the CFTR gene (∆F508/R851L, ∆F508/R170C, ∆F508/L206W, 2 N/∆F508, N/P205S, N/R31C and N/V920M), 2 in the PRSS1 gene (E79K and N246N) and 4 in the SPINK1 gene (-253T>C, -164G>C, -7T>G, c75C>T) (Table 1). Login to comment
69 The CFTR Gene Molecular analysis showed that 8 patients (9.8%) had mutations in the CFTR gene: 3 were compound heterozygotes (∆F508/R851L, ∆F508/R170C and ∆F508/L206W) and 5 had mutations on just one allele (2 N/∆F508, N/P205S, N/R31C and N/V920M). Login to comment
70 Among the 16 patients with idiopathic chronic pancreatitis, 5 (31.3%) had mutations in the CFTR gene (∆F508/R851L, ∆F508/L206W, N/∆F508, N/P205S and N/V920M). Login to comment
71 Two of these patients (∆F508/L206W and N/P205S), were found to have congenital absence of the vas deferens in addition to chronic pancreatitis. Login to comment
78 Gene Localization Mutation Polymorphism Frequency in patients' chromosomes Frequency in controls' chromosomes P value Exon 2 R31C 1/164 (0.6%) - - Exon 5 R170C 1/164 (0.6%) - - P205S 1/164 (0.6%) - -Exon 6 L206W 1/164 (0.6%) - - Exon 10 ∆F508 5/164 (3.0%) - - Exon 14a R851L 1/164 (0.6%) - - CFTR Exon 15 V920M 1/164 (0.6%) - - Exon 3 E79K 1/164 (0.6%) 1/300 (0.3%) 1.000a PRSS1 Exon 5 N246N 47/164 (28.7%) 85/300 (28.3%) 1.000b -253T>C 20/164 (12.2%) 20/400 (5.0%) 0.004b Promoter -164G>C 4/164 (2.4%) 13/400 (3.3%) 0.788a Exon 1 -7T>G 5/164 (3.0%) 8/300 (2.7%) 0.777a SPINK1 Exon 2 c75C>T 1/164 (0.6%) 3/300 (1.0%) 1.000a a Fisher's exact test b Yates' corrected chi-squared test alcohol-related chronic pancreatitis, but with no family history. Login to comment
94 Molecular analysis showed that 9.8% of the total group of patients had mutations in the CFTR gene: 3 were compound heterozygotes (∆F508/R851L, ∆F508/R170C and ∆F508/L206W) and 5 had mutations on just one allele (2 N/∆F508, N/P205S, N/R31C and N/V920M). Login to comment
96 Among the 16 patients with idiopathic chronic pancreatitis, 5 had mutations in the CFTR gene (∆F508/R851L, ∆F508/L206W, N/∆F508, N/P205S and N/V920M). Login to comment
97 Two of these patients (∆F508/L206W and N/P205S), were found to have congenital absence of the vas deferens, a condition associated with cystic fibrosis mutations in addition to chronic pancreatitis. Login to comment

[hide] Different CFTR mutational spectrum in alcoholic an... Pancreas. 2004 May;28(4):374-9. Casals T, Aparisi L, Martinez-Costa C, Gimenez J, Ramos MD, Mora J, Diaz J, Boadas J, Estivill X, Farre A
Different CFTR mutational spectrum in alcoholic and idiopathic chronic pancreatitis?
Pancreas. 2004 May;28(4):374-9., [PMID:15097853]

Abstract [show]
OBJECTIVE: Cystic fibrosis transmembrane conductance regulator (CFTR) mutations are responsible for cystic fibrosis (CF) and have been postulated as a predisposing risk factor to chronic pancreatitis (CP), but controversial results demand additional support. We have therefore investigated the role of the CFTR gene in a cohort of 68 CP patients. METHODS: We have performed the CFTR gene analysis using 2 screening techniques. Fragments showing abnormal migration patterns were characterized by sequencing. Patients were classified in alcoholic (ACP) (n = 37) and idiopathic (ICP) (n = 31) chronic pancreatitis. Clinical features of CP and CF were evaluated. RESULTS: Sixteen mutations/variants were identified in 27 patients (40%), most of them (35%) presenting a single CFTR mutant gene. The 1716G/A variant showed the highest frequency accounting for 22% in ICP and 5% in ACP, in contrast with other more common mutations such as F508del found in 8% of ACP and the 5T variant identified in 7% of patients. Acute pancreatitis, abdominal pain, tobacco, pancreatic calcifications, and pancreatic pseudocysts showed significant higher values in ACP than ICP patients. No significant differences were found between patients with and without CFTR mutations. CONCLUSIONS: Apart from reinforcing previous findings our data highlight the increased susceptibility of CFTR heterozygous to developing CP. Heterozygosity, combined with other factors, places these individuals at greater risk.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 Time Years BMI Alcohol Alcohol Time Years Tobacco Pancreatic Features Hepatobiliary Disease CFTR Genotype Sweat Test mmol/L FEV1/FVC % Predicted Male Fertility Alcoholic Chronic Pancreatitis (n = 15) 1 M/52 15 24.5 110g/d 27 yes AP, P, Ps, DM, PI Chronic hepatitisa F508del/S1235R 18 105/107 yes 2 M/72 15 23.4 85g/d 22 yes AP, P, C, PS no F508del/1716G/A 72 90/104 yes 3 M/53 10 21.9 135g/d 20 yes P, C, DM, PI no F508del/- 54 71/89 yes 4 M/64 18 20.7 250g/d 27 yes AP, P, C, Ps, DM, PI cirrhosis, lithiasis W1282X/- 68 71/78 unproved 5 M/44 13 22.0 95g/d 6 yes AP, P, C, Ps, DM, PI lithiasis R170C/- 16 105/111 yes 6 M/62 12 22.1 >60g/d >5 yes AP, P, C, Ps, DM, PS no R258G/- 82 73/82 yes 7 M/38 9 18.0 210g/d 15 yes AP, P, C, Ps, PS no M281T/- 62 132/126 yes 8 M/40 11 - >60g/d >5 yes AP, P, C, Ps, PS lithiasis R297Q/- 46 103/99 yes 9 M/42 2 21.4 150g/d 20 yes AP, P, C, Ps, PS no 1716G/A/- 19 93/102 yes 10 M/44 3 22.2 95g/d 22 yes AP, P, DM, PS no R668C/- 58 105/102 yes 11 M/59 6 21.8 90g/d 18 yes PS lithiasis L997F/- 85 69/84 nd 12 M/72 16 - >60g/d >5 no P, C, DM, PI lithiasis R1162L/- - - yes 13 M/35 8 21.0 90g/d 7 yes AP, P, C, PS no 5T-12TG-V470/- 13 106/114 unproved 14 M/60 14 28.0 80g/d 20 no AP, P, C, Ps, DM, PI no 5T-11TG/- 28 80/77 yes 15 M/65 12 24.4 100g/d 23 yes AP, P, C, DM, PS no 5T-11TG/ 40 86/110 yes Idiopathic Chronic Pancreatitis (n = 12) 16 M/21 5 - no - yes AP, P, PS no 1716G/A/R170H 40 normal yes 17 M/59 4 24.2 no - no PS chronic hepatitisb 1716G/A/- 40 146/128 yes 18 M/63 14 21.4 no - no DM, PI no 1716G/A/- 34 144/126 yes 19 M/70 18 19.9 no - yes AP, P, DM, PI chronic hepatitisa 1716G/A/- 60 36/47 yes 20 M/65 1 27.7 no - yes P, Ps, DM, PI no 1716G/A/- 38 79/78 yes 21 M/76 8 24.1 no - no AP, P, DM, PS no 1716G/A/- 60 81/109 yes 22 M/25 2 25.0 no - yes AP, P, PS no 1716G/A/- 48 94/86 nd 23 F/42 10 22.6 no - yes P, C, PS lithiasis P205S/- 72 111/109 - 24 F/81 21 34.6 no - no P, C, DM, PI lithiasis D443Y+G+R*/- 42 121/108 - 25 F/72 8 23.3 no - yes AP, C, PS no L997F/- 40 100/93 - 26 M/9 2 19.2 no - no AP, P, PS no 5T-11TG/- 30 101/110 nd 27 M/63 6 - no - no C, DM, PI cirrhosis 5T-11TG/- - - yes a C virus hepatitis. Login to comment

[hide] Relation of sweat chloride concentration to severi... Pediatr Pulmonol. 2004 Sep;38(3):204-9. Davis PB, Schluchter MD, Konstan MW
Relation of sweat chloride concentration to severity of lung disease in cystic fibrosis.
Pediatr Pulmonol. 2004 Sep;38(3):204-9., [PMID:15274098]

Abstract [show]
In cystic fibrosis (CF), sweat chloride concentration has been proposed as an index of CFTR function for testing systemic drugs designed to activate mutant CFTR. This suggestion arises from the assumption that greater residual CFTR function should lead to a lower sweat chloride concentration, as well as protection against severe lung disease. This logic gives rise to the hypothesis that the lower the sweat chloride concentration, the less severe the lung disease. In order to test this hypothesis, we studied 230 patients homozygous for the DeltaF508 allele, and 34 patients with at least one allele associated with pancreatic sufficiency, born since January 1, 1955, who have pulmonary function data and sweat chloride concentrations recorded in our CF center database, and no culture positive for B. cepacia. We calculated a severity index for pulmonary disease, using an approach which takes into account all available pulmonary function data as well as the patient's current age and survival status. Patients with alleles associated with pancreatic sufficiency had significantly better survival (P = 0.0083), lower sweat chloride concentration (81.4 +/- 23.8 vs. 103.2 +/- 14.2 mEq/l, P < 0.0001), slower rate of decline of FEV(1) % predicted (-0.75 +/- 0.34 vs. -2.34 +/- 0.17% predicted per year), and a better severity index than patients homozygous for the DeltaF508 allele (median 73rd percentile vs. median 55th percentile, P = 0.0004). However, the sweat chloride concentration did not correlate with the severity index, either in the population as a whole, or in the population of patients with alleles associated with pancreatic sufficiency, who are thought to have some residual CFTR function. These data suggest that, by itself, sweat chloride concentration does not necessarily predict a milder pulmonary course in patients with cystic fibrosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
27 T; G91R; E92K; P205S; G551S; Y563N; and P574H.23,24 Note that there are 36 mild alleles in 34 subjects, because two subjects had both the 3848 þ 10 kb C ! Login to comment

[hide] Characterization of cystic fibrosis conductance tr... Hum Reprod. 2004 Nov;19(11):2502-8. Epub 2004 Aug 27. Grangeia A, Niel F, Carvalho F, Fernandes S, Ardalan A, Girodon E, Silva J, Ferras L, Sousa M, Barros A
Characterization of cystic fibrosis conductance transmembrane regulator gene mutations and IVS8 poly(T) variants in Portuguese patients with congenital absence of the vas deferens.
Hum Reprod. 2004 Nov;19(11):2502-8. Epub 2004 Aug 27., [PMID:15333598]

Abstract [show]
BACKGROUND: Cystic fibrosis conductance transmembrane regulator (CFTR) gene mutations and IVS8 poly(T) variants in Portuguese patients with bilateral (CBAVD) and unilateral (CUAVD) congenital absence of the vas deferens remain to be evaluated. METHODS: Patient screening was carried out by PCR, denaturing gradient gel electrophoresis and DNA sequencing. RESULTS: CFTR mutations were found in 18 out of 31 (58.1%) CBAVD and in three of four (75%) CUAVD patients. The most frequent mutations were F508del and R334W in CBAVD and G542X in CUAVD, with the allelic frequencies of R334W (6.5%) and G542X (25%) being particular to the Portuguese population. The 5T allelic frequency was 3.5% in the fertile male population, 25% in CUAVD and 27.4% in CBAVD patients. The combined frequency of mutations (CFTR+5T) was increased in CBAVD to 22 out of 31 (71%). The frequency of CFTR mutations was compared with that of patients with secondary obstructive azoospermia (OAZ; one out of 16, 6.3%) and non-obstructive azoospermia (NOAZ; two out of 22, 9.1%) with conserved spermatogenesis, which were similar to the general population. However, whereas the 5T allelic frequency in OAZ was similar to that of the general population (3.1%), it was increased in NOAZ cases (14.3%). CONCLUSIONS: Data confirm that CFTR+5T mutations represent the most common genetic abnormality in CAVD, and suggest that cases of NOAZ may be associated with the 5T allele.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
92 The frequency of the other mutations was: four of 62 (6.5%) for R334W, two of 62 (3.2%) for R117H, P205S and G576A, and one of 62 (1.6%) for D614G, V562I, R668C, 2789-5G ! Login to comment
104 Of the 22 NOAZ patients with conserved spermatogenesis and normal renal development, there were seven (31.8%) Table I. CFTR mutations and IVS8-5T variants found in 77 Portuguese azoospermic patients Syndromes Mutations n CFTR mutations IVS8 poly(T) variants Two mutations One mutation CBAVD F508del/R117H 1 1 - 7/9 F508del/D614G 1 1 - 7/9 R334W/R334W 1 1 - 7/7 R334W/V562I 1 1 - 5/7 R117H/P205S 1 1 - 7/7 2789 þ 5G ! Login to comment
105 A/S1235R 1 1 - 5/7 F508del/- 6 - 6 5/9 (£6) I507del/- 1 - 1 7/9 G576A-R668C/- 1 - 1 5/7 P205S/- 1 - 1 5/5 R334W/- 1 - 1 7/7 G576A/- 1 - 1 7/7 3272-26A ! Login to comment
125 Contrary to all other countries, the second most frequent mutation found in Portugal was R334W (6.5%), whereas no differences from other countries were found regarding the third most frequent mutations, R117H, P205S and G576A (3.2%), with the exception of Germany regarding R117H (11%) (Dork et al., 1997). Login to comment

[hide] Identification of novel and rare mutations in Cali... Hum Mutat. 2004 Oct;24(4):353. Alper OM, Wong LJ, Young S, Pearl M, Graham S, Sherwin J, Nussbaum E, Nielson D, Platzker A, Davies Z, Lieberthal A, Chin T, Shay G, Hardy K, Kharrazi M
Identification of novel and rare mutations in California Hispanic and African American cystic fibrosis patients.
Hum Mutat. 2004 Oct;24(4):353., [PMID:15365999]

Abstract [show]
In ethnic heterogeneous California, complete genetic information is currently lacking to build solid population-based cystic fibrosis (CF) screening programs because a large proportion of mutations in the cystic fibrosis transmembrane conductance regulator gene (CFTR/ABCC7) are still unknown, especially in non-Caucasian patients. A total of 402 [46 African American+356 Hispanic] Hispanic and African American patients from California CF patient registry were included in this study. Patients with at least one unidentified mutant allele were asked to donate blood samples for further analysis, first by Genzyme Genetics for a panel of 87 known mutations, followed by temporal temperature gradient gel electrophoresis (TTGE) scanning of the entire coding exons of CFTR gene. A total of eight novel mutations; one missense mutation, one splice-site mutation and six frame-shift mutations were identified. In addition to the eight novel mutations, 20 [corrected] distinct rare mutations that are not in the current available commercial mutation panels were identified by TTGE. The overall detection rate was raised to 95.7% for African American and 94.5% for Hispanic. The discovery of recurrent rare and novel mutations improves the diagnosis and care of persons with CF and improves our ability to adequately and equitably provide screening and genetic counseling services to non-Caucasians.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
73 Mutations Not Included in 87-Mutation Panel Nucleotide change-position Traditional nomenclature Approved nomenclature Protein Mutation/Effect Exon/ Intron Number of chromosomes 136 C>T c.4C>T p.Gln2Ter nonsense mutation 1 1 355 C>T c.223C>T p.Arg75Ter nonsense mutation 3 1 406-1G>A c.274-1G>A splice mutation/ truncation int 3 9 (1 sib) 424 C>T c.292C>T p.Gln98Ter nonsense mutation 4 1 425 A>G c.293A>G p.Gln98Arg missense mutation 4 2 663 del T c.531delT p.Ile177fs frameshift/ truncation 5 2 (sib) 727 C>T c.595C>T p.His199Tyr missense mutation 6a 5 (1 sib) Nucleotide change-position Traditional nomenclature Approved nomenclature Protein Mutation/Effect Exon/ Intron Number of chromosomes 745 C>T c.613C>T p.Pro205Ser missense mutation 6a 4 1248+1G>A c.1116+1G>A splice mutation/ truncation 7 2 (sib) 1461 ins AGAT c.1326_1327ins4 p.Asp443fs frameshift/ truncation 9 1 1529 C>G c.1397C>G p.Ser466Ter nonsense mutation 10 1 1607 C>T c.1475C>T p.Ser492Phe missense mutation 10 3 1924 del 7bp c.1792_1798del7 p.Lys598fs frameshift/ truncation 13 2 (sib) 2055 del 9bp to A c.1923_1931del9 insA p.Ser641fs frameshift/ truncation 13 2 (homo) 2105_2117 del 13bp insAGAAA c.1973_1985del 13insAGAAA p.Arg658fs frameshift/ truncation 13 3 2184 ins A c.2052dupA p.Gln685fs frameshift/ truncation 13 2 (twin) 3272-26A>G c.3140-26A>G splice mutation/ truncation int 17a 4 (3 rel) 3313 G>C c.3181G>C p.Gly1061Arg missense mutation 17b 1 3431 A>C c.3299A>C p.Gln1100Pro missense mutation 17b 1 3743 G>A c.3611G>A p.Trp1204Ter nonsense mutation 19 5 (1 sib, 1 homo) 4382 del A c.4250delA p.E1417fs frameshift/ truncation 24 1 Sib:1 sibling pair; homo:homozygote; 3 rel: 3 relatives. Login to comment

[hide] Misprocessing of the CFTR protein leads to mild cy... Hum Mutat. 2005 Apr;25(4):360-71. Clain J, Lehmann-Che J, Dugueperoux I, Arous N, Girodon E, Legendre M, Goossens M, Edelman A, de Braekeleer M, Teulon J, Fanen P
Misprocessing of the CFTR protein leads to mild cystic fibrosis phenotype.
Hum Mutat. 2005 Apr;25(4):360-71., [PMID:15776432]

Abstract [show]
Cystic fibrosis (CF) is mainly caused by mutations that interfere with the biosynthetic folding of the cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel. The aim of this study was to determine the mechanism of dysfunction of a disease-causing mutation associated with variable phenotypes. In order to attain these objectives, we studied the effect of the p.L206W mutation on CFTR protein production and function, and we examined the genotype-phenotype correlation of [p.L206W]+[p.F508del] patients. We showed that p.L206W is a processing (class II) mutation since the CFTR biosynthetic pathway was severely impaired, whereas single-channel measurements indicated ion conductance similar to the wild-type protein. These data raise the larger question of the phenotypic variability of class II mutants, including p.F508del. Since multiple potential partners could modify the processing of the CFTR protein during its course to the cell surface, environmental and other genetic factors might contribute to this variability.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
250 Interestingly, the disease-causing mutation p.P205S, flanking p.L206W in the middle of the TM3, produced nearly no detectable mature protein [Sheppard et al., 1996]. Login to comment
275 Unexpectedly, the mechanism of dysfunction of p.L206W resembles that of p.G85E and p.P205S, which are misprocessed without altering ion conductance [Sheppard et al., 1996; Xiong et al., 1997]. Login to comment

[hide] Pharmacological induction of CFTR function in pati... Pediatr Pulmonol. 2005 Sep;40(3):183-96. Kerem E
Pharmacological induction of CFTR function in patients with cystic fibrosis: mutation-specific therapy.
Pediatr Pulmonol. 2005 Sep;40(3):183-96., [PMID:15880796]

Abstract [show]
CFTR mutations cause defects of CFTR protein production and function by different molecular mechanisms. Mutations can be classified according to the mechanisms by which they disrupt CFTR function. This understanding of the different molecular mechanisms of CFTR dysfunction provides the scientific basis for the development of targeted drugs for mutation-specific therapy of cystic fibrosis (CF). Class I mutations are nonsense mutations that result in the presence of a premature stop codon that leads to the production of unstable mRNA, or the release from the ribosome of a short, truncated protein that is not functional. Aminoglycoside antibiotics can suppress premature termination codons by disrupting translational fidelity and allowing the incorporation of an amino acid, thus permitting translation to continue to the normal termination of the transcript. Class II mutations cause impairment of CFTR processing and folding in the Golgi. As a result, the mutant CFTR is retained in the endoplasmic reticulum (ER) and eventually targeted for degradation by the quality control mechanisms. Chemical and molecular chaperones such as sodium-4-phenylbutyrate can stabilize protein structure, and allow it to escape from degradation in the ER and be transported to the cell membrane. Class III mutations disrupt the function of the regulatory domain. CFTR is resistant to phosphorylation or adenosine tri-phosphate (ATP) binding. CFTR activators such as alkylxanthines (CPX) and the flavonoid genistein can overcome affected ATP binding through direct binding to a nucleotide binding fold. In patients carrying class IV mutations, phosphorylation of CFTR results in reduced chloride transport. Increases in the overall cell surface content of these mutants might overcome the relative reduction in conductance. Alternatively, restoring native chloride pore characteristics pharmacologically might be effective. Activators of CFTR at the plasma membrane may function by promoting CFTR phosphorylation, by blocking CFTR dephosphorylation, by interacting directly with CFTR, and/or by modulation of CFTR protein-protein interactions. Class V mutations affect the splicing machinery and generate both aberrantly and correctly spliced transcripts, the levels of which vary among different patients and among different organs of the same patient. Splicing factors that promote exon inclusion or factors that promote exon skipping can promote increases of correctly spliced transcripts, depending on the molecular defect. Inconsistent results were reported regarding the required level of corrected or mutated CFTR that had to be reached in order to achieve normal function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 C-D565G II DF508 D1507 S549R S549I S549N S549R S945D S945L H1054D G1061R L1065P R1066C R1066M L1077P H1085R N1303K G85E III G551D S492F V520F R553G R560T R560S Y569D IV R117H, R117C, R117P, R117L D1152H, L88S, G91R, E92K, Q98R, P205S, L206W, L227R, F311L, G314E, R334W, R334Q, I336K, T338I, L346P, R347C, R347H, R347L, R347P, L927P, R1070W, R1070Q V 3849 þ 10 kb C ! Login to comment

[hide] Genotype-phenotype correlation for pulmonary funct... Thorax. 2005 Jul;60(7):558-63. de Gracia J, Mata F, Alvarez A, Casals T, Gatner S, Vendrell M, de la Rosa D, Guarner L, Hermosilla E
Genotype-phenotype correlation for pulmonary function in cystic fibrosis.
Thorax. 2005 Jul;60(7):558-63., [PMID:15994263]

Abstract [show]
BACKGROUND: Since the CFTR gene was cloned, more than 1000 mutations have been identified. To date, a clear relationship has not been established between genotype and the progression of lung damage. A study was undertaken of the relationship between genotype, progression of lung disease, and survival in adult patients with cystic fibrosis (CF). METHODS: A prospective cohort of adult patients with CF and two CFTR mutations followed up in an adult cystic fibrosis unit was analysed. Patients were classified according to functional effects of classes of CFTR mutations and were grouped based on the CFTR molecular position on the epithelial cell surface (I-II/I-II, I-II/III-V). Spirometric values, progression of lung disease, probability of survival, and clinical characteristics were analysed between groups. RESULTS: Seventy four patients were included in the study. Patients with genotype I-II/I-II had significantly lower current spirometric values (p < 0.001), greater loss of pulmonary function (p < 0.04), a higher proportion of end-stage lung disease (p < 0.001), a higher risk of suffering from moderate to severe lung disease (odds ratio 7.12 (95% CI 1.3 to 40.5)) and a lower probability of survival than patients with genotype I-II/III, I-II/IV and I-II/V (p < 0.001). CONCLUSIONS: The presence of class I or II mutations on both chromosomes is associated with worse respiratory disease and a lower probability of survival.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
209 To study the decline in pulmonary function between groups the ANOVA method (repeated measures) was used with baseline and current spirometric values as dependent variables, genotype groups as the independent variable, and age and evolution time as Table 1 CFTR mutation according to functional classification Class Molecular dysfunction Mutation I Defective protein production G542X, 711+1GRT, 1609delCA, R1162X, 1717-8GRA, W1282X, 1782delA, Q890X, 1898+3ARG, CFTRdele19, 936delTA II Defective protein processing F508del, N1303K, I507del, R1066C III Defective protein regulation D1270N, G551D IV Defective protein conductance L206W, R334W, R117H, R347H, D836Y, P205S V Partially defective production or processing 2789+5GRA, 1811+1.6kbARG, 3849+10kbCRT, 3272+26GRA Table 2 Groups based on genotype in CF adult patients Functional classes Genotype No of subjects I-I G542X/W1282X 1 R1162X/1898+3ARG 1 R1162X/CFTRdele19 1 I-II F508del/G542X 5 F508del/711+1GRT 2 F508del/1717-8GRA 1 F508del/936delTA 1 F508del/R1162X 1 N1303K/1609delCA 1 I-III G542X/D1270N+R74W 1 711+1G-T/G551D 1 I-IV G542X/P205S 1 Q890X/R334W 1 1609delCA/R347H 1 I-V G542X/2789+5GRT 2 G542X/1811+1.6kbARG 1 1782delA/2789+5GRA 1 1609delCA/1811+1.6kbARG 1 II-II F508del/F508del 21 F508del/N1303K 1 F508del/R1066C 1 II-III F508del/D1270N+R74W 1 I507del/D1270N+R74W 1 II-IV F508del/L206W 4 F508del/R334W 3 F508del/R117H 3 F08del/R347H 2 F508del/D836Y 1 II-V F508del/2789+5GRA 5 F508del/3849+10kbCRT 2 F508del/1811+1.6kbARG 2 F508del/3272+26GRA 1 N1303K/1811+1.6kbARG 1 N1303K/2789+5GRA 1 adjusted variables. Login to comment

[hide] Polymorphic markers suggest a gene flow of CFTR ge... J Hered. 2006 Jul-Aug;97(4):313-7. Epub 2006 Jul 12. Cabello GM, Cabello PH, Llerena JC Jr, Fernandes O
Polymorphic markers suggest a gene flow of CFTR gene from Sub-Saharan/Arabian and Mediterranean to Brazilian Population.
J Hered. 2006 Jul-Aug;97(4):313-7. Epub 2006 Jul 12., [PMID:16837565]

Abstract [show]
The analysis of 2 diallelic loci (M470V and T854T) and a microsatellite IVS8(T)n of the cystic fibrosis transmembrane conductance regulator (CFTR) gene has shown different haplotype distribution in Brazilian cystic fibrosis (CF) chromosomes carrying different CF mutations. The DeltaF508 mutation was in absolute linkage disequilibrium with 1-1 haplotype (M470V-T854T). Most of DeltaF508 chromosomes (84%) were found to carry the IVS8-9T. The most frequent haplotypes IVS8-7T and 2-1 (M470V-T854T) were found associated with Non-DeltaF508 mutations. Although there is a remarkable linkage disequilibrium between these markers with CFTR locus, the mutations R334W (7T-1-2 and 7T-2-1) and the 3120 + 1G --> A (7T-1-2 and 9T-1-2) are associated with two different haplotypes probably introduced in the Brazilian population by migration. These findings suggest that recombination events from the original haplotype and gene flow among different ethnic groups (sub-Saharan and Mediterranean) might have resulted in CF mutations associated with different haplotypes by independent introductions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
23 A previous screening of the whole coding region and flanking intronic sequences from the 23 exons of the CFTR gene in 190 chromosomes allowed us to identify 11 different mutations: DF508 (28.4%), G85E (4.7%), 3120 þ 1G / A (3.7%), R334W (2.6%), G542X (2.1%), P205S (1.0%), G551D (0.5%), R1162X (0.5%), Y1092X (0.5%), S549R (0.5%), and S4X (0.5%) (Cabello GMK, Cabello PH, Otsuki, and others 2005). Login to comment

[hide] Molecular characterization of the cystic fibrosis ... Genet Med. 2007 Mar;9(3):163-72. Grangeia A, Sa R, Carvalho F, Martin J, Girodon E, Silva J, Ferraz L, Barros A, Sousa M
Molecular characterization of the cystic fibrosis transmembrane conductance regulator gene in congenital absence of the vas deferens.
Genet Med. 2007 Mar;9(3):163-72., [PMID:17413420]

Abstract [show]
PURPOSE: Approximately 20% of patients with congenital absence of the vas deferens remain without two mutations identified. We applied a strategy of serial screening steps to 45 patients with congenital absence of the vas deferens and characterized cystic fibrosis transmembrane conductance regulator gene mutations in all cases. METHODS: DNA samples of 45 patients with congenital absence of the vas deferens were screened by successive different molecular genetics approaches. RESULTS: Initial screening for the 31 most frequent cystic fibrosis mutations, IVS8 poly(TG)m, poly(T)n, and M470V polymorphisms, identified 8 different mutations in 40 patients (88.9%). Extensive cystic fibrosis transmembrane conductance regulator gene analysis by denaturing gradient gel electrophoresis, denaturing high-performance liquid chromatography, and DNA sequencing detected 17 further mutations, of which three were novel. Cystic fibrosis transmembrane conductance regulator gene rearrangements were searched by semiquantitative fluorescent multiplex polymerase chain reaction, which detected a CFTRdele2,3 (21 kb) large deletion and confirmed two homozygous mutations. Overall, 42 patients (93.3%) had two mutations and 3 patients (6.7%) had one mutation detected. CONCLUSIONS: The present screening strategy allowed a higher mutation detection rate than previous studies, with at least one cystic fibrosis transmembrane conductance regulator gene mutation found in all patients with congenital absence of the vas deferens.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
93 DeltaF508 was the second most common mutation, representing 21 (23.3%) of total alleles, followed by R334W (6, Table 1 CFTR gene mutations and polymorphisms in patients with congenital absence of the vas deferens Mutation Location Nucleotide alteration Effect Method 1 CFTRdele2,3 Exons 2-3 Deletion of exons 2 and 3 Frameshift QFM-PCR 2 R117H Exon 4 G¡A at 482 AA substitution 31 mutation panel 3 P205S Exon 6a C¡T at 745 AA substitution DGGE/dHPLC 4 L206W Exon 6a T¡G at 749 AA substitution DGGE/dHPLC 5 R258G Exon 6b A¡G at 904 AA substitution DGGE/dHPLC 6 R334W Exon 7 C¡T at 1132 AA substitution 31 mutation panel 7 T5 allele Intron 8 Deletion of 2T at 1342-12 to -6 Aberrant splicing DGGE/DNA sequencing 8 P439S Exon 9 C¡T at 1447 AA substitution DGGE/dHPLC 9 D443Ya Exon 9 G¡T at 1459 AA substitution DGGE/dHPLC 10 I507del Exon 10 Deletion of 3 bp at 1648-1653 AA deletion 31 mutation panel 11 DeltaF508 Exon 10 Deletion of 3 bp at 1652-1655 AA deletion 31 mutation panel 12 G542X Exon 11 G¡T at 1756 Truncation 31 mutation panel 13 V562I Exon 12 G¡A at 1816 AA substitution DGGE/dHPLC 14 G576Aa Exon 12 G¡C at 1859 Aberrant splicing DGGE/dHPLC 15 D614G Exon 13 A¡G at 1973 AA substitution DGGE/dHPLC 16 R688Ca Exon 13 C¡T at 2134 AA substitution DGGE/dHPLC 17 V754M Exon 13 G¡A at 2392 AA substitution DGGE/dHPLC 18 E831X Exon 14a G¡T at 2623 Truncation DGGE/dHPLC 19 3272-26AϾG Intron 17a A¡G at 3272-26 Aberrant splicing DGGE/dHPLC 20 2789ϩ5G¡A Intron 14b G¡A at 2789ϩ5 Aberrant splicing 31 mutation panel 21 V1108L Exon 17b G¡C at 3454 AA substitution DGGE/dHPLC 22 L1227S Exon 19 T¡C at 3812 AA substitution DGGE/dHPLC 23 S1235R Exon 19 T¡G at 3837 AA substitution DGGE/dHPLC 24 P1290S Exon 20 C¡T at 4000 AA substitution DGGE/dHPLC 25 N1303K Exon 21 C¡G at 4041 AA substitution 31 mutation panel 26 E1401K Exon 23 G¡A at 4333 AA substitution DGGE/dHPLC Polymorphisms 1 TG repeats Intron 8 9-13 copies at 1342-12 to -35 Sequence variation DGGE/DNA sequencing 2 M470V Exon 10 A or G at 1540 Sequence variation DNA sequencing 3 125G/C Exon 1 G¡C at 125 Sequence variation DGGE/dHPLC 4 1001ϩ11T/C Intron 6b C¡4T at 1001ϩ11 Sequence variation DGGE/dHPLC 5 1716G/A Exon 10 G¡A at 1716 Sequence variation DGGE/dHPLC 6 1899-136T/G Intron 12 T¡G at 1899-136 Sequence variation DGGE/dHPLC 7 T854T Exon 14a T¡G at 2694 Sequence variation DGGE/dHPLC 8 3601-65C/A Intron 18 C¡A at 3601-65 Sequence variation DGGE/dHPLC 9 4521G/A Exon 24 G¡A at 4521 Sequence variation DGGE/dHPLC QFM-PCR, semiquantitative fluorescent multiplex polymerase chain reaction; bp, base pair; DGGE, denaturing gradient gel electrophoresis; dHPLC, denaturing high-performance liquid chromatography. Login to comment
97 The allelic frequency of the other mutations was 4.4% for R117H, G576A, and R668C, 3.3% for S1235R and 3272-26A¡G, and 2.2% for P205S, L206W, D443Y, G542X, D614G, and N1301K, whereas the remaining 12 mutations were present in single patients (Table 3). Login to comment
101 The missense M470V polymorphism was evaluated in all 45 pa- tientswithCAVD(Table2).TheallelicfrequencyoftheM470variant Table 2 CFTR genotypes identified in patients with congenital absence of the vas deferens CFTR mutation genotypes [(TG)mTn] genotype M470V Patients N % DeltaF508 (TG)10T9 (TG)12T5 M V 11 24.4 DeltaF508 (TG)10T9 (TG)11T5 M M 1 2.2 DeltaF508 R117H (TG)10T9 (TG)10T7 M M 2 4.4 G542X (TG)10T9 (TG)12T5 M V 2a 4.4 DeltaF508 R334W (TG)10T9 (TG)11T7 M V 1 2.2 DeltaF508 D443Y-G576A-R668C (TG)10T9 (TG)10T7 M M 1 2.2 DeltaF508 D614G (TG)10T9 (TG)11T7 M V 1 2.2 DeltaF508 E831X (TG)10T9 (TG)11T7 M V 1 2.2 DeltaF508 L1227S (TG)10T9 (TG)11T7 M M 1 2.2 DeltaF508 E1401K (TG)10T9 (TG)11T7 M V 1 2.2 I507del D614G (TG)11T7 (TG)10T7 M V 1 2.2 N1303K L206W (TG)10T9 (TG)9T9 M M 1 2.2 R117H P205S (TG)11T7 (TG)10T7 M V 1 2.2 R117H R334W (TG)10T7 (TG)11T7 M V 1 2.2 R334W P439S (TG)11T7 (TG)11T7 M V 1 2.2 R334W R334Wb (TG)11T7 (TG)11T7 V V 1 2.2 R334W V562I (TG)11T7 (TG)11T5 V M 1 2.2 D443Y-G576A-R668C 3272-26A¡G (TG)10T7 (TG)10T7 M M 1 2.2 G576A-R668C V754Mb (TG)10T7 (TG)11T7 M M 1 2.2 S1235R S1235Rb (TG)13T5 (TG)13T5 M M 1 2.2 2789ϩ5G¡A S1235Rb (TG)10T7 (TG)13T5 M M 1 2.2 3272-26A¡G P1290S (TG)11T7 (TG)10T7 M V 1 2.2 P205S (TG)11T7 (TG)12T5 V V 1 2.2 G576A-R668C b (TG)10T7 (TG)11T5 M M 1 2.2 V1108L b (TG)11T7 (TG)11T5 V M 1 2.2 N1303K (TG)10T9 (TG)12T5 M V 1 2.2 3272-26A¡G b (TG)10T7 (TG)12T5 M V 1 2.2 CFTRdele2,3 b (TG)11T7 (TG)13T5 V M 1 2.2 b (TG)11T5 (TG)12T5 M V 1 2.2 b (TG)13T5 (TG)12T5 M V 1 2.2 DeltaF508 - (TG)10T9 (TG)11T7 M V 1a 2.2 L206W -b (TG)9T9 (TG)11T7 M V 1 2.2 R258G -b (TG)11T7 (TG)11T7 V V 1 2.2 a CUAVD. Login to comment
110 Large Table 3 Allelic frequencies of CFTR mutations in patients with congenital absence of the vas deferens CBAVD CUAVD Total Patients 42 3 45 Alleles 84 6 90 Mutations N % N % N % 1 T5 allele 26a 31 2 33.3 28 31.1 2 DeltaF508 20 23.8 1 16.7 21 23.3 3 R334W 6a 7.1 0 0 6 6.7 4 R117H 4 4.8 0 0 4 4.4 5 G576A 4b 4.8 0 0 4 4.4 6 R688C 4b 4.8 0 0 4 4.4 7 S1235R 3a 3.6 0 0 3 3.3 8 3272-26A¡G 3 3.6 0 0 3 3.3 9 P205S 2 2.4 0 0 2 2.2 10 L206W 2 2.4 0 0 2 2.2 11 D443Y 2b 2.4 0 0 2 2.2 13 D614G 2 2.4 0 0 2 2.2 14 N1303K 2 2.4 0 0 2 2.2 12 G542X 0 0 2 33.3 2 2.2 15 R258G 1 1.2 0 0 1 1.1 16 P439S 1 1.2 0 0 1 1.1 17 I507del 1 1.2 0 0 1 1.1 18 V562I 1 1.2 0 0 1 1.1 19 V754M 1 1.2 0 0 1 1.1 20 E831X 1 1.2 0 0 1 1.1 21 2789ϩ5G¡A 1 1.2 0 0 1 1.1 22 V1108L 1 1.2 0 0 1 1.1 23 L1227S 1 1.2 0 0 1 1.1 24 P1290S 1 1.2 0 0 1 1.1 25 E1401K 1 1.2 0 0 1 1.1 26 CFTRdele2,3 1 1.2 0 0 1 1.1 CBAVD, congenital bilateral absence of the vas deferens; CUAVD, congenital unilateral absence of the vas deferens. Login to comment

[hide] N-terminal CFTR missense variants severely affect ... Hum Mutat. 2008 May;29(5):738-49. Gene GG, Llobet A, Larriba S, de Semir D, Martinez I, Escalada A, Solsona C, Casals T, Aran JM
N-terminal CFTR missense variants severely affect the behavior of the CFTR chloride channel.
Hum Mutat. 2008 May;29(5):738-49., [PMID:18306312]

Abstract [show]
Over 1,500 cystic fibrosis transmembrane conductance regulator (CFTR) gene sequence variations have been identified in patients with cystic fibrosis (CF) and related disorders involving an impaired function of the CFTR chloride channel. However, detailed structure-function analyses have only been established for a few of them. This study aimed evaluating the impact of eight N-terminus CFTR natural missense changes on channel behavior. By site-directed mutagenesis, we generated four CFTR variants in the N-terminal cytoplasmic tail (p.P5L, p.S50P, p.E60K, and p.R75Q) and four in the first transmembrane segment of membrane-spanning domain 1 (p.G85E/V, p.Y89C, and p.E92K). Immunoblot analysis revealed that p.S50P, p.E60K, p.G85E/V, and p.E92K produced only core-glycosylated proteins. Immunofluorescence and whole cell patch-clamp confirmed intracellular retention, thus reflecting a defect of CFTR folding and/or trafficking. In contrast, both p.R75Q and p.Y89C had a glycosylation pattern and a subcellular distribution comparable to the wild-type CFTR, while the percentage of mature p.P5L was considerably reduced, suggesting a major biogenesis flaw on this channel. Nevertheless, whole-cell chloride currents were recorded for all three variants. Single-channel patch-clamp analyses revealed that the channel activity of p.R75Q appeared similar to that of the wild-type CFTR, while both p.P5L and p.Y89C channels displayed abnormal gating. Overall, our results predict a major impact of the CFTR missense variants analyzed, except p.R75Q, on the CF phenotype and highlight the importance of the CFTR N-terminus on channel physiology.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
133 Genotype^Phenotype Correlation in the N-Terminal CFTR MissenseVariants Under StudyÃ Missense varianta Phenotype Second allele (number of patients)b p.P5L CF p.F508del (1), p.P205S (1) p.S50P CBAVD p.F508del (1), p.E115del (1) p.E60K CF p.G542X (1), p.I507del (1) p.R75Q HT p.F508del (3), p.E725K (1) B p.R347H (1), p.R75Q (1), n.i. (4) Br c.1584G4A (2), c.1210-7_1210-6delTT (1), n.i.(3) NT p.F508del (1) CP c.1584G4A (1), n.i. (3) MI n.i. (1) CUAVD n.i. (2) OZ n.i. (2) Normal p.R75Q (1), c.2052_2053insA (1), n.i. (1) p.G85E CF p.F508del (8), p.G542X (2), p.I507del (1), c.580-1G4T (1), p.G85E (1), c.1477_ 1478delCA (1) CBAVD p.G576A (1) HT p.L997F (1),WT (1) p.G85V CF p.F508del (2), p.G542X (2), p.Y1092X (1), c.265715G4A (1), p.A1006E, c.1210-7_1210- 6delTT (1), n.i. (1) p.Y89C CF n.i. (1)c p.E92K CF p.F508del (2), p.Q890X (1), p.L206W (1) CBAVD c.1210-7_1210-6delTT (1) ÃThe recommendations for mutation nomenclature (www.hgvs.org/mutnomen/) were used to name CFTR gene sequence variations at both the nucleotide level and the protein level. Login to comment

[hide] Detergent binding explains anomalous SDS-PAGE migr... Proc Natl Acad Sci U S A. 2009 Feb 10;106(6):1760-5. Epub 2009 Jan 30. Rath A, Glibowicka M, Nadeau VG, Chen G, Deber CM
Detergent binding explains anomalous SDS-PAGE migration of membrane proteins.
Proc Natl Acad Sci U S A. 2009 Feb 10;106(6):1760-5. Epub 2009 Jan 30., 2009-02-10 [PMID:19181854]

Abstract [show]
Migration on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) that does not correlate with formula molecular weights, termed "gel shifting," appears to be common for membrane proteins but has yet to be conclusively explained. In the present work, we investigate the anomalous gel mobility of helical membrane proteins using a library of wild-type and mutant helix-loop-helix ("hairpin") sequences derived from transmembrane segments 3 and 4 of the human cystic fibrosis transmembrane conductance regulator (CFTR), including disease-phenotypic residue substitutions. We find that these hairpins migrate at rates of -10% to +30% vs. their actual formula weights on SDS-PAGE and load detergent at ratios ranging from 3.4-10 g SDS/g protein. We additionally demonstrate that mutant gel shifts strongly correlate with changes in hairpin SDS loading capacity (R(2) = 0.8), and with hairpin helicity (R(2) = 0.9), indicating that gel shift behavior originates in altered detergent binding. In some cases, this differential solvation by SDS may result from replacing protein-detergent contacts with protein-protein contacts, implying that detergent binding and folding are intimately linked. The CF-phenotypic V232D mutant included in our library may thus disrupt CFTR function via altered protein-lipid interactions. The observed interdependence between hairpin migration, SDS aggregation number, and conformation additionally suggests that detergent binding may provide a rapid and economical screen for identifying membrane proteins with robust tertiary and/or quaternary structures.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
24 We find that gel shifts strongly correlate (R2 ϭ 0.8) with changes in the SDS-loading capacity of these miniature membrane proteins, indicating that altered detergent binding explains anomalous SDS-PAGE behavior. Our results reveal a distinction between two CF-phenotypic mutants studied: V232D binds significantly less SDS than the WT protein while P205S SDS binding is indistinguishable from WT, indicating that CFTR dysfunction may arise variously as a consequence of altered protein-lipid interactions or via altered intra-protein contacts. Login to comment
42 We noted that certain hairpins ran as more diffuse bands than others (e.g., P205S and Q220W vs. V232K and E217V, see Fig. 1B). Login to comment
62 V232D, V232A, P205S, and Q220W) migrated as WT within statistical significance; 2 were faster (V232D and V232K); and 4 were slower (G228L, E217V, E217F, and E217S/S222E). Login to comment
155 On the other hand, the as-WT stoichiometry of the P205S protein-SDS complex suggests that this lesion could disrupt CFTR folding and/or dynamics by directly altering protein-protein interactions while maintaining native protein-lipid contacts. Login to comment

[hide] Association of cystic fibrosis genetic modifiers w... Fertil Steril. 2010 Nov;94(6):2122-7. Epub 2010 Jan 25. Havasi V, Rowe SM, Kolettis PN, Dayangac D, Sahin A, Grangeia A, Carvalho F, Barros A, Sousa M, Bassas L, Casals T, Sorscher EJ
Association of cystic fibrosis genetic modifiers with congenital bilateral absence of the vas deferens.
Fertil Steril. 2010 Nov;94(6):2122-7. Epub 2010 Jan 25., [PMID:20100616]

Abstract [show]
OBJECTIVE: To investigate whether genetic modifiers of cystic fibrosis (CF) lung disease also predispose to congenital bilateral absence of the vas deferens (CBAVD) in association with cystic fibrosis transmembrane conductance regulator (CFTR) mutations. We tested the hypothesis that polymorphisms of transforming growth factor (TGF)-beta1 (rs 1982073, rs 1800471) and endothelin receptor type A (EDNRA) (rs 5335, rs 1801708) are associated with the CBAVD phenotype. DESIGN: Genotyping of subjects with clinical CBAVD. SETTING: Outpatient and hospital-based clinical evaluation. PATIENT(S): DNA samples from 80 subjects with CBAVD and 51 healthy male controls from various regions of Europe. This is one of the largest genetic studies of this disease to date. INTERVENTION(S): None. MAIN OUTCOME MEASURE(S): Genotype analysis. RESULT(S): For single nucleotide polymorphism (SNP) rs 5335, we found increased frequency of the CC genotype among subjects with CBAVD. The difference was significant among Turkish patients versus controls (45.2% vs. 19.4%), and between all cases versus controls (36% vs. 15.7%). No associations between CBAVD penetrance and polymorphisms rs 1982073, rs 1800471, or rs 1801708 were observed. CONCLUSION(S): Our findings indicate that endothelin receptor type A polymorphism rs 5335 may be associated with CBAVD penetrance. To our knowledge, this is the first study to investigate genetic modifiers relevant to CBAVD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
68 Portuguese CFTR alleles Spanish CFTR alleles Turkish CFTR alleles 5T 22 F508del 11 5T 20 F508del 14 5T 9 D1152H 14 R334W 5 D443Ya 3 D110H 3 R117H 3 G576Aa 3 F508del 2 S1235R 3 R668Ca 3 3041-11del7 2 N1303K 2 G542X 2 1767del6 2 P205S 2 R117H 2 2789þ5G>A 2 D614G 2 V232D 2 CFTRdele2(ins186) 2 G542X 1 L997F 1 3120þ1G>A 1 L206W 1 H609R 1 G1130A 1 V562I 1 N1303H 1 M952I 1 I507del 1 L206W 1 365insT 1 3272-26A>G 1 3272-26A/G 1 E585X 1 2789þ5G>A 1 L15P 1 2752-15C>G 1 G576Aa 1 R347H 1 R334Q 1 R668Ca 1 2689insG 1 R347H 1 CFTRdele2,3 1 R1070W 1 E831X 1 L1227S 1 I 1027T 1 R1070W 1 E831X 1 3272-26A>G 1 L997F 1 I853F 1 A349V 1 6T 1 Note: CFTR ¼ cystic fibrosis transmembrane conductance regulator. Login to comment

[hide] CFTR transcription defects in pancreatic sufficien... J Med Genet. 2011 Apr;48(4):235-41. Epub 2010 Nov 20. Sheridan MB, Hefferon TW, Wang N, Merlo C, Milla C, Borowitz D, Green ED, Mogayzel PJ Jr, Cutting GR
CFTR transcription defects in pancreatic sufficient cystic fibrosis patients with only one mutation in the coding region of CFTR.
J Med Genet. 2011 Apr;48(4):235-41. Epub 2010 Nov 20., [PMID:21097845]

Abstract [show]
BACKGROUND: Patients with cystic fibrosis (CF) manifest a multisystem disease due to deleterious mutations in each gene encoding the cystic fibrosis transmembrane conductance regulator (CFTR). However, the role of dysfunctional CFTR is uncertain in individuals with mild forms of CF (ie, pancreatic sufficiency) and mutation in only one CFTR gene. METHODS: Eleven pancreatic sufficient (PS) CF patients with only one CFTR mutation identified after mutation screening (three patients), mutation scanning (four patients) or DNA sequencing (four patients) were studied. Bi-directional sequencing of the coding region of CFTR was performed in patients who had mutation screening or scanning. If a second CFTR mutation was not identified, CFTR mRNA transcripts from nasal epithelial cells were analysed to determine if any PS-CF patients harboured a second CFTR mutation that altered RNA expression. RESULTS: Sequencing of the coding regions of CFTR identified a second deleterious mutation in five of the seven patients who previously had mutation screening or mutation scanning. Five of the remaining six patients with only one deleterious mutation identified in the coding region of one CFTR gene had a pathologic reduction in the amount of RNA transcribed from their other CFTR gene (8.4-16% of wild type). CONCLUSIONS: These results show that sequencing of the coding region of CFTR followed by analysis of CFTR transcription could be a useful diagnostic approach to confirm that patients with mild forms of CF harbour deleterious alterations in both CFTR genes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
61 To detect these transcripts, we amplified Table 1 CFTR genotypes and clinical characteristics of patients with one CFTR mutation after CFTR screening or scanning ID Sweat [ClL ]* FEV1 y Pseudomonas infection NPD CBAVD CFTR genotype upon entry to study (method) CFTR genotype after sequencing 1 52 57 Yes ND ND DF508/unknown, IVS8 5T/9T (c.1210-12T[5]/c.1210-12T[9]) (comprehensive scan) DF508/IVS8-TG12-5T 2 98 79 No CF Yes DF508/unknown (comprehensive scan) DF508/S492F [p.Ser492Phe] 3 89 62 No ND NA DF508/unknown (screened e 86 mutations) DF508/P205S [p.Pro205Ser] 4z 65 58 Yes ND NA R553X/unknown (screened e 86 mutations) R553X/711+3 A/G 5z 66 82 Yes ND Yes R553X/unknown (screened e 70 mutations) R553X/711+3 A/G 6 72 71 Yes CF No DF508/unknown{ DF508/unknownyy 7 59 106 Yes Abnormalx NA DF508/unknown{ DF508/unknownyy 8 37 85 No CF NA DF508/unknown{ DF508/unknownyy 9 40 112 No ND ND DF508/unknown (comprehensive scan) DF508/unknown 10 66 ND Yes ND ND 621+1G/T/unknown (comprehensive scan) 621+1G/T/ unknownyy 11 58 ND No ND ND NA** R764X/unknownyy *Sweat [ClÀ ] concentration is expressed as mmol/l. Login to comment
87 A Splicing of RNA from CFTR gene with R553X: Genomic DNA Transcript including exon 5 and R553X GTA R553X R553X (R553X) Splicing of RNA from CFTR gene with 711+3 A>G: Transcript missing exon 5 (90 bp)Transcript including exon 5 GTG (Exon 5+) (Exon 5-) 4 5 6b6a 11 6a 6b54 11 Genomic DNA4 5 6b6a 11 6a 6b54 11 6a 6b4 11 B PeakHeight Exon 5-Exon 5+ /R553X including exon 5 390bp missing exon 5 300bp Table 2 Functional consequences of CFTR mutations identified after CFTR sequencing ID Second CFTR mutation identified after sequencing Amino acid conservation* Functional consequence References 1 TG12-5T NA Missplicingeloss of exon 9 from CFTR transcript Cuppens et al 199835 Groman et al 200436 2 S492F Conserved in mammalian orthologues except platypus None described Ferec et al31 Wine et al 200139 3 P205S Conserved in mammalian orthologues Defective biosynthesis, decreased amount of fully glycosylated CFTR Sheppard et al 199634 4, 5 711+3 A/G NA Missplicingeloss of exon 5 from CFTR transcript This study (figure 2) *Sequences were obtained from GenBank. Login to comment
63 To detect these transcripts, we amplified Table 1 CFTR genotypes and clinical characteristics of patients with one CFTR mutation after CFTR screening or scanning ID Sweat [ClL ]* FEV1 y Pseudomonas infection NPD CBAVD CFTR genotype upon entry to study (method) CFTR genotype after sequencing 1 52 57 Yes ND ND DF508/unknown, IVS8 5T/9T (c.1210-12T[5]/c.1210-12T[9]) (comprehensive scan) DF508/IVS8-TG12-5T 2 98 79 No CF Yes DF508/unknown (comprehensive scan) DF508/S492F [p.Ser492Phe] 3 89 62 No ND NA DF508/unknown (screened e 86 mutations) DF508/P205S [p.Pro205Ser] 4z 65 58 Yes ND NA R553X/unknown (screened e 86 mutations) R553X/711+3 A/G 5z 66 82 Yes ND Yes R553X/unknown (screened e 70 mutations) R553X/711+3 A/G 6 72 71 Yes CF No DF508/unknown{ DF508/unknownyy 7 59 106 Yes Abnormalx NA DF508/unknown{ DF508/unknownyy 8 37 85 No CF NA DF508/unknown{ DF508/unknownyy 9 40 112 No ND ND DF508/unknown (comprehensive scan) DF508/unknown 10 66 ND Yes ND ND 621+1G/T/unknown (comprehensive scan) 621+1G/T/ unknownyy 11 58 ND No ND ND NA** R764X/unknownyy *Sweat [ClÀ ] concentration is expressed as mmol/l. Login to comment
90 A Splicing of RNA from CFTR gene with R553X: Genomic DNA Transcript including exon 5 and R553X GTA R553X R553X (R553X) Splicing of RNA from CFTR gene with 711+3 A>G: Transcript missing exon 5 (90 bp)Transcript including exon 5 GTG (Exon 5+) (Exon 5-) 4 5 6b6a 11 6a 6b54 11 Genomic DNA4 5 6b6a 11 6a 6b54 11 6a 6b4 11 B PeakHeight Exon 5-Exon 5+ /R553X including exon 5 390bp missing exon 5 300bp Table 2 Functional consequences of CFTR mutations identified after CFTR sequencing ID Second CFTR mutation identified after sequencing Amino acid conservation* Functional consequence References 1 TG12-5T NA Missplicingeloss of exon 9 from CFTR transcript Cuppens et al 199835 Groman et al 200436 2 S492F Conserved in mammalian orthologues except platypus None described Ferec et al31 Wine et al 200139 3 P205S Conserved in mammalian orthologues Defective biosynthesis, decreased amount of fully glycosylated CFTR Sheppard et al 199634 4, 5 711+3 A/G NA Missplicingeloss of exon 5 from CFTR transcript This study (figure 2) *Sequences were obtained from GenBank. Login to comment

[hide] Channel-lining residues in the M3 membrane-spannin... Biochemistry. 1998 Sep 1;37(35):12233-40. Akabas MH
Channel-lining residues in the M3 membrane-spanning segment of the cystic fibrosis transmembrane conductance regulator.
Biochemistry. 1998 Sep 1;37(35):12233-40., 1998-09-01 [PMID:9724537]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) forms a chloride-selective channel. Residues from the 12 putative membrane-spanning segments form at least part of the channel lining. We need to identify the channel-lining residues in order to understand the structural basis for the channel's functional properties. Using the substituted-cysteine-accessibility method we mutated to cysteine, one at a time, 24 consecutive residues (Asp192-Ile215) in the M3 membrane-spanning segment. Cysteines substituted for His199, Phe200, Trp202, Ile203, Pro205, Gln207, Leu211, and Leu214 reacted with charged, sulfhydryl-specific reagents that are derivatives of methanethiosulfonate (MTS). We infer that these residues are on the water-accessible surface of the protein and probably form a portion of the channel lining. When plotted on an alpha-helical wheel the exposed residues from Gln207 to Leu214 lie within an arc of 60 degrees; the exposed residues in the cytoplasmic half (His199-Ile203) lie within an arc of 160 degrees. We infer that the secondary structures of the extracellular and cytoplasmic halves of M3 are alpha-helical and that Pro205, in the middle of the M3 segment, may bend the M3 segment, moving the cytoplasmic end of the segment in toward the central axis of the channel. The bend in the M3 segment may help to narrow the channel lumen near the cytoplasmic end. In addition, unlike full-length CFTR, the current induced by the deletion construct, Delta259, is inhibited by the MTS reagents, implying that the channel structure of Delta259 is different than the channel structure of wild-type CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
200 The mutation P205S is associated with mild CF (58); this and other mutations of Pro205 reduce the formation of mature CFTR protein but they do not alter the halide permeability and conductance ratios (31). Login to comment
222 Several mutations of residues in and flanking the M3 membrane-spanning segment have been identified in patients with CF, including D192G, E193K, H199Y, P205S, and L206W (58, 60-63). Login to comment

[hide] Regulation of Cl-/ HCO3- exchange by cystic fibros... J Biol Chem. 1999 Feb 5;274(6):3414-21. Lee MG, Wigley WC, Zeng W, Noel LE, Marino CR, Thomas PJ, Muallem S
Regulation of Cl-/ HCO3- exchange by cystic fibrosis transmembrane conductance regulator expressed in NIH 3T3 and HEK 293 cells.
J Biol Chem. 1999 Feb 5;274(6):3414-21., 1999-02-05 [PMID:9920885]

Abstract [show]
A central function of cystic fibrosis transmembrane conductance regulator (CFTR)-expressing tissues is the secretion of fluid containing 100-140 mM HCO3-. High levels of HCO3- maintain secreted proteins such as mucins (all tissues) and digestive enzymes (pancreas) in a soluble and/or inactive state. HCO3- secretion is impaired in CF in all CFTR-expressing, HCO3--secreting tissues examined. The mechanism responsible for this critical problem in CF is unknown. Since a major component of HCO3- secretion in CFTR-expressing cells is mediated by the action of a Cl-/HCO3- exchanger (AE), in the present work we examined the regulation of AE activity by CFTR. In NIH 3T3 cells stably transfected with wild type CFTR and in HEK 293 cells expressing WT and several mutant CFTR, activation of CFTR by cAMP stimulated AE activity. Pharmacological and mutagenesis studies indicated that expression of CFTR in the plasma membrane, but not the Cl- conductive function of CFTR was required for activation of AE. Furthermore, mutations in NBD2 altered regulation of AE activity by CFTR independent of their effect on Cl- channel activity. At very high expression levels CFTR modified the sensitivity of AE to 4,4'-diisothiocyanatostilbene-2, 2'-disulfonate. The novel finding of regulation of Cl-/HCO3- exchange by CFTR reported here may have important physiological implications and explain, at least in part, the impaired HCO3- secretion in CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
52 The mutagenesis primers were as follows: P205S primer, 5Ј-CGT GTG GAT CGC TTC TTT GCA AGT GGC-3Ј; W846term, 5Ј-GAG CAT ACC AGC AGT GAC TAC ATA GAA CAC ATA CCT TCG ATA TAT TAC-3Ј; G1247D/G1249E, 5Ј-GTG GGC CTC TTG GGA AGA ACT GAT TCA GAG AAG AGT ACT TTG TTA TCA GC-3Ј; K1250M, 5Ј-CTT GGG AAG AAC TGG ATC AGG GAT GAG TAC TTT GTT ATC AGC-3Ј; D1370N, 5Ј-GTA AGG CGA AGA TCT TGC TGC TTA ATG AAC CCA GTG CTC ATT TGG ATC-3Ј. Login to comment
161 Fig. 6, c and d shows the localization of WT CFTR relative to that of BiP, and g and h show the localization of P205S CFTR. Login to comment
162 It is clear that WT CFTR was present in the ER and plasma membrane whereas P205S CFTR localized in the ER. Login to comment
185 Panels e and g show the predominant ER localization of ⌬F508 and P205S CFTR, respectively. Login to comment
234 ⌬F508 and P205S CFTR are known maturation mutants (26, 27) that do not reach the plasma membrane of 293 cells (Fig. 6). Login to comment
256 Folding CFTR mutants and N-terminal half CFTR had no effect on AE activity. HEK 293 cells were cotransfected with plasmids carrying GFP and P205S CFTR (a), ⌬F508 CFTR (b), or Trp-846 termination codon CFTR (c). Login to comment
272 This is further supported by the findings with the ⌬F508 and P205S CFTR maturation mutants, which showed that expression of CFTR in the plasma membrane, rather than mere expression of CFTR in the cells, was required for activation of AE. Login to comment

[hide] Detection of CFTR mutations using temporal tempera... Electrophoresis. 2004 Aug;25(15):2593-601. Wong LJ, Alper OM
Detection of CFTR mutations using temporal temperature gradient gel electrophoresis.
Electrophoresis. 2004 Aug;25(15):2593-601., [PMID:15300780]

Abstract [show]
Cystic fibrosis (CF), caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, is one of the most common autosomal recessive diseases with variable incidences and mutation spectra among different ethnic groups. Current commercially available mutation panels designed for the analysis of known recurrent mutations have a detection rate between 38 to 95%, depending upon the ethnic background of the patient. We describe the application of a novel mutation detection method, temporal temperature gradient gel electrophoresis (TTGE), to the study of the molecular genetics of Hispanic CF patients. TTGE effectively identified numerous rare and novel mutations and polymorphisms. One interesting observation is that the majority of the novel mutations are splice site, frame shift, or nonsense mutations that cause severe clinical phenotypes. Our data demonstrate that screening of the 27 exons and intron/exon junctions of the CFTR gene by TTGE greatly improves the molecular diagnosis of Hispanic CF patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
133 Identification of rare and novel mutations and polymorphisms Base substitution Mutation Exon or intron Homozygote or heterozygote Polymorphism or mutation # Alleles identified 1 c.124_146del23bp Frameshift 1 Heterozygote Mutation 1 2 c.296+2T>A Splice Int 2 Heterozygote Mutation 1 3 c.296+28A/G Int 2 Homozygote Polymorphism 2 4 c.355CT p.R75X 3 Heterozygote Mutation 2 5 c.360_365insT Frameshift 3 Heterozygote Mutation 1 6 c.379_381insT Frameshift 3 Heterozygote Mutation 1 7 c.406-1G>A Splice Int 4 Heterozygote Mutation 2 8 c.424C.T p.Q98X 4 Heterozygote Mutation 1 9 c.425A.G p.Q98R 4 Heterozygote Mutation 3 10 c.586A.G p.M152V 4 Homozygote Mutation 2 11 c.663delT Frameshift 5 Heterozygote Mutation 3 12 c.667C>A p.Q179K 5 Heterozygote Mutation, 1 13 c.745C.T p.P205S 6a Heterozygote Mutation 5 14 c.875140A/G 6a Heterozygote Polymorphism 11 15 c.935delA Frameshift 6b Heterozygote Mutation 2 16 c.124811G.A Splice Int 7 Heterozygote Mutation 2 17 c.1285ins TA Frameshift 8 Heterozygote Mutation 4 Homozygote Mutation 2 18 c.1342+196C/T Int 8 Heterozygote Polymorphism 4 Homozygote 2 19 c.1461insAGAT Frameshift 9 Heterozygote Mutation 1 20 c.1525-61A/G 10 Heterozygote Polymorphism 22 21 c.1529C.A/G p.S466X 10 Heterozygote Mutation 1 22 c.1607C.T p.S492F 10 Heterozygote Mutation 3 23 c.1814C.T p.A561E 12 Heterozygote Mutation 1 24 c.189813A.G Splice Int 12 Heterozygote Mutation 1 25 c.18981152T/A Int 12 Heterozygote Polymorphism 5 26 c.1924del 7bp Frameshift 13 Heterozygote Mutation 1 27 c.1949del84 Frameshift 13 Heterozygote Mutation 1 28 c.2055del9toA Frameshift 13 Homozygote Mutation 2 29 c.2105_2117 Frameshift 13 Heterozygote Mutation 4 del13insAGAAA 30 c.2108delA Frameshift 13 Heterozygote Mutation 1 31 c.2184insA Frameshift 13 Heterozygote Mutation 2 32 c.2184delA Frameshift 13 Heterozygote Mutation 1 33 c.2289_2295 Frameshift 13 Heterozygote Mutation 1 del7insGT 34 c.2694T.G p.T854T 14a Heterozygote Polymorphism 10 35 c.2752+12G/C Int 14a Heterozygote Polymorphism 2 36 c.2800C.T p.Q890X 15 Homozygote Mutation 2 37 c.3171delC Frameshift 17a Heterozygote Mutation 1 38 c.3179T>C p.F1016S 17a Heterozygote Mutation 1 39 c.3199del 6bp Frameshift 17a Heterozygote Mutation 1 40 c.3212T.C p.I1027T 17a Heterozygote Mutation 1 41 c.3272-26A.G Splice Int17a Heterozygote Mutation 4 42 c.3271delGG Frameshift 17a Heterozygote Mutation 1 43 c.3313G.C p.G1061R 17b Heterozygote Mutation 1 44 c.3328C.T p.R1066C 17b Heterozygote Mutation 2 45 c.3362T.C p.L1077P 17b Heterozygote Mutation 1 46 c.3431A.C p.Q1100P 17b Heterozygote Mutation 1 47 c.3500-2A>T Splice Int 17b Heterozygote Mutation 1 48 c.3743G.A p.W1204X 19 Heterozygote Mutation 1 Homozygote Mutation 2 49 c.3601-65C/A Int 19 Heterozygote Polymorphism 14 50 c.3863G.A p.G1244E 20 Heterozygote Mutation 3 Table 3. Login to comment

[hide] Spectrum of mutations in the CFTR gene in cystic f... Ann Hum Genet. 2007 Mar;71(Pt 2):194-201. Alonso MJ, Heine-Suner D, Calvo M, Rosell J, Gimenez J, Ramos MD, Telleria JJ, Palacio A, Estivill X, Casals T
Spectrum of mutations in the CFTR gene in cystic fibrosis patients of Spanish ancestry.
Ann Hum Genet. 2007 Mar;71(Pt 2):194-201., [PMID:17331079]

Abstract [show]
We analyzed 1,954 Spanish cystic fibrosis (CF) alleles in order to define the molecular spectrum of mutations in the CFTR gene in Spanish CF patients. Commercial panels showed a limited detection power, leading to the identification of only 76% of alleles. Two scanning techniques, denaturing gradient gel electrophoresis (DGGE) and single strand conformation polymorphism/hetroduplex (SSCP/HD), were carried out to detect CFTR sequence changes. In addition, intragenic markers IVS8CA, IVS8-6(T)n and IVS17bTA were also analyzed. Twelve mutations showed frequencies above 1%, p.F508del being the most frequent mutation (51%). We found that eighteen mutations need to be studied to achieve a detection level of 80%. Fifty-one mutations (42%) were observed once. In total, 121 disease-causing mutations were identified, accounting for 96% (1,877 out of 1,954) of CF alleles. Specific geographic distributions for the most common mutations, p.F508del, p.G542X, c.1811 + 1.6kbA > G and c.1609delCA, were confirmed. Furthermore, two other relatively common mutations (p.V232D and c.2789 + 5G > A) showed uneven geographic distributions. This updated information on the spectrum of CF mutations in Spain will be useful for improving genetic testing, as well as to facilitate counselling in people of Spanish ancestry. In addition, this study contributes to defining the molecular spectrum of CF in Europe, and corroborates the high molecular mutation heterogeneity of Mediterranean populations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
52 Mutation 0.46-0.35 9 c.1078delT #, p.R347P # 8 p.G85V, c.621 + 1G > T #, p.S549R (T > G) #, p.R553X #, c.3849 + 10kbC > T # 7 p.R347H #, c.1812-1G > A, p.R709X 0.30-0.10 6 p.H199Y, p.P205S, 5 p.R117H #, p.G551D #, p.W1089X, p.Y1092X, CFTR50kbdel 4 c.296 + 3insT, c.1717-1G > A #, c.1949del84, c.3849 + 1G > A 3 p.E92K, c.936delTA, c.1717-8G > A, c.1341G > A, p.A561E, c.2603delT, p.G1244E, [p.D1270N; p.R74W] 2 p.Q2X, p.P5L, CFTRdele2,3, p.S50P, p.E60K, c.405 + 1G > A, c.1677delTA, p.L558S, p.G673X, p.R851X, p.Y1014C, p.Q1100P, p.M1101K, p.D1152H, CFTRdele19, p.G1244V, p.Q1281X, p.Y1381X <0,1 1 c.124del23bp, p.Q30X, p.W57X, c.406-1G > A, p.Q98R, p.E115del, c.519delT, p.L159S, c.711 + 3A > T, p.W202X, c.875 + 1G > A, p.E278del, p.W361R, c.1215delG, p.L365P, p.A399D, c.1548delG, p.K536X, p.R560G, c.1782delA, p.L571S, [p.G576A; p.R668C], p.T582R, p.E585X, c.1898 + 1G > A, c.1898 + 3A > G, c.2051delTT, p.E692X, p.R851L, c.2711delT, c.2751 + 3A > G, c.2752-26A > G, p.D924N, p.S945L, c.3121-1G > A, p.V1008D, p.L1065R, [p.R1070W; p.R668C], [p.F1074L; 5T], p.H1085R, p.R1158X, c.3659delC #, c.3667del4, c.3737delA, c.3860ins31, c.3905insT #, c.4005 + 1G > A, p.T1299I, p.E1308X, p.Q1313X, c.4095 + 2T > A, rearrangements study (n = 4) Mutations identified in CF families with mixed European origin: c.182delT, p.L1254X, c.4010del4. Login to comment

[hide] Membrane-integration characteristics of two ABC tr... J Mol Biol. 2009 Apr 17;387(5):1153-64. Epub 2009 Feb 21. Enquist K, Fransson M, Boekel C, Bengtsson I, Geiger K, Lang L, Pettersson A, Johansson S, von Heijne G, Nilsson I
Membrane-integration characteristics of two ABC transporters, CFTR and P-glycoprotein.
J Mol Biol. 2009 Apr 17;387(5):1153-64. Epub 2009 Feb 21., [PMID:19236881]

Abstract [show]
To what extent do corresponding transmembrane helices in related integral membrane proteins have different membrane-insertion characteristics? Here, we compare, side-by-side, the membrane insertion characteristics of the 12 transmembrane helices in the adenosine triphosphate-binding cassette (ABC) transporters, P-glycoprotein (P-gp) and the cystic fibrosis transmembrane conductance regulator (CFTR). Our results show that 10 of the 12 CFTR transmembrane segments can insert independently into the ER membrane. In contrast, only three of the P-gp transmembrane segments are independently stable in the membrane, while the majority depend on the presence of neighboring loops and/or transmembrane segments for efficient insertion. Membrane-insertion characteristics can thus vary widely between related proteins.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
113 For CFTR, we chose mutations located in TM1CFTR (F87L, G91R), TM3CFTR (P205S, L206W), TM4CFTR (C225R), TM5CFTR (DF311, G314E), TM6CFTR (R334L/W, I336K/R/D, I340N/S, L346P, R347L/H), TM8CFTR (S909I, S912L), TM9CFTR (I1005R, A1006E), TM10CFTR (Y1032N), and TM12CFTR (M1137R, ΔM1140, M1140K), or close to the TM region of TM1CFTR (R74W, L102R/P), TMF2CFTR (R117P/L, L137P), and TM11CFTR (M1101K/R). Login to comment
109 For CFTR, we chose mutations located in TM1CFTR (F87L, G91R), TM3CFTR (P205S, L206W), TM4CFTR (C225R), TM5CFTR (DF311, G314E), TM6CFTR (R334L/W, I336K/R/D, I340N/S, L346P, R347L/H), TM8CFTR (S909I, S912L), TM9CFTR (I1005R, A1006E), TM10CFTR (Y1032N), and TM12CFTR (M1137R, ƊM1140, M1140K), or close to the TM region of TM1CFTR (R74W, L102R/P), TMF2CFTR (R117P/L, L137P), and TM11CFTR (M1101K/R). Login to comment

[hide] The ACE gene D/I polymorphism as a modulator of se... BMC Pulm Med. 2012 Aug 8;12:41. Marson FA, Bertuzzo CS, Hortencio TD, Ribeiro JD, Bonadia LC, Ribeiro AF
The ACE gene D/I polymorphism as a modulator of severity of cystic fibrosis.
BMC Pulm Med. 2012 Aug 8;12:41., [PMID:22874010]

Abstract [show]
ABSTRACT: BACKGROUND: Cystic Fibrosis (CF) is a monogenic disease with complex expression because of the action of genetic and environmental factors. We investigated whether the ACE gene D/I polymorphism is associated with severity of CF. METHODS: A cross-sectional study was performed, from 2009 to 2011, at University of Campinas - UNICAMP. We analyzed 180 patients for the most frequent mutations in the CFTR gene, presence of the ACE gene D/I polymorphism and clinical characteristics of CF. RESULTS: There was an association of the D/D genotype with early initiation of clinical manifestations (OR: 1.519, CI: 1.074 to 2.146), bacterium Burkholderia cepacia colonization (OR: 3.309, CI: 1.476 to 6.256) and Bhalla score (BS) (p = 0.015). The association was observed in subgroups of patients which were defined by their CFTR mutation genotype (all patients; subgroup I: no mutation detected; subgroup II: one CFTR allele identified to mutation class I, II or III; subgroup III: both CFTR alleles identified to mutation class I, II and/or III). CONCLUSION: An association between the D allele in the ACE gene and the severity of CF was found in our study.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
33 Others identified mutations as class IV (P205S e R334W) were included in the statistical analysis in the not identified mutation subgroup, to minimize the associated factor with the mutation classes in the CFTR gene, being that the class IV is associated with a minor severity. Login to comment
99 Others identified mutations as class IV (P205S e R334W) was included in the statistical analysis in the not identified mutation subgroup, to minimize the associated factor with the mutation classes in the CFTR gene. Login to comment
32 Others identified mutations as class IV (P205S e R334W) were included in the statistical analysis in the not identified mutation subgroup, to minimize the associated factor with the mutation classes in the CFTR gene, being that the class IV is associated with a minor severity. Login to comment
98 Others identified mutations as class IV (P205S e R334W) was included in the statistical analysis in the not identified mutation subgroup, to minimize the associated factor with the mutation classes in the CFTR gene. Login to comment

[hide] Sequence hydropathy dominates membrane protein res... Biochemistry. 2012 Aug 7;51(31):6228-37. Epub 2012 Jul 25. Nadeau VG, Rath A, Deber CM
Sequence hydropathy dominates membrane protein response to detergent solubilization.
Biochemistry. 2012 Aug 7;51(31):6228-37. Epub 2012 Jul 25., [PMID:22779403]

Abstract [show]
The ability to predict from amino acid sequence how membrane protein structures will respond to detergent solubilization would significantly facilitate experimental characterization of these molecules. Here we have investigated and compared the response to solubilization by the "mild" n-dodecyl-beta-d-maltoside (DDM) and "harsh" sodium dodecyl sulfate (SDS) of wild-type and point mutant "hairpin" (helix-loop-helix) membrane proteins derived from the third and fourth TM segments of the human cystic fibrosis transmembrane conductance regulator (CFTR) and the intervening extracellular loop. Circular dichroism spectroscopy, size-exclusion chromatography, and pyrene fluorescence spectroscopy were used to evaluate the secondary structures, hairpin-detergent complex excluded volumes, and hairpin compactness of the detergent-solubilized sequences. Sequence hydrophobicity is found to be the dominant factor dictating membrane protein response to detergent solubilization by DDM and SDS, with hairpin secondary structure exquisitely sensitive to mutation when DDM is used for solubilization. DDM and SDS differ principally in their ability to promote approach of TM segment ends, although hairpin compactness remains sensitive to point mutations. Our overall findings suggest that protein-protein and protein-detergent interactions are determined concomitantly, with the net hydropathy of residues exposed to detergent dominating the observed properties of the solubilized protein.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
89 We further noted that the spectra of mutant hairpins solubilized in DDM exhibited a gradation of intensities, whereas SDS-solubilized mutant spectra could be divided into "low helicity" (WT, V232D, A204L, and P205S) or "high helicity" (E217V, ES/SE, and E217F) clusters. Login to comment
144 In DDM (Figure 4B, left), we found that the P205S (E:M = 0.87 ± 0.20), E217V (E:M = 0.78 ± 0.06), E271F (E:M = 0.76 ± 0.12) and A204L spectra (E:M = 0.69 ± 0.02) each displayed excimer fluorescence, and the E:M ratio of each of these "compact" mutants was statistically distinct from the negative control in DDM (E:M = 0.52 ± 0.02, 4.7 × 10-6 ≤ p ≤ 0.008). Login to comment
189 We were thus excited to observe that solubilization by DDM supports a distance <10 Å between pyrene molecules conjugated at the ends of TM3 and TM4, giving rise to a subset of "compact" mutants (P205S, E217V, E217F, and A204L) (Figure 4B, left). Login to comment

[hide] Folding of CFTR is predominantly cotranslational. Mol Cell. 2005 Oct 28;20(2):277-87. Kleizen B, van Vlijmen T, de Jonge HR, Braakman I
Folding of CFTR is predominantly cotranslational.
Mol Cell. 2005 Oct 28;20(2):277-87., [PMID:16246729]

Abstract [show]
The folding process for newly synthesized, multispanning membrane proteins in the endoplasmic reticulum (ER) is largely unknown. Here, we describe early folding events of the cystic fibrosis transmembrane conductance regulator (CFTR), a member of the ABC-transporter family. In vitro translation of CFTR in the presence of semipermeabilized cells allowed us to investigate this protein during nascent chain elongation. We found that CFTR folds mostly during synthesis as determined by protease susceptibility. C-terminally truncated constructs showed that individual CFTR domains formed well-defined structures independent of C-terminal parts. We conclude that the multidomain protein CFTR folds mostly cotranslationally, domain by domain.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
93 Altogether these results validate our proteolysis assay as a measure for CFTR folding and conformation in semipermeabilized cells, which was confirmed further by the subtle changes we detected in two CF patient-related mutants, CFTR ⌬F508 and CFTR P205S (our unpublished data). Login to comment
92 Altogether these results validate our proteolysis assay as a measure for CFTR folding and conformation in semipermeabilized cells, which was confirmed further by the subtle changes we detected in two CF patient-related mutants, CFTR èc;F508 and CFTR P205S (our unpublished data). Login to comment

[hide] Genotyping microarray for the detection of more th... J Mol Diagn. 2005 Aug;7(3):375-87. Schrijver I, Oitmaa E, Metspalu A, Gardner P
Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations.
J Mol Diagn. 2005 Aug;7(3):375-87., [PMID:16049310]

Abstract [show]
Cystic fibrosis (CF), which is due to mutations in the cystic fibrosis transmembrane conductance regulator gene, is a common life-shortening disease. Although CF occurs with the highest incidence in Caucasians, it also occurs in other ethnicities with variable frequency. Recent national guidelines suggest that all couples contemplating pregnancy should be informed of molecular screening for CF carrier status for purposes of genetic counseling. Commercially available CF carrier screening panels offer a limited panel of mutations, however, making them insufficiently sensitive for certain groups within an ethnically diverse population. This discrepancy is even more pronounced when such carrier screening panels are used for diagnostic purposes. By means of arrayed primer extension technology, we have designed a genotyping microarray with 204 probe sites for CF transmembrane conductance regulator gene mutation detection. The arrayed primer extension array, based on a platform technology for disease detection with multiple applications, is a robust, cost-effective, and easily modifiable assay suitable for CF carrier screening and disease detection.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS. Login to comment
150 Primers Generated to Create Synthetic Templates That Serve As Positive Mutation Controls Primer name Sense strand 5Ј 3 3Ј Name Antisense strand 5Ј 3 3Ј 175delC synt F T(15)ATTTTTTTCAGGTGAGAAGGTGGCCA 175delC synt R T(15)ATTTGGAGACAACGCTGGCCTTTTCC W19C synt F T(15)TACCAGACCAATTTTGAGGAAAGGAT W19C synt R T(15)ACAGCTAAAATAAAGAGAGGAGGAAC Q39X synt F T(15)TAAATCCCTTCTGTTGATTCTGCTGA Q39X synt R T(15)AGTATATGTCTGACAATTCCAGGCGC 296 ϩ 12TϾC synt F T(15)CACATTGTTTAGTTGAAGAGAGAAAT 296 ϩ 12TϾC synt R T(15)GCATGAACATACCTTTCCAATTTTTC 359insT synt F T(15)TTTTTTTCTGGAGATTTATGTTCTAT 359insT synt R T(15)AAAAAAACATCGCCGAAGGGCATTAA E60X synt F T(15)TAGCTGGCTTCAAAGAAAAATCCTAA E60X synt R T(15)ATCTATCCCATTCTCTGCAAAAGAAT P67L synt F T(15)TTAAACTCATTAATGCCCTTCGGCGA P67L synt R T(15)AGATTTTTCTTTGAAGCCAGCTCTCT R74Q synt F T(15)AGCGATGTTTTTTCTGGAGATTTATG R74Q synt R T(15)TGAAGGGCATTAATGAGTTTAGGATT R75X synt F T(15)TGATGTTTTTTCTGGAGATTTATGTT R75X synt R T(15)ACCGAAGGGCATTAATGAGTTTAGGA W57X(TAG) synt F T(15)AGGATAGAGAGCTGGCTTCAAAGAAA W57X(TAG) synt R T(15)TATTCTCTGCAAAAGAATAAAAAGTG W57X(TGA) synt F T(15)AGATAGAGAGCTGGCTTCAAAGAAAA W57X(TGA) synt R T(15)TCATTCTCTGCAAAAGAATAAAAAGT G91R synt F T(15)AGGGTAAGGATCTCATTTGTACATTC G91R synt R T(15)TTAAATATAAAAAGATTCCATAGAAC 405 ϩ 1GϾA synt F T(15)ATAAGGATCTCATTTGTACATTCATT 405 ϩ 1GϾA synt R T(15)TCCCTAAATATAAAAAGATTCCATAG 405 ϩ 3AϾC synt F T(15)CAGGATCTCATTTGTACATTCATTAT 405 ϩ 3AϾC synt R T(15)GACCCCTAAATATAAAAAGATTCCAT 406 - 1GϾA synt F T(15)AGAAGTCACCAAAGCAGTACAGCCTC 406 - 1GϾA synt R T(15)TTACAAAAGGGGAAAAACAGAGAAAT E92X synt F T(15)TAAGTCACCAAAGCAGTACAGCCTCT E92X synt R T(15)ACTACAAAAGGGGAAAAACAGAGAAA E92K synt F T(15)AAAGTCACCAAAGCAGTACAGCCTCT E92K synt R T(15)TCTACAAAAGGGGAAAAACAGAGAAA 444delA synt F T(15)GATCATAGCTTCCTATGACCCGGATA 444delA synt R T(15)ATCTTCCCAGTAAGAGAGGCTGTACT 574delA synt F T(15)CTTGGAATGCAGATGAGAATAGCTAT 574delA synt R T(15)AGTGATGAAGGCCAAAAATGGCTGGG 621GϾA synt F T(15)AGTAATACTTCCTTGCACAGGCCCCA 621GϾA synt R T(15)TTTCTTATAAATCAAACTAAACATAG Q98P synt F T(15)CGCCTCTCTTACTGGGAAGAATCATA Q98P synt R T(15)GGTACTGCTTTGGTGACTTCCTACAA 457TATϾG synt F T(15)GGACCCGGATAACAAGGAGGAACGCT 457TATϾG synt R T(15)CGGAAGCTATGATTCTTCCCAGTAAG I148T synt F T(15)CTGGAATGCAGATGAGAATAGCTATG I148T synt R T(15)GTGTGATGAAGGCCAAAAATGGCTGG 624delT synt F T(15)CTTAAAGCTGTCAAGCCGTGTTCTAG 624delT synt R T(15)TAAGTCTAAAAGAAAAATGGAAAGTT 663delT synt F T(15)ATGGACAACTTGTTAGTCTCCTTTCC 663delT synt R T(15)CATACTTATTTTATCTAGAACACGGC G178R synt F T(15)AGACAACTTGTTAGTCTCCTTTCCAA G178R synt R T(15)TAATACTTATTTTATCTAGAACACGG Q179K synt F T(15)AAACTTGTTAGTCTCCTTTCCAACAA Q179K synt R T(15)TTCCAATACTTATTTTATCTAGAACA 711 ϩ 5GϾA synt F T(15)ATACCTATTGATTTAATCTTTTAGGC 711 ϩ 5GϾA synt R T(15)TTATACTTCATCAAATTTGTTCAGGT 712 - 1GϾT synt F T(15)TGGACTTGCATTGGCACATTTCGTGT 712 - 1GϾT synt R T(15)TATGGAAAATAAAAGCACAGCAAAAAC H199Y synt F T(15)TATTTCGTGTGGATCGCTCCTTTGCA H199Y synt R T(15)TATGCCAATGCTAGTCCCTGGAAAATA P205S synt F T(15)TCTTTGCAAGTGGCACTCCTCATGGG P205S synt R T(15)TAAGCGATCCACACGAAATGTGCCAAT L206W synt F T(15)GGCAAGTGGCACTCCTCATGGGGCTA L206W synt R T(15)TCAAGGAGCGATCCACACGAAATGTGC Q220X synt F T(15)TAGGCGTCTGCTTTCTGTGGACTTGG Q220X synt R T(15)TATAACAACTCCCAGATTAGCCCCATG 936delTA synt F T(15)AATCCAATCTGTTAAGGCATACTGCT 936delTA synt R T(15)TGATTTTCAATCATTTCTGAGGTAATC 935delA synt F T(15)GAAATATCCAATCTGTTAAGGCATAC 935delA synt R T(15)TATTTCAATCATTTCTGAGGTAATCAC N287Y synt F T(15)TACTTAAGACAGTAAGTTGTTCCAAT N287Y synt R T(15)TATTCAATCATTTTTTCCATTGCTTCT 1002 - 3TϾG synt F T(15)GAGAACAGAACTGAAACTGACTCGGA 1002 - 3TϾG synt R T(15)TCTAAAAAACAATAACAATAAAATTCA 1154insTC syntwt F T(15)ATCTCATTCTGCATTGTTCTGCGCAT 1154insTC syntwt R T(15)TTGAGATGGTGGTGAATATTTTCCGGA 1154insTC syntmt F T(15)TCTCTCATTCTGCATTGTTCTGCGCAT 1154insTC syntmt R T(15)TAGAGATGGTGGTGAATATTTTCCGGA DF311 mt syntV1 F T(15)CCTTCTTCTCAGGGTTCTTTGTGGTG dF311 mt syntV1 R T(15)GAGAAGAAGGCTGAGCTATTGAAGTATC G330X synt F T(15)TGAATCATCCTCCGGAAAATATTCAC G330X synt R T(15)ATTTGATTAGTGCATAGGGAAGCACA S364P synt F T(15)CCTCTTGGAGCAATAAACAAAATACA S364P synt R T(15)GGTCATACCATGTTTGTACAGCCCAG Q359K/T360K mt synt F T(15)AAAAAATGGTATGACTCTCTTGGAGC Q359K/T360K mt synt R T(15)TTTTTTACAGCCCAGGGAAATTGCCG 1078delT synt F T(15)CTTGTGGTGTTTTTATCTGTGCTTCC 1078delT synt R T(15)CAAGAACCCTGAGAAGAAGAAGGCTG 1119delA synt F T(15)CAAGGAATCATCCTCCGGAAAATATT 1119delA synt R T(15)CTTGATTAGTGCATAGGGAAGCACAG 1161delC synt F T(15)GATTGTTCTGCGCATGGCGGTCACTC 1161delC synt R T(15)TCAGAATGAGATGGTGGTGAATATTT T338I synt F T(15)TCACCATCTCATTCTGCATTGTTCTG T338I synt R T(15)ATGAATATTTTCCGGAGGATGATTCC R352Q synt F T(15)AGCAATTTCCCTGGGCTGTACAAACA R352Q synt R T(15)TGAGTGACCGCCATGCGCAGAACAAT L346P synt F T(15)CGCGCATGGCGGTCACTCGGCAATTT L346P synt R T(15)GGAACAATGCAGAATGAGATGGTGGT 1259insA synt F T(15)AAAAAGCAAGAATATAAGACATTGGA 1259insA synt R T(15)TTTTTGTAAGAAATCCTATTTATAAA W401X(TAG)mtsynt F T(15)AGGAGGAGGTCAGAATTTTTAAAAAA W401X(TAG)mtsynt R T(15)TAGAAGGCTGTTACATTCTCCATCAC W401X(TGA) synt F T(15)AGAGGAGGTCAGAATTTTTAAAAAAT W401X(TGA) synt R T(15)TCAGAAGGCTGTTACATTCTCCATCA 1342 - 2AϾC synt F T(15)CGGGATTTGGGGAATTATTTGAGAAA 1342 - 2AϾC synt R T(15)GGTTAAAAAAACACACACACACACAC 1504delG synt F T(15)TGATCCACTGTAGCAGGCAAGGTAGT 1504delG synt R T(15)TCAGCAACCGCCAACAACTGTCCTCT G480C synt F T(15)TGTAAAATTAAGCACAGTGGAAGAAT G480C synt R T(15)ACTCTGAAGGCTCCAGTTCTCCCATA C524X synt F T(15)ACAACTAGAAGAGGTAAGAAACTATG C524X synt R T(15)TCATGCTTTGATGACGCTTCTGTATC V520F synt F T(15)TTCATCAAAGCAAGCCAACTAGAAGA V520F synt R T(15)AGCTTCTGTATCTATATTCATCATAG 1609delCA synt F T(15)TGTTTTCCTGGATTATGCCTGGCACC 1609delCA synt R T(15)CAGAACAGAATGAAATTCTTCCACTG 1717 - 8GϾA synt F T(15)AGTAATAGGACATCTCCAAGTTTGCA 1717 - 8GϾA synt R T(15)TAAAAATAGAAAATTAGAGAGTCACT 1784delG synt F T(15)AGTCAACGAGCAAGAATTTCTTTAGC 1784delG synt R T(15)ACTCCACTCAGTGTGATTCCACCTTC A559T synt F T(15)ACAAGGTGAATAACTAATTATTGGTC A559T synt R T(15)TTAAAGAAATTCTTGCTCGTTGACCT Q552X synt F T(15)TAACGAGCAAGAATTTCTTTAGCAAG Q552X synt R T(15)AACCTCCACTCAGTGTGATTCCACCT S549R(AϾC) synt F T(15)CGTGGAGGTCAACGAGCAAGAATTTC S549R(AϾC) synt R T(15)GCAGTGTGATTCTACCTTCTCCAAGA S549R(TϾG) synt F T(15)GGGAGGTCAACGAGCAAGTATTTC S549R(TϾG) synt R T(15)CCTCAGTGTGATTCCACCTTCTCCAA L558S synt F T(15)CAGCAAGGTGAATAACTAATTATTGG L558S synt R T(15)GAAGAAATTCTCGCTCGTTGACCTCC 1811 ϩ 1.6 kb AϾG synt F T(15)GTAAGTAAGGTTACTATCAATCACAC 1811 ϩ 1.6 kb AϾG synt R T(15)CATCTCAAGTACATAGGATTCTCTGT 1812 - 1GϾA synt F T(15)AAGCAGTATACAAAGATGCTGATTTG 1812 - 1GϾA synt R T(15)TTAAAAAGAAAATGGAAATTAAATTA D572N synt F T(15)AACTCTCCTTTTGGATACCTAGATGT D572N synt R T(15)TTAATAAATACAAATCAGCATCTTTG P574H synt F T(15)ATTTTGGATACCTAGATGTTTTAACA P574H synt R T(15)TGAGAGTCTAATAAATACAAATCAGC 1833delT synt F T(15)ATTGTATTTATTAGACTCTCCTTTTG 1833delT synt R T(15)CAATCAGCATCTTTGTATACTGCTCT Table 4. Continued Primer name Sense strand 5Ј 3 3Ј Name Antisense strand 5Ј 3 3Ј Y563D synt F T(15)GACAAAGATGCTGATTTGTATTTATT Y563D synt R T(15)CTACTGCTCTAAAAAGAAAATGGAAA T582R synt F T(15)GAGAAAAAGAAATATTTGAAAGGTAT T582R synt R T(15)CTTAAAACATCTAGGTATCCAAAAGG E585X synt F T(15)TAAATATTTGAAAGGTATGTTCTTTG E585X synt R T(15)ATTTTTCTGTTAAAACATCTAGGTAT 1898 ϩ 5GϾT synt F T(15)TTTCTTTGAATACCTTACTTATATTG 1898 ϩ 5GϾT synt R T(15)AATACCTTTCAAATATTTCTTTTTCT 1924del7 synt F T(15)CAGGATTTTGGTCACTTCTAAAATGG 1924del7 synt R T(15)CTGTTAGCCATCAGTTTACAGACACA 2055del9ϾA synt F T(15)ACATGGGATGTGATTCTTTCGACCAA 2055del9ϾA synt R T(15)TCTAAAGTCTGGCTGTAGATTTTGGA D648V synt F T(15)TTTCTTTCGACCAATTTAGTGCAGAA D648V synt R T(15)ACACATCCCATGAGTTTTGAGCTAAA K710X synt F T(15)TAATTTTCCATTGTGCAAAAGACTCC K710X synt R T(15)ATCGTATAGAGTTGATTGGATTGAGA I618T synt F T(15)CTTTGCATGAAGGTAGCAGCTATTTT I618T synt R T(15)GTTAATATTTTGTCAGCTTTCTTTAA R764X synt F T(15)TGAAGGAGGCAGTCTGTCCTGAACCT R764X synt R T(15)ATGCCTGAAGCGTGGGGCCAGTGCTG Q685X synt F T(15)TAATCTTTTAAACAGACTGGAGAGTT Q685X synt R T(15)ATTTTTTTGTTTCTGTCCAGGAGACA R709X synt F T(15)TGAAAATTTTCCATTGTGCAAAAGAC R709X synt R T(15)ATATAGAGTTGATTGGATTGAGAATA V754M synt F T(15)ATGATCAGCACTGGCCCCACGCTTCA V754M synt R T(15)TGCTGATGCGAGGCAGTATCGCCTCT 1949del84 synt F T(15)AAAAATCTACAGCCAGACTTTATCTC 1949del84 synt R T(15)TTTTTAGAAGTGACCAAAATCCTAGT 2108delA synt F T(15)GAATTCAATCCTAACTGAGACCTTAC 2108delA synt R T(15)ATTCTTCTTTCTGCACTAAATTGGTC 2176insC synt F T(15)CCAAAAAAACAATCTTTTAAACAGACTGGAGAG 2176insC synt R T(15)GGTTTCTGTCCAGGAGACAGGAGCAT 2184delA synt F T(15)CAAAAAACAATCTTTTAAACAGACTGG 2184delA synt R T(15)GTTTTTTGTTTCTGTCCAGGAGACAG 2105-2117 del13 synt F T(15)AAACTGAGACCTTACACCGTTTCTCA 2105-2117 del13 synt R T(15)TTTCTTTCTGCACTAAATTGGTCGAA 2307insA synt F T(15)AAAGAGGATTCTGATGAGCCTTTAGA 2307insA synt R T(15)TTTCGATGCCATTCATTTGTAAGGGA W846X synt F T(15)AAACACATACCTTCGATATATTACTGTCCAC W846X synt R T(15)TCATGTAGTCACTGCTGGTATGCTCT 2734G/AT synt F T(15)TTAATTTTTCTGGCAGAGGTAAGAAT 2734G/AT synt R T(15)TTAAGCACCAAATTAGCACAAAAATT 2766del8 synt F T(15)GGTGGCTCCTTGGAAAGTGAGTATTC 2766del8 synt R T(15)CACCAAAGAAGCAGCCACCTGGAATGG 2790 - 2AϾG synt F T(15)GGCACTCCTCTTCAAGACAAAGGGAA 2790 - 2AϾG synt R T(15)CGTAAAGCAAATAGGAAATCGTTAAT 2991del32 synt F T(15)TTCAACACGTCGAAAGCAGGTACTTT 2991del32 synt R T(15)AAACATTTTGTGGTGTAAAATTTTCG Q890X synt F T(15)TAAGACAAAGGGAATAGTACTCATAG Q890X synt R T(15)AAAGAGGAGTGCTGTAAAGCAAATAG 2869insG synt F T(15)GATTATGTGTTTTACATTTACGTGGG 2869insG synt R T(15)CACGAACTGGTGCTGGTGATAATCAC 3120GϾA synt F T(15)AGTATGTAAAAATAAGTACCGTTAAG 3120GϾA synt R T(15)TTGGATGAAGTCAAATATGGTAAGAG 3121 - 2AϾT synt F T(15)TGTTGTTATTAATTGTGATTGGAGCT 3121 - 2AϾT synt R T(15)AGTAAGATCAAAGAAAACATGTTGGT 3132delTG synt F T(15)TTGATTGGAGCCATAGCAGTTGTCGC 3132delTG synt R T(15)AATTAATAACAACTGTAAGATCAAAG 3271delGG synt F T(15)ATATGACAGTGAATGTGCGATACTCA 3271delGG synt R T(15)ATTCAGATTCCAGTTGTTTGAGTTGC 3171delC synt F T(15)ACCTACATCTTTGTTGCAACAGTGCC 3171delC synt R T(15)AGGTTGTAAAACTGCGACAACTGCTA 3171insC synt F T(15)CCCCTACATCTTTGTTGCTACAGTGC 3171insC synt R T(15)GGGGTTGTAAAACTGCGACAACTGCT 3199del6 synt F T(15)GAGTGGCTTTTATTATGTTGAGAGCATAT 3199del6 synt R T(15)CCACTGGCACTGTTGCAACAAAGATG M1101K synt F T(15)AGAGAATAGAAATGATTTTTGTCATC M1101K synt R T(15)TTTTGGAACCAGCGCAGTGTTGACAG G1061R synt F T(15)CGACTATGGACACTTCGTGCCTTCGG G1061R synt R T(15)GTTTTAAGCTTGTAACAAGATGAGTG R1066L synt F T(15)TTGCCTTCGGACGGCAGCCTTACTTT R1066L synt R T(15)AGAAGTGTCCATAGTCCTTTTAAGCT R1070P synt F T(15)CGCAGCCTTACTTTGAAACTCTGTTC R1070P synt R T(15)GGTCCGAAGGCACGAAGTGTCCATAG L1077P synt F T(15)CGTTCCACAAAGCTCTGAATTTACAT L1077P synt R T(15)GGAGTTTCAAAGTAAGGCTGCCGTCC W1089X synt F T(15)AGTTCTTGTACCTGTCAACACTGCGC W1089X synt R T(15)TAGTTGGCAGTATGTAAATTCAGAGC L1093P synt F T(15)CGTCAACACTGCGCTGGTTCCAAATG L1093P synt R T(15)GGGTACAAGAACCAGTTGGCAGTATG W1098R synt F T(15)CGGTTCCAAATGAGAATAGAAATGAT W1098R synt R T(15)GGCGCAGTGTTGACAGGTACAAGAAC Q1100P synt F T(15)CAATGAGAATAGAAATGATTTTTGTC Q1100P synt R T(15)GGGAACCAGCGCAGTGTTGACAGGTA D1152H synt F T(15)CATGTGGATAGCTTGGTAAGTCTTAT D1152H synt R T(15)GTATGCTGGAGTTTACAGCCCACTGC R1158X synt F T(15)TGATCTGTGAGCCGAGTCTTTAAGTT R1158X synt R T(15)ACATCTGAAATAAAAATAACAACATT S1196X synt F T(15)GACACGTGAAGAAAGATGACATCTGG S1196X synt R T(15)CAATTCTCAATAATCATAACTTTCGA 3732delA synt F T(15)GGAGATGACATCTGGCCCTCAGGGGG 3732delA synt R T(15)CTCCTTCACGTGTGAATTCTCAATAA 3791delC synt F T(15)AAGAAGGTGGAAATGCCATATTAGAG 3791delC synt R T(15)TTGTATTTTGCTGTGAGATCTTTGAC 3821delT synt F T(15)ATTCCTTCTCAATAAGTCCTGGCCAG 3821delT synt R T(15)GAATGTTCTCTAATATGGCATTTCCA Q1238X synt F T(15)TAGAGGGTGAGATTTGAACACTGCTT Q1238X synt R T(15)AGCCAGGACTTATTGAGAAGGAAATG S1255X (ex19)synt F T(15)GTCTGGCCCTCAGGGGGCCAAATGAC S1255X (ex19) synt R T(15)CGTCATCTTTCTTCACGTGTGAATTC S1255X;L synt F T(15)AAGCTTTTTTGAGACTACTGAACACT S1255X;L synt R T(15)TATAACAAAGTAATCTTCCCTGATCC 3849 ϩ 4AϾG synt F T(15)GGATTTGAACACTGCTTGCTTTGTTA 3849 ϩ 4AϾG synt R T(15)CCACCCTCTGGCCAGGACTTATTGAG 3850 - 1GϾA synt F T(15)AGTGGGCCTCTTGGGAAGAACTGGAT 3850 - 1GϾA synt R T(15)TTATAAGGTAAAAGTGATGGGATCAC 3905insT synt F T(15)TTTTTTTGAGACTACTGAACACTGAA 3905insT synt R T(15)AAAAAAAGCTGATAACAAAGTACTCT 3876delA synt F T(15)CGGGAAGAGTACTTTGTTATCAGCTT 3876delA synt R T(15)CGATCCAGTTCTTCCCAAGAGGCCCA G1244V synt F T(15)TAAGAACTGGATCAGGGAAGAGTACT G1244V synt R T(15)ACCAAGAGGCCCACCTATAAGGTAAA G1249E synt F T(15)AGAAGAGTACTTTGTTATCAGCTTTT G1249E synt R T(15)TCTGATCCAGTTCTTCCCAAGAGGCC S1251N synt F T(15)ATACTTTGTTATCAGCTTTTTTGAGACTACTG S1251N synt R T(15)TTCTTCCCTGATCCAGTTCTTCCCAA S1252P synt F T(15)CCTTTGTTATCAGCTTTTTTGAGACT S1252P synt R T(15)GACTCTTCCCTGATCCAGTTCTTCCC D1270N synt F T(15)AATGGTGTGTCTTGGGATTCAATAAC D1270N synt R T(15)TGATCTGGATTTCTCCTTCAGTGTTC W1282R synt F T(15)CGGAGGAAAGCCTTTGGAGTGATACC W1282R synt R T(15)GCTGTTGCAAAGTTATTGAATCCCAA R1283K synt F T(15)AGAAAGCCTTTGGAGTGATACCACAG R1283K synt R T(15)TTCCACTGTTGCAAAGTTATTGAATC 4005 ϩ 1GϾA synt F T(15)ATGAGCAAAAGGACTTAGCCAGAAAA 4005 ϩ 1GϾA synt R T(15)TCTGTGGTATCACTCCAAAGGCTTTC 4010del4 synt F T(15)GTATTTTTTCTGGAACATTTAGAAAAAACTTGG 4010del4 synt R T(15)AAAATACTTTCTATAGCAAAAAAGAAAAGAAGAA 4016insT synt F T(15)TTTTTTTCTGGAACATTTAGAAAAAACTTGG 4016insT synt R T(15)AAAAAAATAAATACTTTCTATAGCAAAAAAGAAAAGAAGA CFTRdele21 synt F T(15)TAGGTAAGGCTGCTAACTGAAATGAT CFTRdele21 synt R T(15)CCTATAGCAAAAAAGAAAAGAAGAAGAAAGTATG 4382delA synt F T(15)GAGAGAACAAAGTGCGGCAGTACGAT 4382delA synt R T(15)CTCTATGACCTATGGAAATGGCTGTT Bold, mutation allele of interest; bold and italicized, modified nucleotide. Login to comment

[hide] Diagnostic testing by CFTR gene mutation analysis ... J Mol Diagn. 2005 May;7(2):289-99. Schrijver I, Ramalingam S, Sankaran R, Swanson S, Dunlop CL, Keiles S, Moss RB, Oehlert J, Gardner P, Wassman ER, Kammesheidt A
Diagnostic testing by CFTR gene mutation analysis in a large group of Hispanics: novel mutations and assessment of a population-specific mutation spectrum.
J Mol Diagn. 2005 May;7(2):289-99., [PMID:15858154]

Abstract [show]
Characterization of CFTR mutations in the U.S. Hispanic population is vital to early diagnosis, genetic counseling, patient-specific treatment, and the understanding of cystic fibrosis (CF) pathogenesis. The mutation spectrum in Hispanics, however, remains poorly defined. A group of 257 self-identified Hispanics with clinical manifestations consistent with CF were studied by temporal temperature gradient electrophoresis and/or DNA sequencing. A total of 183 mutations were identified, including 14 different amino acid-changing novel variants. A significant proportion (78/85) of the different mutations identified would not have been detected by the ACMG/ACOG-recommended 25-mutation screening panel. Over one third of the mutations (27/85) occurred with a relative frequency >1%, which illustrates that the identified mutations are not all rare. This is supported by a comparison with other large CFTR studies. These results underscore the disparity in mutation identification between Caucasians and Hispanics and show utility for comprehensive diagnostic CFTR mutation analysis in this population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
98 Spectrum of CFTR Sequence Variants in 257 Hispanic Patients Who Underwent Diagnostic DNA Testing for CF Mutations in 257 patients Allele counts of each mutation % of variant alleles (183) % of all alleles tested (514) ACMG/ACOG recommended 25 mutation panel* DeltaF508 53 28.96 10.31 G542X 7 3.83 1.36 R334W 2 1.09 0.39 R553X 2 1.09 0.39 DeltaI507 1 0.55 0.19 1717 - 1 GϾA 1 0.55 0.19 3120 ϩ 1 GϾA 1 0.55 0.19 7 different mutations 67 36.61 13.04 All mutations included ACMG/ACOG 1248 ϩ 1 GϾA 1 0.55 0.19 1249 - 29delAT 1 0.55 0.19 1288insTA1288insTA 1 0.55 0.19 1341 ϩ 80 GϾA1341 ϩ 80 GϾA 1 0.55 0.19 1429del71429del7 1 0.55 0.19 1525 - 42 GϾA1525 - 42 GϾA 1 0.55 0.19 1717 - 1 GϾA 1 0.55 0.19 1717 - 8 GϾA 2 1.09 0.39 1811 ϩ 1 GϾA1811 ϩ 1 GϾA 1 0.55 0.19 2055del9-ϾA 3 1.64 0.58 2105-2117del13insAGAAA 1 0.55 0.19 2215insG 1 0.55 0.19 2585delT2585delT 1 0.55 0.19 2752 - 6 TϾC 1 0.55 0.19 296 ϩ 28 AϾG 1 0.55 0.19 3120 ϩ 1 GϾ A 1 0.55 0.19 3271 ϩ 8 AϾG3271 ϩ 8 AϾG 1 0.55 0.19 3271delGG 1 0.55 0.19 3272 - 26 AϾG 2 1.09 0.39 3876delA 2 1.09 0.39 4016insT 1 0.55 0.19 406 - 1 GϾA 6 3.28 1.17 406 - 6 TϾC 1 0.55 0.19 4374 ϩ 13 A ϾG 1 0.55 0.19 663delT 1 0.55 0.19 874insTACA874insTACA 1 0.55 0.19 A1009T 2 1.09 0.39 A559T 1 0.55 0.19 D1152H 1 0.55 0.19 D1270N 3 1.64 0.58 D1445N 2 1.09 0.39 D836Y 1 0.55 0.19 DeltaF311 1 0.55 0.19 DeltaF508 53 28.96 10.31 DeltaI507 1 0.55 0.19 E116K 2 1.09 0.39 E585X 1 0.55 0.19 E588VE588V 2 1.09 0.39 E831X 1 0.55 0.19 F311L 1 0.55 0.19 F693L 1 0.55 0.19 G1244E 1 0.55 0.19 G542X 7 3.83 1.36 G576A 1 0.55 0.19 H199Y 3 1.64 0.58 I1027T 3 1.64 0.58 I285FI285F 1 0.55 0.19 L206W 3 1.64 0.58 L320V 1 0.55 0.19 L967S 1 0.55 0.19 L997F 3 1.64 0.58 P1372LP1372L 1 0.55 0.19 P205S 1 0.55 0.19 P439SP439S 1 0.55 0.19 Q1313X 1 0.55 0.19 Q890X 2 1.09 0.39 Q98R 1 0.55 0.19 R1066C 1 0.55 0.19 R1066H 1 0.55 0.19 (Table continues) missense variant, I1027T (3212TϾC), in exon 17a.25 Family studies have not been performed to identify which allele carries two mutations. Login to comment
187 CFTR Sequence Variants Identified in Five Comprehensive CFTR Studies in US Hispanics CFTR mutations Alleles Relative mutation frequency (%) (of 317) deltaF508 123 38.80 3876delA 15 4.70 G542X 12 3.80 406 - 1GϾA 8 2.50 3849 ϩ 10kbCϾT 5 1.60 R75X 4 1.30 935delA 4 1.30 S549N 4 1.30 W1204X 4 1.30 R334W 4 1.30 2055del9ϾA 3 1 R74W 3 1 H199Y 3 1 L206W 3 1 663delT 3 1 3120 ϩ 1GϾA 3 1 L997F 3 1 I1027T 3 1 R1066C 3 1 W1089X 3 1 D1270N 3 1 2105del13insAGAAA 3 1 Q98R 2 Ͻ1 E116K 2 Ͻ1 I148T 2 Ͻ1 R668C 2 Ͻ1 P205S 2 Ͻ1 V232D 2 Ͻ1 S492F 2 Ͻ1 T501A 2 Ͻ1 1949del84 2 Ͻ1 Q890X 2 Ͻ1 3271delGG 2 Ͻ1 3272 - 26AϾG 2 Ͻ1 G1244E 2 Ͻ1 D1445N 2 Ͻ1 R553X 2 Ͻ1 E588V 2 Ͻ1 1717 - 8GϾA 2 Ͻ1 A1009T 2 Ͻ1 S1235R 2 Ͻ1 G85E 1 Ͻ1 296 ϩ 28AϾG 1 Ͻ1 406 - 6TϾC 1 Ͻ1 V11I 1 Ͻ1 Q179K 1 Ͻ1 V201 mol/L 1 Ͻ1 874insTACA 1 Ͻ1 I285F 1 Ͻ1 deltaF311 1 Ͻ1 F311L 1 Ͻ1 L320V 1 Ͻ1 T351S 1 Ͻ1 R352W 1 Ͻ1 1248 ϩ 1GϾA 1 Ͻ1 1249 - 29delAT 1 Ͻ1 1288insTA 1 Ͻ1 1341 ϩ 80GϾA 1 Ͻ1 1429del7 1 Ͻ1 1525 - 42GϾA 1 Ͻ1 P439S 1 Ͻ1 1717 - 1GϾA 1 Ͻ1 1811 ϩ 1GϾA 1 Ͻ1 deltaI507 1 Ͻ1 G551D 1 Ͻ1 A559T 1 Ͻ1 Y563N 1 Ͻ1 (Table continues) In this study, we used temporal temperature gradient gel electrophoresis (TTGE) and direct DNA sequencing to increase the sensitivity of mutation detection in U.S. Hispanics, and to determine whether additional mutations are recurrent. Login to comment

[hide] CFTR Cl- channel function in native human colon co... Gastroenterology. 2004 Oct;127(4):1085-95. Hirtz S, Gonska T, Seydewitz HH, Thomas J, Greiner P, Kuehr J, Brandis M, Eichler I, Rocha H, Lopes AI, Barreto C, Ramalho A, Amaral MD, Kunzelmann K, Mall M
CFTR Cl- channel function in native human colon correlates with the genotype and phenotype in cystic fibrosis.
Gastroenterology. 2004 Oct;127(4):1085-95., [PMID:15480987]

Abstract [show]
BACKGROUND & AIMS: Cystic fibrosis (CF) is caused by over 1000 mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene and presents with a widely variable phenotype. Genotype-phenotype studies identified CFTR mutations that were associated with pancreatic sufficiency (PS). Residual Cl- channel function was shown for selected PS mutations in heterologous cells. However, the functional consequences of most CFTR mutations in native epithelia are not well established. METHODS: To elucidate the relationships between epithelial CFTR function, CFTR genotype, and patient phenotype, we measured cyclic adenosine monophosphate (cAMP)-mediated Cl- secretion in rectal biopsy specimens from 45 CF patients who had at least 1 non-DeltaF508 mutation carrying a wide spectrum of CFTR mutations. We compared CFTR genotypes and clinical manifestations of CF patients who expressed residual CFTR-mediated Cl- secretion with patients in whom Cl- secretion was absent. RESULTS: Residual anion secretion was detected in 40% of CF patients, and was associated with later disease onset (P < 0.0001), higher frequency of PS (P < 0.0001), and less severe lung disease (P < 0.05). Clinical outcomes correlated with the magnitude of residual CFTR activity, which was in the range of approximately 12%-54% of controls. CONCLUSIONS: Specific CFTR mutations confer residual CFTR function to rectal epithelia, which is related closely to a mild disease phenotype. Quantification of rectal CFTR-mediated Cl- secretion may be a sensitive test to predict the prognosis of CF disease and identify CF patients who would benefit from therapeutic strategies that would increase residual CFTR activity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
78 Relationship Between the CFTR Genotype and Cl- Channel Function in Native Rectal Epithelia CFTR genotype Number of individuals Sweat Cl-concentration (mmol/L)a cAMP-mediated response Carbachol-induced plateau response or maximal lumen-negative response Isc-cAMP (␮A/cm2) Cl- secretion (% of control) Isc-carbachol (␮A/cm2) Cl- secretion (% of control) Cl- secretion absent R1162X/Q552X 1 71 17.1 0 0.7 0 W1282X/3121-2AϾG 1 112 1.9 0 0.6 0 1898 ϩ 1G Ͼ T/1609delCA 2b 114, 118 25.4, 13.4 0, 0 0, 0.7 0, 0 ⌬F508/Q39X 2b 127, 129 2.6, 4.4 0, 0 1.7, 3.7 0, 0 ⌬F508/G542X 1 102 29.0 0 6.6 0 ⌬F508/R553X 3 112, 102, 109 13.1, 4.5, 23.8 0, 0, 0 1.5, 4.4, 1.0 0, 0, 0 ⌬F508/E585X 1 115 1.4 0 1.1 0 ⌬F508/Q637X 1 100 2.9 0 1.2 0 ⌬F508/Y1092X 1 119 0.0 0 -0.3 0 ⌬F508/120del23c 1 72 20.1 0 3.3 0 ⌬F508/182delT 1 116 10.8 0 5.2 0 ⌬F508/3905insT 2 88, 96 8.4, 5.6 0, 0 2.3, -1.1 0, 1 ⌬F508/V520F 1 68 1.2 0 1.7 0 ⌬F508/A561E 3 113, 146, 100 17.0, 17.0, 16.0 0, 0, 0 2.1, 1.5, 3.7 0, 0, 0 ⌬F508/R1066C 1 138 0.0 0 0.0 0 ⌬F508/N1303K 3 100, 117, 94 1.7, 4.1, 1.5 0, 0, 0 -0.6, 2.2, 0.8 0, 0, 0 A561E/A561E 2 101, 116 6.6, 2.0 0, 0 7.3, 3.3 0, 0 Residual Cl- secretiond G542X/I148N 1 75 -50.1 54 -22.2 12 1898 ϩ 3A Ͼ G/1898 ϩ 3A Ͼ G 1 82 -36.8 39 -12.9 7 ⌬F508/3272-26A Ͼ G 1 116 -17.8 19 -27.2 14 ⌬F508/S108F 1 118 -15.8 17 -12.3 7 ⌬F508/R117H 1 90 -35.9 38 -207.7 109 ⌬F508/Y161Cc 1 44 -35.1 37 -45.9 25 ⌬F508/P205S 1 80 -23.3 25 -10.4 5 ⌬F508/V232D 1 120 -16.9 18 -26.9 14 ⌬F508/R334W 1 92 -22.1 23 -21.1 11 ⌬F508/R334W 1 101 -24.5 26 -37.4 20 ⌬F508/T338I 1 73 -44.4 47 -79.4 42 ⌬F508/G576A 1 40 -16.9 18 -115.5 61 ⌬F508/I1234V 1 113 -13.6 15 -8.6 5 G576A/G85E 1 95 -26.1 28 -61.6 32 F1052V/M1137R 1 47 -36.7 39 -146.6 77 M1101K/M1101K 1 94 -11.1 12 -4.8 3 S1159F/S1159F 1 67 -47.9 51 -38.7 21 N1303K/R334W 1 91 -30.3 32 -47.7 25 NOTE. CFTR Cl- channel function was determined in rectal epithelia from Cl- secretory responses induced by IBMX/forskolin (Isc-cAMP) and after co-activation with carbachol (Isc-carbachol). Login to comment
101 Functional Classification and Protein Location of CFTR Mutations Mutation type Severe mutations (protein location) Mild mutations (protein location) Missense V520F, A561E (NBD1) G85E (MSD1, TM1) R1066C (MSD2, CL4) S108F, R117H (MSD1, EL1) N1303K (NBD2) I148N, Y161Ca (MSD1, CL1) P205S (MSD1, TM3) V232D (MSD1, TM4) R334W, T338I (MSD1, TM6) G576A (NBD1) I1234V (NBD2) F1052V, M1101K (MSD2, CL4) M1137R (MSD2, TM12) S1159F (pre-NBD2) Splice 1898 ϩ 1G Ͼ T (R domain) 1898 ϩ 3A Ͼ G (R domain) 3121-2A Ͼ G (MSD2, TM9) 3272-26A Ͼ G (MSD2, TM10) Single amino acid deletion ⌬F508 (NBD1) Nonsense Q39X (N-terminus) G542X, Q552X, R553X, E585X (NBD1) Q637X (R domain) Y1092X (MSD2, CL4) R1162X (pre-NBD2) W1282X (NBD2) Frameshift 120del23a 182delT (N-terminus) 1609delCA (NBD1) 3905insT (NBD2) NOTE. Severe mutation, Cl- secretion absent; mild mutation, residual cAMP-mediated Cl- secretion. Login to comment
123 Residual function also was observed for mutants, which are expected to form membrane Cl- channels that are reduced in number, either owing to improper protein maturation (P205S, M1137R) or owing to reduced levels of full-length CFTR messenger RNA (3272-26AϾG, G576A).32,38 - 40 The only exception was M1101K, which was reported as a loss of function mutation in heterologous cells34 and was associated with residual CFTR function in the 1 homozygous patient studied (Table 1). Login to comment

[hide] Spectrum of CFTR mutations in cystic fibrosis and ... Hum Mutat. 2000;16(2):143-56. Claustres M, Guittard C, Bozon D, Chevalier F, Verlingue C, Ferec C, Girodon E, Cazeneuve C, Bienvenu T, Lalau G, Dumur V, Feldmann D, Bieth E, Blayau M, Clavel C, Creveaux I, Malinge MC, Monnier N, Malzac P, Mittre H, Chomel JC, Bonnefont JP, Iron A, Chery M, Georges MD
Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France.
Hum Mutat. 2000;16(2):143-56., [PMID:10923036]

Abstract [show]
We have collated the results of cystic fibrosis (CF) mutation analysis conducted in 19 laboratories in France. We have analyzed 7, 420 CF alleles, demonstrating a total of 310 different mutations including 24 not reported previously, accounting for 93.56% of CF genes. The most common were F508del (67.18%; range 61-80), G542X (2.86%; range 1-6.7%), N1303K (2.10%; range 0.75-4.6%), and 1717-1G>A (1.31%; range 0-2.8%). Only 11 mutations had relative frequencies >0. 4%, 140 mutations were found on a small number of CF alleles (from 29 to two), and 154 were unique. These data show a clear geographical and/or ethnic variation in the distribution of the most common CF mutations. This spectrum of CF mutations, the largest ever reported in one country, has generated 481 different genotypes. We also investigated a cohort of 800 French men with congenital bilateral absence of the vas deferens (CBAVD) and identified a total of 137 different CFTR mutations. Screening for the most common CF defects in addition to assessment for IVS8-5T allowed us to detect two mutations in 47.63% and one in 24.63% of CBAVD patients. In a subset of 327 CBAVD men who were more extensively investigated through the scanning of coding/flanking sequences, 516 of 654 (78. 90%) alleles were identified, with 15.90% and 70.95% of patients carrying one or two mutations, respectively, and only 13.15% without any detectable CFTR abnormality. The distribution of genotypes, classified according to the expected effect of their mutations on CFTR protein, clearly differed between both populations. CF patients had two severe mutations (87.77%) or one severe and one mild/variable mutation (11.33%), whereas CBAVD men had either a severe and a mild/variable (87.89%) or two mild/variable (11.57%) mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
107 f 306insA, W79X, R117C, P205S, L227R, I336K, 1248+1G>A, 1609delCA, 1717-8G>A, S549R(T>G), S549N, 1812-1G>A, P574H, 2176insC, R709X, E827X, D836Y, 3007delG, L1065P, L1077P, H1085R, M1101K, 4021insT. Login to comment

[hide] Transmembrane domain of cystic fibrosis transmembr... Biochemistry. 1998 Jan 20;37(3):844-53. Wigley WC, Vijayakumar S, Jones JD, Slaughter C, Thomas PJ
Transmembrane domain of cystic fibrosis transmembrane conductance regulator: design, characterization, and secondary structure of synthetic peptides m1-m6.
Biochemistry. 1998 Jan 20;37(3):844-53., [PMID:9454574]

Abstract [show]
Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) give rise to cystic fibrosis (CF), the most common genetic disease in the Caucasian population. CFTR is organized into five putative domains, including two that are predicted to be transmembrane and consist of six membrane-spanning segments each. CFTR mediates regulated anion transport across the apical membrane of epithelial cells. The pore through which CFTR transports its solutes is thought to be formed by some combination of the amino-terminal membrane-spanning segments. Although these sequences are predicted to be alpha-helical in secondary structure, to date, no direct structural evidence has been presented testing this hypothesis. Here, we present the biophysical characterization of six peptides (m1-m6) representing the predicted amino-terminal membrane-spanning domain of CFTR. The peptides can be incorporated into liposomes and are soluble in SDS micelles and trifluoroethanol (TFE). FTIR and CD spectroscopy indicate all six peptides adopt a stable, predominantly alpha-helical secondary structure in these environments. In contrast, peptide m6 undergoes a shift from alpha-helix to beta-sheet when dissolved in 20% methanol. Additionally, the peptides show an increase in beta-sheet in TFE, a known inducer of alpha-helices, relative to that seen in the nativelike environments. These results have implications for the folding of this complex membrane protein and suggest that the possible functional role of m6 is manifested through a shift in secondary structure.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
261 The critical importance of this intramembrane residue to CFTR structure is highlighted by the CF-causing mutation of proline 205 to serine (54), which prevents proper folding and processing of CFTR (52) and causes a form of cystic fibrosis similar to other misprocessing mutants such as A455E and P574H (55). Login to comment

[hide] Cystic fibrosis phenotype associated with pancreat... J Biol Chem. 1997 Nov 28;272(48):30563-6. Fanen P, Labarthe R, Garnier F, Benharouga M, Goossens M, Edelman A
Cystic fibrosis phenotype associated with pancreatic insufficiency does not always reflect the cAMP-dependent chloride conductive pathway defect. Analysis of C225R-CFTR and R1066C-CFTR.
J Biol Chem. 1997 Nov 28;272(48):30563-6., [PMID:9374552]

Abstract [show]
We have previously screened the cystic fibrosis transmembrane conductance regulator (CFTR) gene and identified new disease-causing mutations. C225R and R1066C are both associated with pancreatic insufficiency, but the former mutation is associated with mild and unusual lung disease, whereas the latter is associated with severe lung disease. In the present study, we expressed these mutants heterologously in HeLa cells, and we analyzed protein synthesis by immunoprecipitation and chloride channel function by using a halide-sensitive fluorescent dye, 6-methoxy-N-ethylquinolinium. Immunoprecipitation and functional studies showed that cells transfected with C225R-CFTR exhibit cAMP-dependent chloride fluxes; C225R-CFTR protein is poorly expressed but fully glycosylated and can be compared with R117H-CFTR. R1066C-CFTR protein is not correctly processed and, unlike DeltaF508-CFTR, this defect cannot be corrected by reduced temperature or overexpression in butyrate-treated cells; defective processing may occur at a different step in the biosynthetic pathway. These results point to two different mechanisms underlying the same pancreatic status and suggest that it is unwise to use pancreatic sufficiency and insufficiency to define mild and severe cystic fibrosis (CF) disease, respectively. Finally, the experimental model described here may be helpful to predict the pulmonary status of CF patients bearing mutations located in putative membrane-spanning domains of the CFTR protein.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
101 Six CF-associated mutations (P99L, R117H, P205S, R334W, R347P, and R347H) located in putative membrane-spanning domains that have already been analyzed for their functional properties (2-5) were all associated with a mild phenotype (pancreatic sufficiency, PS). Login to comment

[hide] Genotype-phenotype relationships in a cohort of ad... Eur Respir J. 1996 Nov;9(11):2207-14. Hubert D, Bienvenu T, Desmazes-Dufeu N, Fajac I, Lacronique J, Matran R, Kaplan JC, Dusser DJ
Genotype-phenotype relationships in a cohort of adult cystic fibrosis patients.
Eur Respir J. 1996 Nov;9(11):2207-14., [PMID:8947061]

Abstract [show]
In cystic fibrosis (CF), relationships between genotype and phenotype have been shown for pancreatic status but not for pulmonary disease. One hundred and ten adult CF patients were classified according to the expected effect of their mutations on cystic fibrosis transmembrane conductance regulator (CFTR) protein: Group 1 (n=48) included deltaF508 homozygotes; Group 2 (n=26), patients with two "severe" mutations and no expected CFTR production; Group 3 (n=17), patients with expected partly functional CFTR corresponding to at least one "mild" mutation; Group 4 (n=19), patients with no mutation identified or only one identified "severe" mutation. As compared to Groups 1 and 2: patients from Groups 3 and 4 had higher arterial oxygen tension (Pa,O2) (9.5+/-1.9 and 9.9+/-1.5 vs 8.8+/-1.5 and 8.3+/-1.7 kPa, respectively p<0.02); and a slower decline in their pulmonary function, estimated by the mean annual loss in forced vital capacity (FVC) (1.2+/-1.0 and 1.5+/-1.1 vs 2.0+/-0.9 and 2.2+/-1.0%, respectively; p<0.01) and in forced expiratory volume in one second (FEV1) (1.7+/-1.1 and 1.9+/-1.3 vs 2.6+/-1.0 and 2.8+/-1.0%, respectively; p<0.005). They had fewer episodes of colonization of the airways by Pseudomonas aeruginosa, and colonization occurred at a more advanced age (median age 25 and 19 vs 15 and 17 yrs, respectively; p<0.01) and required fewer intravenous antibiotic courses (p<0.01). Pancreatic insufficiency was less frequent in Groups 3 (23%) and 4 (63%) than in Groups 1 (100%) and 2 (96%). This study suggests that the phenotype of adult cystic fibrosis patients, including the severity of the lung disease, is related to the severity of the cystic fibrosis transmembrane conductance regulator mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
77 - Genotype of the 110 CF patients: details of the CF mutations and classification into four groups Genotype Genotype Pts groups n 1 ∆F508/∆F508 48* 2 ∆F508/G542X 6 ∆F508/E827X 3† ∆F508/R553X 2 ∆F508/W1282X 2 ∆F508/E595X 1 ∆F508/E60X 1 ∆F508/W846X 1 ∆F508/1078delT 1 ∆F508/2143delT 1 ∆F508/2347delG 1 ∆F508/3659delC 1 ∆F508/4382delA 1 ∆F508/2183 AA→G 1 ∆F508/1717-1 G→A 1 ∆F508/1811+1.6 kb A→G 1 E595X/Y1092X 1 1717-1 G→A/1078delT 1 3 ∆F508/I336K 1 ∆F508/G27E 1 ∆F508/D192N 1 ∆F508//I980K 1 ∆F508/P205S 1 ∆F508/2789+5 G→A 1 ∆F508/3272-26 A→G 1 G542X/3849+10 kb C→T 2‡ G542X/2789+5 G→A 1 W361R/297-3 C→T 1 G551D/1717-1 G→A 1 N1303H/2183 AA→G 1 2789+5 G→A/2183 AA→G 1 R1070Q/D1152H 1 R1070Q/unidentified 1 S1251N/unidentified 1 4 ∆F508/unidentified 7 ∆I507/unidentified 2 1811+1.6 kb A→G/unidentified 1 1161delC/unidentified 1 unidentified/unidentified 8 *: two patients are brothers; †: three brothers; ‡: two sisters. Login to comment

[hide] Thirteen cystic fibrosis patients, 12 compound het... J Med Genet. 1996 Oct;33(10):820-2. Vazquez C, Antinolo G, Casals T, Dapena J, Elorz J, Seculi JL, Sirvent J, Cabanas R, Soler C, Estivill X
Thirteen cystic fibrosis patients, 12 compound heterozygous and one homozygous for the missense mutation G85E: a pancreatic sufficiency/insufficiency mutation with variable clinical presentation.
J Med Genet. 1996 Oct;33(10):820-2., [PMID:8933333]

Abstract [show]
To study the severity of mutation G85E, located in the first membrane spanning domain of the CFTR gene, we studied the clinical features of 13 Spanish patients with cystic fibrosis (CF) carrying this mutation. G85E accounts for about 1% of Spanish CF alleles. One patient was homozygous G85E/G85E and the rest were compound heterozygotes for G85E and other mutations (delta F508 nine patients, delta I507 two patients, and 712-1G > T one patient). The characteristics of the pooled G85E/any mutation group were compared with those of 30 delta F508 homozygotes. Mean age at diagnosis and percentage of ideal height for age were higher in the G85E/any mutation group (4.2 (SD 4.7) v 2.4 (SD 2.3), p < 0.05, and 102.8 (SD 4.7) v 97.8 (SD 4.1), p < 0.01), both probably related to the greater prevalence of pancreatic sufficiency (70% v 0%, p < 0.01). The G85E homozygote was pancreatic sufficient. Sweat sodium levels were slightly higher, and salt loss related problems more frequent, in the G85E/any group. Two of the G85E patients died of respiratory failure aged 6 and 14 years. Striking discordance in the phenotype was observed in two pairs of sibs, one of them dizygotic twins, suggesting that factors, genetic and environmental, other than CFTR genotype are important in determining CF phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
105 Identification of a new missense mutation (P205S) in the first transmembrane domain of the CFTR gene associated with a mild cystic fibrosis phenotype. Login to comment
103 Identification of a new missense mutation (P205S) in the first transmembrane domain of the CFTR gene associated with a mild cystic fibrosis phenotype. Login to comment

[hide] Contribution of proline residues in the membrane-s... J Biol Chem. 1996 Jun 21;271(25):14995-5001. Sheppard DN, Travis SM, Ishihara H, Welsh MJ
Contribution of proline residues in the membrane-spanning domains of cystic fibrosis transmembrane conductance regulator to chloride channel function.
J Biol Chem. 1996 Jun 21;271(25):14995-5001., [PMID:8663008]

Abstract [show]
Proline residues located in membrane-spanning domains of transport proteins are thought to play an important structural role. In the cystic fibrosis transmembrane conductance regulator (CFTR), the predicted transmembrane segments contain four prolines: Pro99, Pro205, Pro324, and Pro1021. These residues are conserved across species, and mutations of two (P99L and P205S) are associated with cystic fibrosis. To evaluate the contribution of these prolines to CFTR Cl- channel function, we mutated each residue individually to either alanine or glycine or mutated all four simultaneously to alanine (P-Quad-A). We also constructed the two cystic fibrosis-associated mutations. cAMP agonists stimulated whole cell Cl- currents in HeLa cells expressing the individual constructs that resembled those produced by wild-type CFTR. However, the amount of current was decreased in the rank order: wild-type CFTR = Pro324 > Pro1021 > Pro99 >/= Pro205 mutants. The anion selectivity sequence of the mutants (Br- >/= Cl- > I-) resembled wild-type except for P99L (Br- >/= Cl- = I-). Although the Pro99, Pro324, and Pro1021 mutants produced mature protein, the amount of mature protein was much reduced with the Pro205 mutants, and the P-Quad-A made none. Because the Pro99 constructs produced mature protein but had altered whole cell currents, we investigated their single-channel properties. Mutant channels were regulated like wild-type CFTR; however, single-channel conductance was decreased in the rank order: wild-type CFTR >/= P99G > P99L >/= P99A. These results suggest that proline residues in the transmembrane segments are important for CFTR function, Pro205 is critical for correct protein processing, and Pro99 may contribute either directly or indirectly to the Cl- channel pore.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 These residues are conserved across species, and mutations of two (P99L and P205S) are associated with cystic fibrosis. Login to comment
23 These residues are conserved across species and mutations of two (P99L and P205S) are associated with cystic fibrosis (CF) (12, 13). Login to comment
24 Because P99L and P205S are associated with a milder clinical phenotype characterized by retention of some pancreatic function (termed pancreatic sufficiency) (2), these mutants may retain some residual Cl- channel function. Based on the above information, the aims of this study were to determine the contribution of proline residues located within the MSDs of CFTR to Cl- channel function and to understand how P99L and P205S cause a loss of Cl- channel function. Login to comment
76 Cyclic AMP agonists activated whole cell currents in cells expressing each of the individual proline to alanine or glycine mutations and in cells expressing the CF-associated mutations, P99L and P205S. Login to comment
77 As an example, Fig. 2 shows data from studies of P99A, P99G, and P99L; qualitatively similar results were obtained with the Pro205 , Pro324 , and Pro1021 mutants (data not shown). Login to comment
122 Mutant n Px/PCl Gx/GCl Br- Cl- IBr- ClI- CFTR 5 1.18 Ϯ 0.08 1.00 0.73 Ϯ 0.05 1.27 Ϯ 0.16 1.00 0.61 Ϯ 0.08 P99A 7 0.98 Ϯ 0.03 1.00 0.70 Ϯ 0.06 1.04 Ϯ 0.05 1.00 0.72 Ϯ 0.05 P99G 5 1.06 Ϯ 0.02 1.00 0.75 Ϯ 0.08 1.04 Ϯ 0.07 1.00 0.66 Ϯ 0.05 P99L 5 1.21 Ϯ 0.07 1.00 1.06 Ϯ 0.07 1.33 Ϯ 0.11 1.00 0.95 Ϯ 0.08 P205A 4 1.09 Ϯ 0.07 1.00 0.64 Ϯ 0.09 0.95 Ϯ 0.04 1.00 0.46 Ϯ 0.11 P205G 5 1.09 Ϯ 0.05 1.00 0.45 Ϯ 0.05 1.05 Ϯ 0.03 1.00 0.44 Ϯ 0.06 P205S 2 1.01 Ϯ 0.01 1.00 0.55 Ϯ 0.28 1.09 Ϯ 0.09 1.00 0.59 Ϯ 0.08 P324A 7 1.08 Ϯ 0.04 1.00 0.72 Ϯ 0.06 1.15 Ϯ 0.07 1.00 0.60 Ϯ 0.08 P324G 6 1.12 Ϯ 0.07 1.00 0.69 Ϯ 0.04 1.22 Ϯ 0.14 1.00 0.57 Ϯ 0.04 P1021A 3 1.15 Ϯ 0.17 1.00 0.73 Ϯ 0.11 1.17 Ϯ 0.10 1.00 0.47 Ϯ 0.19 P1021G 7 1.17 Ϯ 0.06 1.00 0.78 Ϯ 0.02 1.21 Ϯ 0.08 1.00 0.59 Ϯ 0.06 though for P99G the reduction was small, for P99A and P99L the effect was marked. Login to comment
126 The conductance for P99G was 7.31 Ϯ 0.24 pS (n ϭ 5), not significantly different from wild type (p ϭ 0.26). Login to comment
145 The number of cells responding to cAMP agonists with Cl- current activation relative to the total number of cells tested for each construct was: CFTR (8/16; 50%), P99A (11/12; 92%), P99G (9/19; 47%), P99L (10/19; 53%), P205A (7/12; 58%), P205G (5/9; 56%), P205S (7/20; 35%), P324A (9/18; 50%), P324G (9/22; 41%), P1021A (8/18; 44%), and P1021G (7/16; 44%). Login to comment
206 Implications for Cystic Fibrosis-P99L and P205S are CF mutations located in MSD1 that are associated with a milder (pancreatic sufficiency) clinical phenotype (12, 13). Login to comment
207 Our studies of the processing and function of P99L and P205S explain why these mutants generate less Cl- current than wild-type CFTR. Login to comment
208 Loss of Cl- channel function caused by P205S was predominantly a result of defective protein processing; whereas that caused by P99L was a consequence of both defective protein processing and altered Cl- channel function. Login to comment
212 This suggests that the defective processing of the P205S mutant observed in HeLa cells likely accounts for the loss of Cl- channel function in patients bearing this mutation. Login to comment
215 The present results complement and extend our previous study of mild CF mutants located in MSD1 (R117H, R334W, and R347P). Login to comment
217 The mechanism of dysfunction of P205S resembles that of the nucleotide-binding domain 1 pancreatic sufficiency mutants A455E and P574H, which are misprocessed (23). Login to comment
149 The number of cells responding to cAMP agonists with Cl2 current activation relative to the total number of cells tested for each construct was: CFTR (8/16; 50%), P99A (11/12; 92%), P99G (9/19; 47%), P99L (10/19; 53%), P205A (7/12; 58%), P205G (5/9; 56%), P205S (7/20; 35%), P324A (9/18; 50%), P324G (9/22; 41%), P1021A (8/18; 44%), and P1021G (7/16; 44%). Login to comment
214 Implications for Cystic Fibrosis-P99L and P205S are CF mutations located in MSD1 that are associated with a milder (pancreatic sufficiency) clinical phenotype (12, 13). Login to comment
216 Loss of Cl2 channel function caused by P205S was predominantly a result of defective protein processing; whereas that caused by P99L was a consequence of both defective protein processing and altered Cl2 channel function. Login to comment
220 This suggests that the defective processing of the P205S mutant observed in HeLa cells likely accounts for the loss of Cl2 channel function in patients bearing this mutation. Login to comment
225 The mechanism of dysfunction of P205S resembles that of the nucleotide-binding domain 1 pancreatic sufficiency mutants A455E and P574H, which are misprocessed (23). Login to comment

[hide] Haplotype analysis of 94 cystic fibrosis mutations... Hum Mutat. 1996;8(2):149-59. Morral N, Dork T, Llevadot R, Dziadek V, Mercier B, Ferec C, Costes B, Girodon E, Zielenski J, Tsui LC, Tummler B, Estivill X
Haplotype analysis of 94 cystic fibrosis mutations with seven polymorphic CFTR DNA markers.
Hum Mutat. 1996;8(2):149-59., [PMID:8844213]

Abstract [show]
We have analyzed 416 normal and 467 chromosomes carrying 94 different cystic fibrosis (CF) mutations with polymorphic genetic markers J44, IVS6aGATT, IVS8CA, T854, IVS17BTA, IVS17BCA, and TUB20. The number of mutations found with each haplotype is proportional to its frequency among normal chromosomes, suggesting that there is no preferential haplotype in which mutations arise and thus excluding possible selection for specific haplotypes. While many common mutations in the worldwide CF population showed absence of haplotype variation, indicating their recent origins, some mutations were associated with more than one haplotype. The most common CF mutations, delta F508, G542X, and N1303K, showed the highest number of slippage events at microsatellites, suggesting that they are the most ancient CF mutations. Recurrence was probably the case for 9 CF mutations (R117H, H199Y, R347YH, R347P, L558S, 2184insA, 3272-26A-->G, R1162X, and 3849 + 10kbC-->T). This analysis of 94 CF mutations should facilitate mutation screening and provides useful data for studies on population genetics of CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
105 CFTR Haplotypes for Diallelic and Multiallelic DNA Markers for 94 CF Mutations" J44-GATT- 8CA-17BTA- No. of T854-TUB20 17BCA Mutation chromosomes % Normal Laboratory Reference 2-7-1-2 17-47-13 (55.4%) 17-46-13 17-45-13 17-34-13 17-32-13 17-31-14 17-31-13 17-29-14 17-28-13 16-48-13 16-46-14 16-46-13 16-45-13 16-44-13 16-35-13 16-33-13 16-32-13 16-31-14 16-31-13 16-30-13 16-29-13 16-26-13 16-25-13 16-24-13 14-31-13 1-7-2-1 17-7-17 (16.8%) R334W R334W 3860ins31 G1244E R1162X R1162X R1162X G91R MllOlK R347P R334W R117C E92K 3849+lOkbC+T 3293delA 1811+1.6kb A-tG 1811+1.6kb A-tG 2184insA P205S 3659delC G673X 11005R I336K W58S R347P W846X 405+1-A G178R 3905insT R1162X R347H 3100insA E60X 1078delT 4005+1-A K710X 1677delTA H199Y 3601-2AjG 3850-3T+G 3272-26A-tG 3850-1-A 1812-1-A R117H L1059X S492F Y1092X Y569H 3732delA C866Y 711+1G+T 711+1-T G85E 1949del84 2789+5-A H1085R W1282X R1066C 2043delG V456F 2 1 1 1 2 1 6 2 2 1 2 1 1 2 1 1 4 1 1 1 3 2 1 1 1 1 1 1 2 7 1 1 1 1 2 1 1 3 19 3 3 1 1 2 1 1 5 1 1 1 1 3 6 3 5 1 13 2 1 1 - 0.48 0.48 - - - 0.24 - - - 2.65 2.40 1.93 2.65 1.68 2.65 0.72 13.94 13.46 1.93 - 0.72 0.24 3.37 - b b fP fP fP t b,fb.fP h fb t h t h h fP fP b.h b h h b h h h h h fb fb,fP.t fP fP fP9t fP b t fPh b h fb b.fb,h fb*fP b,fP h h t h fb fb,fp,h.t fP fP fb t b.fP,t b,fb,h,t b f b h h fb b,fb.fP,h fP h h Gasparini et al. (1991b) Chilldn et al. (1993a) Devoto et al. (1991) Gasparini et al. (1991b) Dork et al. (1993a) Guillermit et al. (1993) Zielenski et al. (1993) Dean et al. (1990) Dork et al. (1994a) Nunes et al. (1993) Highsmith et al. (1994) Ghanem et al. (1994) Chilldn et al. (1995) Dork et al. (1994a) Dork et al. (1993a) Chilldn et al. (1993b) Kerem et al. (1990) Dork et al. (1994a) Dork et al. (1994a) Cuppenset al. (1993) Fanen et al. (1992) Maggio et al. (personal communication) Audrezet et al. (1993) Vidaud et al. (1990) Dork et al. (1993b) Zielenski et al. (1991a) Chilldn et al. (1994b) Malik et al. (personal communication) Cremonesi et at. Login to comment

[hide] A novel donor splice site in intron 11 of the CFTR... Am J Hum Genet. 1995 Mar;56(3):623-9. Chillon M, Dork T, Casals T, Gimenez J, Fonknechten N, Will K, Ramos D, Nunes V, Estivill X
A novel donor splice site in intron 11 of the CFTR gene, created by mutation 1811+1.6kbA-->G, produces a new exon: high frequency in Spanish cystic fibrosis chromosomes and association with severe phenotype.
Am J Hum Genet. 1995 Mar;56(3):623-9., [PMID:7534040]

Abstract [show]
mRNA analysis of the cystic fibrosis transmembrane regulator (CFTR) gene in tissues of cystic fibrosis (CF) patients has allowed us to detect a cryptic exon. The new exon involves 49 base pairs between exons 11 and 12 and is due to a point mutation (1811+1.6kbA-->G) that creates a new donor splice site in intron 11. Semiquantitative mRNA analysis showed that 1811+1.6kbA-->G-mRNA was 5-10-fold less abundant than delta F508 mRNA. Mutation 1811+1.6kbA-->G was found in 21 Spanish and 1 German CF chromosomes, making it the fourth-most-frequent mutation (2%) in the Spanish population. Individuals with genotype delta F508/1811+1.6kbA-->G have only 1%-3% of normal CFTR mRNA. This loss of 97% of normal CFTR mRNA must be responsible for the pancreatic insufficiency and for the severe CF phenotype in these patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
111 Three CF patients carried mutation P205S on the other chromosome, which is associated with a mild CF phenotype and pancreatic sufficiency (Chillon et al. 1993). Login to comment
125 of patients ...................... 17 3 82 Age (years) ...................... 9.1 ± 5.8 12 ± 5.3 7.8 ± 5.2 Age at diagnosis (years) ............... 2.8 ± 4.0 7.1 ± 5.2 2.2 ± 2.8 Sweat chloride (mmolIL) ............. 98 ± 11.7 100 ± 10 104.4 ± 15.7 FEV1 (% predicted)d .................... 65 ± 24.8 70.8 ± 12.8 74.8 ± 23.1 Shwachman score' ...................... 74.5 ± 12.3 86.6 ± 2.3 83.1 ± 11.8 Pancreatic sufficiency ................... 0/19 (0%) 3/3 (100%) 1/82 (1.2%) a A1507, AF508, 1609delCA, G542X, K710X, and N1303K. Login to comment
126 b Mutation P205S has been described as associated with a mild CF phenotype and pancreatic sufficiency. Login to comment
110 Three CF patients carried mutation P205S on the other chromosome, which is associated with a mild CF phenotype and pancreatic sufficiency (Chillon et al. 1993). Login to comment

[hide] Extensive analysis of 40 infertile patients with c... Hum Genet. 1995 Feb;95(2):205-11. Casals T, Bassas L, Ruiz-Romero J, Chillon M, Gimenez J, Ramos MD, Tapia G, Narvaez H, Nunes V, Estivill X
Extensive analysis of 40 infertile patients with congenital absence of the vas deferens: in 50% of cases only one CFTR allele could be detected.
Hum Genet. 1995 Feb;95(2):205-11., [PMID:7532150]

Abstract [show]
Mutations in the cystic fibrosis (CF) conductance transmembrane regulator (CFTR) gene have been detected in patients with CF and in males with infertility attributable to congenital bilateral absence of the vas deferens (CBAVD). Thirty individuals with CBAVD and 10 with congenital unilateral absence of the vas deferens (CUAVD) were analyzed by single-strand conformation analysis and denaturing gradient gel electrophoresis for mutations in most of the CFTR gene. All 40 individuals were pancreatic sufficient, but twenty patients had recurrent or sporadic respiratory infections, asthma/asthmatic bronchitis, and/or rhino-sinusitis. Agenesia or displasia of one or both seminal vesicles was detected in 30 men and other urogenital malformations were present in six subjects. Among the 40 samples, we identified 13 different CFTR mutations, two of which were previously unknown. One new mutation in exon 4 was the deletion of glutamic acid at codon 115 (delta E115). A second new mutation was found in exon 17b, viz., an A --> C substitution at position 3311, changing lysine to threonine at codon 1060 (K1060T). CFTR mutations were detected in 22 out of 30 (73.3%) CBAVD patients and in one out of 10 (10%) CUAVD individuals, showing a significantly lower incidence of CFTR mutations in CBAVD/CUAVD patients (P << 0.0001), compared with that found in the CF patient population. Only three CBAVD patients were found with more than one CFTR mutation (delta F508/L206W, delta F508/R74W + D1270N, R117H/712-1G --> T), highlighting L206W, R74W/D1270N, and R117H as benign CF mutations. Sweat electrolyte values were increased in 76.6% of CBAVD patients, but three individuals without CFTR mutations had normal sweat electrolyte levels (10% of the total CBAVD patients), suggesting that factors other than CFTR mutations are involved in CBAVD. The failure to identify a second mutation in exons and their flanking regions of the CFTR gene suggests that these mutations could be located in introns or in the promoter region of CFTR. Such mutations could result in CFTR levels below the minimum 6%-10% necessary for normal protein function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
143 Cell 63:827-837 Chill6n M, Casals T, Nunes V, Gimdnez J, Pdrez Ruiz E, Estivill X (1993) Identification of a new missense mutation (P205S) in the first transmembrane domain of the CFTR gene associated with a mild cystic fibrosis phenotype. Login to comment

[hide] Analysis of the CFTR gene confirms the high geneti... Hum Genet. 1994 Apr;93(4):447-51. Chillon M, Casals T, Gimenez J, Ramos MD, Palacio A, Morral N, Estivill X, Nunes V
Analysis of the CFTR gene confirms the high genetic heterogeneity of the Spanish population: 43 mutations account for only 78% of CF chromosomes.
Hum Genet. 1994 Apr;93(4):447-51., [PMID:7513293]

Abstract [show]
We have analysed 972 unrelated Spanish cystic fibrosis patients for 70 known mutations. Analysis was performed on exons 1, 2, 3, 4, 5, 6a, 6b, 7, 10, 11, 12, 13, 14a, 14b, 15, 16, 17b, 18, 19, 20 and 21 of the cystic fibrosis transmembrane regulator gene using single strand conformation polymorphism analysis and denaturing gradient gel electrophoresis. The major mutation delta F508 accounts for 50.6% of CF chromosomes, whereas another 42 mutations account for 27.6% of CF chromosomes, with 21.8% of Spanish CF chromosomes remaining uncharacterized. At present, we have identified 36 mutations that have frequency of less than 1% and that are spread over 15 different exons. This indicates that, in the Spanish population, with the exception of delta F508 (50.6%) and G542X (8%), the mutations are not concentrated in a few exons of the gene nor are there any predominating mutations. This high degree of genetic heterogeneity is mainly a result of the different ethnic groups that have populated Spain and of the maintenance of separated population sets (Basques, Arab-Andalusian, Mediterranean, Canarian and Gallician). The high proportion of CF chromosomes still unidentified (21.8%) together with association analysis with intragenic markers suggest that at least 100 different mutations causing CF are present in our population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
41 A Exon 13 4 0.41 621-1 G--~T Intron 4 3 0.31 P205S Exon 6a 3 0.31 936 del TA Exon 6b 3 0.31 1949 del 84 Exon 13 3 0.31 K710X Exon 13 3 0.31 CF del #1 Exon 4-7/11-18 3 0.31 L206W Exon 6a 2 0.20 R347H Exon 7 2 0.20 Y1092X Exon 17b 2 0.20 Q1100P Exon 17b 2 0.20 Q30X Exon 2 1 0.10 E92K Exon 4 1 0.10 A120T Exon 4 1 0.10 I148T Exon 4 1 0.10 H199Y Exon 6a 1 0.10 1078 del T Exon 7 1 0.10 1717-1 G--+A Intron 10 1 0.10 T582R Exon 12 1 0.10 E585X Exon 12 1 0.10 1898+3 A~---G Intron 12 1 0.10 W1098X Exon 17b 1 0.10 R1158X Exon 19 1 0.10 3667 del 4 Exon 19 1 0.10 3860 ins 31 Exon 20 1 0.10 3905 ins T Exon 20 1 0.10 Unknown 212 21.81 The Basque subset The Basques have a different genetic background with respect to other ethnic groups (Pancorbo et al. 1989) as they are the only pre-Indoeuropean group in Spain. Login to comment

[hide] Identification of a new missense mutation (P205S) ... Hum Mol Genet. 1993 Oct;2(10):1741-2. Chillon M, Casals T, Nunes V, Gimenez J, Perez Ruiz E, Estivill X
Identification of a new missense mutation (P205S) in the first transmembrane domain of the CFTR gene associated with a mild cystic fibrosis phenotype.
Hum Mol Genet. 1993 Oct;2(10):1741-2., [PMID:7505694]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1 10 -1742 Identification of a new missense mutation (P205S) in the first transmembrane domain of the CFTR gene associated with a mild cystic fibrosis phenotype Miguel Chilldn, Teresa Casals, Virginia Nunes, Javier Gimenez, Estela Perez Ruiz1 and Xavier Estivill* Molecular Genetics Department Cancer Research Institute, Hospital Duran i Reynals, Autovte de Castefldefete Km. 2.7, L'Hospttalet de Uobregat, 08907 Barcelona and 1 Servtao de Neumotogla infantil, Hospital Matemo infants, Malaga, Spain Received June 11, "1993; Revised and Accepted July 26, 1993 Since the cloning of the CFTR gene in 1989 more than 300 cystic fibrosis (CF) mutations have been identified (ref. Login to comment
7 We report here, a new missense mutation (P205S) in the first transmembrane domain of the CFTR gene, which is associated with a mild CF phenotype, pancreatic sufficiency and without gastrointestinal symptoms. Login to comment
8 Mutation P205S was identified, in one patient, in exon 6a, after SSCP analysis of 20 exons of theCT77?gene (1-7, 10-14a, 15-16, and 17b-21) in a panel of 40 unrelated Spanish CF patients. Login to comment
9 Further association of P205S with CFTR microsatellites (4) and screening in a large sample of Spanish CF chromosomes were performed. Login to comment
20 Direct sequencing of the sample, using primers 6ai-5 and 6ai-3, showed a C to T substitution at nucleotide 745 that replaces serine with proline at codon 205 (mutation P205S) (Figure 1). Login to comment
22 P205S does not affect any restriction enzyme site and it was found associated with haplotype 16-44-13 (TVS8CA-IVS17BTA-IVS17BCA) (4). Login to comment
23 For a rapid screening of the mutation, we designed a mutagenesis primer (6) E6XD1 5'-TGGCACATTTCGTGTGAATCGC-3', which creates a Xmnl site if the change C to T, that leads to P205S, is present. Login to comment
24 Screening of mutation P205S in our sample of CF chromosomes was partially based on its association with the microsatellite haplotype 16-44-13. Login to comment
26 A total of three independent P205S alleles were found in the sample analysed (3/950) with a final estimated frequency of 0.3%. Login to comment
27 Clinical data (Table 1) were available for four CF patients carrying mutation P205S (3 were from the same family). Login to comment
34 Clinical presentations of patients carrying P205S suggest its association with a mild CF phenotype, with pancreatic suffiency and without gastrointestinal symptoms. Login to comment
37 Clinical and laboratory features of individuals with P205S Mutation in other chromosome Current age Age at diagnosis Sex Sweat chloride mEq/1. Login to comment

[hide] Rectal forceps biopsy procedure in cystic fibrosis... BMC Gastroenterol. 2013 May 20;13:91. doi: 10.1186/1471-230X-13-91. Servidoni MF, Sousa M, Vinagre AM, Cardoso SR, Ribeiro MA, Meirelles LR, de Carvalho RB, Kunzelmann K, Ribeiro AF, Ribeiro JD, Amaral MD
Rectal forceps biopsy procedure in cystic fibrosis: technical aspects and patients perspective for clinical trials feasibility.
BMC Gastroenterol. 2013 May 20;13:91. doi: 10.1186/1471-230X-13-91., [PMID:23688510]

Abstract [show]
BACKGROUND: Measurements of CFTR function in rectal biopsies ex vivo have been used for diagnosis and prognosis of Cystic Fibrosis (CF) disease. Here, we aimed to evaluate this procedure regarding: i) viability of the rectal specimens obtained by biopsy forceps for ex vivo bioelectrical and biochemical laboratory analyses; and ii) overall assessment (comfort, invasiveness, pain, sedation requirement, etc.) of the rectal forceps biopsy procedure from the patients perspective to assess its feasibility as an outcome measure in clinical trials. METHODS: We compared three bowel preparation solutions (NaCl 0.9%, glycerol 12%, mannitol), and two biopsy forceps (standard and jumbo) in 580 rectal specimens from 132 individuals (CF and non-CF). Assessment of the overall rectal biopsy procedure (obtained by biopsy forceps) by patients was carried out by telephone surveys to 75 individuals who underwent the sigmoidoscopy procedure. RESULTS: Integrity and friability of the tissue specimens correlate with their transepithelial resistance (r = -0.438 and -0.305, respectively) and are influenced by the bowel preparation solution and biopsy forceps used, being NaCl and jumbo forceps the most compatible methods with the electrophysiological analysis. The great majority of the individuals (76%) did not report major discomfort due to the short procedure time (max 15 min) and considered it relatively painless (79%). Importantly, most (88%) accept repeating it at least for one more time and 53% for more than 4 times. CONCLUSIONS: Obtaining rectal biopsies with a flexible endoscope and jumbo forceps after bowel preparation with NaCl solution is a safe procedure that can be adopted for both adults and children of any age, yielding viable specimens for CFTR bioelectrical/biochemical analyses. The procedure is well tolerated by patients, demonstrating its feasibility as an outcome measure in clinical trials.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
89 As shown in Figure 3B, we were able to detect CFTR protein at the plasma membrane for both wt-CFTR and F508del/P205S-CFTR (P205S is a class IV mutation), but F508del/F508del-CFTR was retained into cytoplasm, close to the basolateral membrane. Login to comment
104 Images evidence CFTR at the membrane in a non-CF tissue (top panels) and also, albeit weaker, in a biopsy from a CF patient with the F508del/P205S-CFTR genotype (bottom panels). Login to comment

[hide] Genetic interaction of GSH metabolic pathway genes... BMC Med Genet. 2013 Jun 10;14:60. doi: 10.1186/1471-2350-14-60. de Lima Marson FA, Bertuzzo CS, Secolin R, Ribeiro AF, Ribeiro JD
Genetic interaction of GSH metabolic pathway genes in cystic fibrosis.
BMC Med Genet. 2013 Jun 10;14:60. doi: 10.1186/1471-2350-14-60., [PMID:23758905]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is a monogenic disease caused by CFTR gene mutations, with clinical expression similar to complex disease, influenced by genetic and environmental factors. Among the possible modifier genes, those associated to metabolic pathways of glutathione (GSH) have been considered as potential modulators of CF clinical severity. In this way it is of pivotal importance investigate gene polymorphisms at Glutamate-Cysteine Ligase, Catalytic Subunit (GCLC), Glutathione S-transferase Mu 1 (GSTM1), Glutathione S-transferase Theta 1 (GSTT1), and Glutathione S-transferase P1 (GSTP1), which have been associated to the GSH metabolic pathway and CF clinical severity. METHOD: A total of 180 CF's patients were included in this study, which investigated polymorphisms in GCLC and GST genes (GCLC -129C>T and -3506A>G; GSTM1 and GSTT1 genes deletion, and GSTP1*+313A>G) by PCR and PCR-RFLP associating to clinical variables of CF severity, including variables of sex, clinical scores [Shwachman-Kulczycki, Kanga e Bhalla (BS)], body mass index, patient age, age for diagnosis, first clinical symptoms, first colonization by Pseudomonas aeruginosa, sputum's microorganisms, hemoglobin oxygen saturation in the blood, spirometry and comorbidities. The CFTR genotype was investigated in all patients, and the genetic interaction was performed using MDR2.0 and MDRPT0.4.7 software. RESULTS: The analysis of multiple genes in metabolic pathways in diseases with variable clinical expression, as CF disease, enables understanding of phenotypic diversity. Our data show evidence of interaction between the GSTM1 and GSTT1 genes deletion, and GSTP1*+313A>G polymorphism with CFTR gene mutation classes, and BS (Balance testing accuracy=0.6824, p=0.008), which measures the commitment of bronchopulmonary segments by tomography. CONCLUSION: Polymorphisms in genes associated with metabolism of GSH act on the CF's severity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 Other identified mutations, class IV (P205S e R334W) were not included in the statistical analysis. Login to comment

[hide] Novel CFTR variants identified during the first 3 ... J Mol Diagn. 2013 Sep;15(5):710-22. doi: 10.1016/j.jmoldx.2013.05.006. Epub 2013 Jun 28. Prach L, Koepke R, Kharrazi M, Keiles S, Salinas DB, Reyes MC, Pian M, Opsimos H, Otsuka KN, Hardy KA, Milla CE, Zirbes JM, Chipps B, O'Bra S, Saeed MM, Sudhakar R, Lehto S, Nielson D, Shay GF, Seastrand M, Jhawar S, Nickerson B, Landon C, Thompson A, Nussbaum E, Chin T, Wojtczak H
Novel CFTR variants identified during the first 3 years of cystic fibrosis newborn screening in California.
J Mol Diagn. 2013 Sep;15(5):710-22. doi: 10.1016/j.jmoldx.2013.05.006. Epub 2013 Jun 28., [PMID:23810505]

Abstract [show]
California uses a unique method to screen newborns for cystic fibrosis (CF) that includes gene scanning and DNA sequencing after only one California-40 cystic fibrosis transmembrane conductance regulator (CFTR) panel mutation has been identified in hypertrypsinogenemic specimens. Newborns found by sequencing to have one or more additional mutations or variants (including novel variants) in the CFTR gene are systematically followed, allowing for prospective assessment of the pathogenic potential of these variants. During the first 3 years of screening, 55 novel variants were identified. Six of these novel variants were discovered in five screen-negative participants and three were identified in multiple unrelated participants. Ten novel variants (c.2554_2555insT, p.F1107L, c.-152G>C, p.L323P, p.L32M, c.2883_2886dupGTCA, c.2349_2350insT, p.K114del, c.-602A>T, and c.2822delT) were associated with a CF phenotype (42% of participants were diagnosed at 4 to 25 months of age), whereas 26 were associated with CFTR-related metabolic syndrome to date. Associations with the remaining novel variants were confounded by the presence of other diseases or other mutations in cis or by inadequate follow-up. These findings have implications for how CF newborn screening and follow-up is conducted and will help guide which genotypes should, and which should not, be considered screen positive for CF in California and elsewhere.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 Newborns were screened using the California method, which includes i) analysis of serum immunoreactive trypsinogen (IRT) levels using the AutoDELFIA neonatal IRT L kit (PerkinElmer, Waltham, MA) in all newborn blood spot specimens, ii) CFTR mutation panel [29-40 mutations (the mutations on the California panel were selected for the most part according to allelic frequencies found in a comprehensively genotyped group of California CF cases to achieve a 95% race/ethnicity-specific rate of CF case detection in black, white, and Hispanic individuals in California and include c.1585-1G>A, c.1680-1G>A, c.1973-1985del13insAGAAA, c.2175_2176insA, c.164 &#fe; 2T>A (removed on August 12, 2008), c.2988 &#fe; 1G>A, c.3717 &#fe; 12191C>T, c.3744delA, c.274-1G>A, c.489 &#fe; 1G>T, c.579 &#fe; 1G>T, p.A559T, p.F311del, p.F508del, p.I507del, p.G542X, p.G551D, p.G85E, p.H199Y, p.N1303K, p.R1066C, p.R1162X, p.R334W, p.R553X, p.S549N, p.W1089X, p.W1204X (c.3611G>A), p.W1282X, c.1153_1154insAT [added October 4, 2007], c.1923_1931del9insA, c.3140-26A>G, c.531delT, c.803delA, c.54-5940_273 &#fe; 10250del21kb, p.P205S, p.Q98R, p.R75X, p.S492F [added December 12, 2007], c.3659delC, p.G330X, p.W1204X [c.3612G>A] [added August 12, 2008] [Signature CF 2.0 ASR; Asuragen Inc., Austin, TX])] testing of specimens with IRT 62 ng/mL (highest 1.5%), iii) CFTR gene scanning and sequence analysis (Ambry Test: CF; Ambry Genetics, Aliso Viejo, CA) for specimens found to have only one mutation after CFTR mutation panel testing, and iv) referral to 1 of 15 pediatric CF care centers (CFCs) for sweat chloride (SC) testing and follow-up of all newborns with either two CFTR mutations detected during panel testing or one CFTR mutation detected during panel testing and one (or more) additional CFTR mutation and/or variant detected during sequencing. Login to comment
59 of parents receiving CFTR mutation testing Diagnosis/ status Study participants with positive NBS results 1 W, H 83.5 p.F508del* c.2554_2555insTy 7T/9T 2 CF 2 H 527.0 p.F508del c.-877C>T p.F1107L 7T/9T 0 CF 3 W 86.5 p.F508del p.V562Iy c.-837T>Cy 5Tyz /9T 1 CF 4 H 222.3 p.F508del p.I556V c.1278delC NA 0 CF 5 H, O 93.5 p.F508del* c.-152G>Cy 7T/9T 2 CF 6 W, H, B, O 95.4 p.F508del* p.L323Py 5Tyz /9T 2 CF 7 H 70.5 p.F508del p.L32M 7T/9T 0 CF 8 W 209.5 p.F508del c.2883_2886dupGTCA 9T/9T 0 CF 9 H 155.7 p.F508del* c.2349_2350insT 7T/9T 1 CF 10 O 146.8 p.F508del* c.3718-24G>Ay 5Tyx /9T 2 CF 11 B 99.4 p.A559T* p.L206Wy c.-448A>G* 7T/9T 2 CF 12 W, H 90.3 p.P205S p.K114del 7T/7T 0 CF 13 H 69.7 p.P205S p.K114del 7T/7T 0 CF 14 H 82.9 c.274-1G>A* c.-602A>Ty 7T/7T 2 CF 15 W 106.6 p.F508del* c.-461A>Gy c.-983A>T* 7T/9T 2 CRMS 16 W, B 83.9 p.F508del c.4243-5C>T 5T*x /9T 1 CRMS 17 W 81.5 p.F508del* p.I1027T* p.Y325C 7T/9T 2 CRMS 18 H 70.7 p.F508del c.-967T>C 9T/9T 0 CRMS 19 W, H 62.4 p.F508del* c.-635A>G 7T/9T 1 CRMS 20 H 65.4 p.F508dely c.2490 &#fe; 14G>T* 7T/9T 2 CRMS 21 W 69.3 p.F508del* c.744-15T>Cy 7T/9T 2 CRMS 22 W, H, O 66.2 p.F508del p.D249Y 7T/9T 0 CRMS 23 H 94.8 p.F508del p.R811S 7T/9T 0 CRMS 24 W 75.8 p.F508del* p.H1375Ny 7T/9T 2 CRMS 25 H 63.0 p.F508del p.L136P 7T/9T 0 CRMS 26 W, O 63.0 p.F508del* p.M1140L 7T/9T 1 CRMS 27 W, O 91.7 p.F508del p.V1198M 9T/9T 0 CRMS 28 H 69.3 p.F508dely c.1767-13T>G* 7T/9T 2 CRMS 29 H 108.8 p.F508del p.V1322L 7T/9T 0 CRMS 30 H 96.4 p.F508dely p.C76R* 7T/9T 2 CRMS 31 H 69.0 c.3140-26A>G c.-510G>A* 7T/7T 1 CRMS 32 H 100.2 p.G542X c.-684G>A* 7T/9T 1 CRMS 33 H 84.1 c.1153_1154insAT* c.-730A>Gy 7T/7T 2 CRMS 34 H 62.9 c.1973_ 1985del13insAGAAA* p.D112Gy 7T/7T 2 CRMS 35 H 116.7 c.3744delA* p.T887P 7T/7T 1 CRMS 36 B 73.3 c.2988 &#fe; 1G>A c.-288G>C 7T/9T 0 CRMS 37 H 93.5 p.R75X c.3367 &#fe; 3A>C 7T/7T 0 CRMS 38 W, H 81.4 c.3717 &#fe; 12191C>T* c.-769A>Gy 7T/7T 2 CRMS 39 W 79.0 c.3717 &#fe; 12191C>Ty p.R668Cy p.T1396P* 7T/9T 2 CRMS 40 H 87.3 c.274-1G>A p.F315S 7T/7T 0 CRMS 41 H 79.7 p.G542X c.869 &#fe; 8G>T 7T/9T 0 CRMS 42 O 79.8 p.R553X p.T1478R 7T/7T 0 CRMS 43 H 70.5 p.A559T* c.-448A>G* 7T/7T 2 Carrier 44 B 76.2 p.A559T* c.-448A>G* 7T/7T 1 Carrier 45 W, H 69.2 p.G85E* c.744-15T>C* 5Tyz /7T 2 Carrier 46 W 69.1 p.N1303K* c.2490 &#fe; 14G>A* 7T/9T 1 Carrier 47 W, O 111.7 p.F508del c.3963 &#fe; 6G>T 7T/9T 0 ND{ 48 W 80.1 p.F508del p.R1128G 7T/9T 0 ND{ (table continues) sequencing. Login to comment
139 p.K114del Two nontwin siblings with genotype p.P205S/p.K114del were identified [participants 12 and 13 (younger)]. Login to comment

[hide] Impact of heterozygote CFTR mutations in COPD pati... Respir Res. 2014 Feb 11;15:18. doi: 10.1186/1465-9921-15-18. Raju SV, Tate JH, Peacock SK, Fang P, Oster RA, Dransfield MT, Rowe SM
Impact of heterozygote CFTR mutations in COPD patients with chronic bronchitis.
Respir Res. 2014 Feb 11;15:18. doi: 10.1186/1465-9921-15-18., [PMID:24517344]

Abstract [show]
BACKGROUND: Cigarette smoking causes Chronic Obstructive Pulmonary Disease (COPD), the 3rd leading cause of death in the U.S. CFTR ion transport dysfunction has been implicated in COPD pathogenesis, and is associated with chronic bronchitis. However, susceptibility to smoke induced lung injury is variable and the underlying genetic contributors remain unclear. We hypothesized that presence of CFTR mutation heterozygosity may alter susceptibility to cigarette smoke induced CFTR dysfunction. Consequently, COPD patients with chronic bronchitis may have a higher rate of CFTR mutations compared to the general population. METHODS: Primary human bronchial epithelial cells derived from F508del CFTR heterozygotes and mice with (CFTR+/-) and without (CFTR+/+) CFTR heterozygosity were exposed to whole cigarette smoke (WCS); CFTR-dependent ion transport was assessed by Ussing chamber electrophysiology and nasal potential difference measurements, respectively. Caucasians with COPD and chronic bronchitis, age 40 to 80 with FEV1/FVC < 0.70 and FEV1 < 60% predicted, were selected for genetic analysis from participants in the NIH COPD Clinical Research Network's Azithromycin for Prevention of Exacerbations of COPD in comparison to 32,900 Caucasian women who underwent prenatal genetic testing. Genetic analysis involved an allele-specific genotyping of 89 CFTR mutations. RESULTS: Exposure to WCS caused a pronounced reduction in CFTR activity in both CFTR (+/+) cells and F508del CFTR (+/-) cells; however, neither the degree of decrement (44.7% wild-type vs. 53.5% F508del heterozygous, P = NS) nor the residual CFTR activity were altered by CFTR heterozygosity. Similarly, WCS caused a marked reduction in CFTR activity measured by NPD in both wild type and CFTR heterozygous mice, but the severity of decrement (91.1% wild type vs. 47.7% CF heterozygous, P = NS) and the residual activity were not significantly affected by CFTR genetic status. Five of 127 (3.9%) COPD patients with chronic bronchitis were heterozygous for CFTR mutations which was not significantly different from controls (4.5%) (P = NS). CONCLUSIONS: The magnitude of WCS induced reductions in CFTR activity was not affected by the presence of CFTR mutation heterozygosity. CFTR mutations do not increase the risk of COPD with chronic bronchitis. CFTR dysfunction due to smoking is primarily an acquired phenomenon and is not affected by the presence of congenital CFTR mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 As expected based on genotype-phenotype correlations in the disease [33], HBE cells derived from a F508del CFTR heterozygote had slightly lower CFTR activity at baseline than wild type monolayers as measured by Table 1 List of CFTR mutations analyzed F508del R117H 1717-1G > A R117C G85E R334W 1898 + 1G > A Y122X A455E R347P 2184delA G178R I507del R553X 2789 + 5G > A G314E G542X R560T 3120 + 1G > A G330X G551D W1282X 3659delC R347H N1303K 621 + 1G > T K710X 406-1G > A R1162X 711 + 1G > T E60X G480C R1066C W1089X V520F A559T S1196X Q1238X S1251N S1255X 663delT 935delA 1161delC 1288insTA 2184insA 2307insA 2711delT 2869insG R709X R764X R1158X 574delA Q493X 1898 + 5G > T 3905insT I506T 3849 + 10kbC > T 712-1G > T Q98R Q552X S549N 1078delT H199Y 444delA S549R (T > G) 2143delT P205S 2043delG 1811 + 1.6kbA > G 3272-26A > G L206W 3791delC Y1092X (C > G) 3199del6 F508C 2108delA Y1092X (C > A) D1152H V520I 3667del4 394delTT 3876delA M1101K 1677delTA W1098X (TGA) 1812-1G > A 4016insT 1609delCA 3171delC response to forskolin stimulation (49.3 &#b1; 11.5 bc;A/cm2 in CFTR (+/+) vs. 40.5 &#b1; 5.3 bc;A/cm2 in CFTR (+/-), although this was not statistically significant (Figure 1A,B). Login to comment

[hide] CFTR genotype and clinical outcomes of adult patie... Gene. 2014 May 1;540(2):183-90. doi: 10.1016/j.gene.2014.02.040. Epub 2014 Feb 26. Bonadia LC, de Lima Marson FA, Ribeiro JD, Paschoal IA, Pereira MC, Ribeiro AF, Bertuzzo CS
CFTR genotype and clinical outcomes of adult patients carried as cystic fibrosis disease.
Gene. 2014 May 1;540(2):183-90. doi: 10.1016/j.gene.2014.02.040. Epub 2014 Feb 26., [PMID:24583165]

Abstract [show]
BACKGROUND: There are nearly 2000 cystic fibrosis transmembrane regulator (CFTR) mutations that cause cystic fibrosis (CF). These mutations are classified into six classes; on the one hand, the first three classes cause severe disease involvement in early childhood, on the other hand, the Class IV, V and VI mutations cause minor severe disease in the same age. Nowadays, with therapeutic advances in CF management and competence of pediatricians, physicians of adults have to deal with two groups of CF patients: (i) adults diagnosed in childhood with severe mutations and (ii) adults who initiated symptoms in adulthood and with Class IV, V and VI mutations. The aim of this study was to analyze adults from a clinical center, treated as CF disease, screening the CFTR genotype and evaluating the clinical characteristics. METHODS: Thirty patients followed as CF disease at the University Hospital were enrolled. After a complete molecular CFTR negative screening and sweat test levels between 40 and 59mEq/L, five patients were characterized as non-CF disease and were excluded. Molecular screening was performed by CFTR gene sequencing/MLPA or by specific mutation screening. Clinical data was obtained from medical records. The patients were divided into three groups: (1) patients with Class I, II and III mutations in two CFTR alleles; (2) genotype with at least one allele of Class IV, V or VI CFTR mutations and, (3) non-identified CFTR mutation+one patient with one allele with CFTR mutation screened (Class I). RESULTS: There was an association of CFTR class mutation and sodium/chloride concentration in the sweat test (sodium: p=0.040; chloride: p=0.016), onset of digestive symptoms (p=0.012), lung function parameter (SpO2 - p=0.016), Bhalla score (p=0.021), age at diagnosis (p=0.008) and CF-related diabetes (p=0.029). There was an association between Pseudomonas aeruginosa chronic colonization (as clinical marker for the lung disease status) and lung impairment (FEV1% - p=0.027; Bhalla score - p=0.021), CF-related diabetes (p=0.040), chloride concentration in the sweat test (p=0.040) and chronic infection by microorganisms (Staphylococcus aureus - p=0.039; mucoid P. aeruginosa - p=0.001). There is no positive association with the status of other clinical markers and the CFTR genotype groups. For clinical association with pancreatic insufficiency (as clinical marker for digestive symptoms), no association was related. CONCLUSION: The adults with CF diagnosed by sweat test have specific clinical and genotypic characteristics, being a population that should be studied to cause better future management. Some patients treated as CF disease by clinical symptoms, showed no disease, taking into account the sweat test and complete exon sequencing/MLPA screening.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
82 2 7 V I s s a l C / I I s s a l C H 2 5 1 1 D / l e d 8 0 5 F 2 2 F508del/1584-18672pb A>G Class II/Class V 63.7 90.7 61.5 93.1 62.6 91.9 2 P205S/G542X Class IV/Class I 102 136.2 93.1 112.3 97.55 124.25 6 . Login to comment

[hide] Polymorphisms in the glutathione pathway modulate ... BMC Med Genet. 2014 Mar 4;15:27. doi: 10.1186/1471-2350-15-27. Marson FA, Bertuzzo CS, Ribeiro AF, Ribeiro JD
Polymorphisms in the glutathione pathway modulate cystic fibrosis severity: a cross-sectional study.
BMC Med Genet. 2014 Mar 4;15:27. doi: 10.1186/1471-2350-15-27., [PMID:24593045]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) clinically manifests with various levels of severity, which are thought to be modulated by mutations in the cystic fibrosis transmembrane conductance regulator gene (CFTR), modifier genes, and the environment. This study verified whether polymorphisms in modifier genes associated with glutathione (GSH) metabolism influence CF severity. METHODS: A cross-sectional study of 180 CF patients was carried out from 2011 to 2012. We analyzed CFTR mutations, polymorphisms (GSTM1 and GSTT1 deletions, GSTP1 + 313A > G, GCLC-129C > T, and GCLC-3506A > G) in modifier genes and CF clinical severity as assessed by 28 clinical and laboratory variables. RESULTS: Significant associations were found between modifier gene polymorphisms and particular phenotypes or genotype changes. These included GCLC-129C > T with a higher frequency of the Pseudomonas aeruginosa mucoid to CC genotype (p = 0.044), and GCLC-3506A > G with a higher frequency of the no-mucoid P. aeruginosa (NMPA) to AA genotype (p = 0.012). The GSTT1 deletion was associated with a higher frequency of the NMPA to homozygous deletion (p = 0.008), GSTP1 + 313A > G with a minor risk of osteoporosis (p = 0.036), and patient age </= 154 months (p = 0.044) with the AA genotype. The Bhalla score was associated with GCLC-3506A > G (p = 0.044) and GSTM1/GSTT1 deletion polymorphisms (p = 0.02), while transcutaneous hemoglobin oxygen saturation levels were associated with GSTT1 deletions (p = 0.048). CONCLUSION: CF severity is associated with polymorphisms in GSH pathways and CFTR mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 All class I, II or III mutations, but not class IV mutations (P205S and R334W), identified were included in statistical analysis. Login to comment

[hide] Full-open and closed CFTR channels, with lateral t... Cell Mol Life Sci. 2015 Apr;72(7):1377-403. doi: 10.1007/s00018-014-1749-2. Epub 2014 Oct 7. Mornon JP, Hoffmann B, Jonic S, Lehn P, Callebaut I
Full-open and closed CFTR channels, with lateral tunnels from the cytoplasm and an alternative position of the F508 region, as revealed by molecular dynamics.
Cell Mol Life Sci. 2015 Apr;72(7):1377-403. doi: 10.1007/s00018-014-1749-2. Epub 2014 Oct 7., [PMID:25287046]

Abstract [show]
In absence of experimental 3D structures, several homology models, based on ABC exporter 3D structures, have provided significant insights into the molecular mechanisms underlying the function of the cystic fibrosis transmembrane conductance regulator (CFTR) protein, a chloride channel whose defects are associated with cystic fibrosis (CF). Until now, these models, however, did not furnished much insights into the continuous way that ions could follow from the cytosol to the extracellular milieu in the open form of the channel. Here, we have built a refined model of CFTR, based on the outward-facing Sav1866 experimental 3D structure and integrating the evolutionary and structural information available today. Molecular dynamics simulations revealed significant conformational changes, resulting in a full-open channel, accessible from the cytosol through lateral tunnels displayed in the long intracellular loops (ICLs). At the same time, the region of nucleotide-binding domain 1 in contact with one of the ICLs and carrying amino acid F508, the deletion of which is the most common CF-causing mutation, was found to adopt an alternative but stable position. Then, in a second step, this first stable full-open conformation evolved toward another stable state, in which only a limited displacement of the upper part of the transmembrane helices leads to a closure of the channel, in a conformation very close to that adopted by the Atm1 ABC exporter, in an inward-facing conformation. These models, supported by experimental data, provide significant new insights into the CFTR structure-function relationships and into the possible impact of CF-causing mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
346 First, almost all CF-causing mutations involving residues located in the MSD transmembrane segments are encountered in MSD1 and generally concern positions lining the pore (G85E, E92K, D110H, P205S, R334W, I336K, T338I, S341P, R347H/R347P, and R352Q) (Fig. 7a). Login to comment
348 In addition, L206W and H199Y are situated nearby P205S, orientated toward the lipid bilayer. Login to comment

[hide] Improving newborn screening for cystic fibrosis us... Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209. Baker MW, Atkins AE, Cordovado SK, Hendrix M, Earley MC, Farrell PM
Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study.
Genet Med. 2015 Feb 12. doi: 10.1038/gim.2014.209., [PMID:25674778]

Abstract [show]
Purpose:Many regions have implemented newborn screening (NBS) for cystic fibrosis (CF) using a limited panel of cystic fibrosis transmembrane regulator (CFTR) mutations after immunoreactive trypsinogen (IRT) analysis. We sought to assess the feasibility of further improving the screening using next-generation sequencing (NGS) technology.Methods:An NGS assay was used to detect 162 CFTR mutations/variants characterized by the CFTR2 project. We used 67 dried blood spots (DBSs) containing 48 distinct CFTR mutations to validate the assay. NGS assay was retrospectively performed on 165 CF screen-positive samples with one CFTR mutation.Results:The NGS assay was successfully performed using DNA isolated from DBSs, and it correctly detected all CFTR mutations in the validation. Among 165 screen-positive infants with one CFTR mutation, no additional disease-causing mutation was identified in 151 samples consistent with normal sweat tests. Five infants had a CF-causing mutation that was not included in this panel, and nine with two CF-causing mutations were identified.Conclusion:The NGS assay was 100% concordant with traditional methods. Retrospective analysis results indicate an IRT/NGS screening algorithm would enable high sensitivity, better specificity and positive predictive value (PPV). This study lays the foundation for prospective studies and for introducing NGS in NBS laboratories.Genet Med advance online publication 12 February 2015Genetics in Medicine (2015); doi:10.1038/gim.2014.209.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
15 Correspondence: Mei W. Baker (mwbaker@wisc.edu) Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study Mei W. Baker, MD1,2 , Anne E. Atkins, MPH2 , Suzanne K. Cordovado, PhD3 , Miyono Hendrix, MS3 , Marie C. Earley, PhD3 and Philip M. Farrell, MD, PhD1,4 Table 1ߒ CF-causing or varying consequences mutations in the MiSeqDx IUO Cystic Fibrosis System c.1521_1523delCTT (F508del) c.2875delG (3007delG) c.54-5940_273ߙ+ߙ10250del21kb (CFTRdele2,3) c.3909C>G (N1303K) c.3752G>A (S1251N) Mutations that cause CF when combined with another CF-causing mutation c.1624G>T (G542X) c.2988ߙ+ߙ1G>A (3120ߙ+ߙ1G->A) c.3964-78_4242ߙ+ߙ577del (CFTRdele22,23) c.613C>T (P205S) c.1021T>C (S341P) c.948delT (1078delT) c.2988G>A (3120G->A) c.328G>C (D110H) c.200C>T (P67L) c.1397C>A (S466X(C>A)) c.1022_1023insTC (1154insTC) c.2989-1G>A (3121-1G->A) c.3310G>T (E1104X) c.3937C>T (Q1313X) c.1397C>G (S466X(C>G)) c.1081delT (1213delT) c.3140-26A>G (3272-26A->G) c.1753G>T (E585X) c.658C>T (Q220X) c.1466C>A (S489X) c.1116ߙ+ߙ1G>A (1248ߙ+ߙ1G->A) c.3528delC (3659delC) c.178G>T (E60X) c.115C>T (Q39X) c.1475C>T (S492F) c.1127_1128insA (1259insA) c.3659delC (3791delC) c.2464G>T (E822X) c.1477C>T (Q493X) c.1646G>A (S549N) c.1209ߙ+ߙ1G>A (1341ߙ+ߙ1G->A) c.3717ߙ+ߙ12191C>T (3849ߙ+ߙ10kbC->T) c.2491G>T (E831X) c.1573C>T (Q525X) c.1645A>C (S549R) c.1329_1330insAGAT (1461ins4) c.3744delA (3876delA) c.274G>A (E92K) c.1654C>T (Q552X) c.1647T>G (S549R) c.1393-1G>A (1525-1G->A) c.3773_3774insT (3905insT) c.274G>T (E92X) c.2668C>T (Q890X) c.2834C>T (S945L) c.1418delG (1548delG) c.262_263delTT (394delTT) c.3731G>A (G1244E) c.292C>T (Q98X) c.1013C>T (T338I) c.1545_1546delTA (1677delTA) c.3873ߙ+ߙ1G>A (4005ߙ+ߙ1G->A) c.532G>A (G178R) c.3196C>T (R1066C) c.1558G>T (V520F) c.1585-1G>A (1717-1G->A) c.3884_3885insT (4016insT) c.988G>T (G330X) c.3197G>A (R1066H) c.3266G>A (W1089X) c.1585-8G>A (1717-8G->A) c.273ߙ+ߙ1G>A (405ߙ+ߙ1G->A) c.1652G>A (G551D) c.3472C>T (R1158X) c.3611G>A (W1204X) c.1679ߙ+ߙ1.6kbA>G (1811ߙ+ߙ1.6kbA->G) c.274-1G>A (406-1G->A) c.254G>A (G85E) c.3484C>T (R1162X) c.3612G>A (W1204X) c.1680-1G>A (1812-1G->A) c.4077_4080delTGTTinsAA (4209TGTT->AA) c.2908G>C (G970R) c.349C>T (R117C) c.3846G>A (W1282X) c.1766ߙ+ߙ1G>A (1898ߙ+ߙ1G->A) c.4251delA (4382delA) c.595C>T (H199Y) c.1000C>T (R334W) c.1202G>A (W401X) c.1766ߙ+ߙ3A>G (1898ߙ+ߙ 3A->G) c.325_327delTATinsG (457TAT->G) c.1007T>A (I336K) c.1040G>A (R347H) c.1203G>A (W401X) c.2012delT (2143delT) c.442delA (574delA) c.1519_1521delATC (I507del) c.1040G>C (R347P) c.2537G>A (W846X) c.2051_2052delAAinsG (2183AA->G) c.489ߙ+ߙ1G>T (621ߙ+ߙ 1G->T) c.2128A>T (K710X) c.1055G>A (R352Q) c.3276C>A (Y1092X (C>A)) c.2052delA (2184delA) c.531delT (663delT) c.3194T>C (L1065P) c.1657C>T (R553X) c.3276C>G (Y1092X (C>G)) c.2052_2053insA (2184insA) c.579ߙ+ߙ1G>T (711ߙ+ߙ 1G->T) c.3230T>C (L1077P) c.1679G>A (R560K) c.366T>A (Y122X) c.2175_2176insA (2307insA) c.579ߙ+ߙ3A>G (711ߙ+ߙ 3A->G) c.617T>G (L206W) c.1679G>C (R560T) - c.2215delG (2347delG) c.579ߙ+ߙ5G>A (711ߙ+ߙ 5G->A) c.1400T>C (L467P) c.2125C>T (R709X) - c.2453delT (2585delT) c.580-1G>T (712-1G->T) c.2195T>G (L732X) c.223C>T (R75X) - c.2490ߙ+ߙ1G>A (2622ߙ+ߙ1G->A) c.720_741delAGGGAG AATGATGATGAAGTAC (852del22) c.2780T>C (L927P) c.2290C>T (R764X) - c.2583delT (2711delT) c.1364C>A (A455E) c.3302T>A (M1101K) c.2551C>T (R851X) - c.2657ߙ+ߙ5G>A (2789ߙ+ߙ5G->A) c.1675G>A (A559T) c.1A>G (M1V) c.3587C>G (S1196X) - Mutations/variants that were validated in this study are in bold. CF, cystic fibrosis. Table 1ߒ Continued on next page reduce carrier detection and potentially improve the positive predictive value (PPV), the NBS goals of equity and the highest possible sensitivity become more difficult to achieve. Login to comment

[hide] The improvement of the best practice guidelines fo... Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99. Girardet A, Viart V, Plaza S, Daina G, De Rycke M, Des Georges M, Fiorentino F, Harton G, Ishmukhametova A, Navarro J, Raynal C, Renwick P, Saguet F, Schwarz M, SenGupta S, Tzetis M, Roux AF, Claustres M
The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus.
Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99., [PMID:26014425]

Abstract [show]
Cystic fibrosis (CF) is one of the most common indications for preimplantation genetic diagnosis (PGD) for single gene disorders, giving couples the opportunity to conceive unaffected children without having to consider termination of pregnancy. However, there are no available standardized protocols, so that each center has to develop its own diagnostic strategies and procedures. Furthermore, reproductive decisions are complicated by the diversity of disease-causing variants in the CFTR (cystic fibrosis transmembrane conductance regulator) gene and the complexity of correlations between genotypes and associated phenotypes, so that attitudes and practices toward the risks for future offspring can vary greatly between countries. On behalf of the EuroGentest Network, eighteen experts in PGD and/or molecular diagnosis of CF from seven countries attended a workshop held in Montpellier, France, on 14 December 2011. Building on the best practice guidelines for amplification-based PGD established by ESHRE (European Society of Human Reproduction and Embryology), the goal of this meeting was to formulate specific guidelines for CF-PGD in order to contribute to a better harmonization of practices across Europe. Different topics were covered including variant nomenclature, inclusion criteria, genetic counseling, PGD strategy and reporting of results. The recommendations are summarized here, and updated information on the clinical significance of CFTR variants and associated phenotypes is presented.European Journal of Human Genetics advance online publication, 27 May 2015; doi:10.1038/ejhg.2015.99.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
79 (unknown) Q39X c.115C4T p.Gln39* P67L c.200C4T p.Pro67Leu R75X c.223C4T p.Arg75* 405+1G4A c.273+1G4A 406-1G4A c.274-1G4A E92X c.274G4T p.Glu92* E92K c.274G4A p.Glu92Lys Q98X c.292C4T p.Gln98* 457TAT4G c.325_327delTATinsG p.Tyr109Glyfs*4 D110H c.328G4C p.Asp110His R117C c.349C4T p.Arg117Cys Y122X c.366 T4A p.Tyr122* 574delA c.442delA p.Ile148Leufs*5 444delA c.313delA p.Ile105Serfs*2 663delT c.531delT p.Ile177Metfs*12 G178R c.532G4A p.Gly178Arg 711+3 A4G c.579+3 A4G 711+5G4A c.579+5G4A 712-1G4T c.580-1G4T H199Y c.595C4T p.His199Tyr P205S c.613C4T p.Pro205Ser L206W c.617 T4G p.Leu206Trp Q220X c.658C4T p.Gln220* 852del22 c.720_741delAGGGAGAAT GATGATGAAGTAC p.Gly241Glufs*13 1078delT c.948delT p.Phe316Leufs*12 G330X c.988G4T p.Gly330* Table 1 (Continued ) HGVS nomenclature Legacy name cDNA nucleotide name Protein name R334W c.1000C4T p.Arg334Trp I336K c.1007 T4A p.Ile336Lys T338I c.1013C4T p.Thr338Ile 1154insTC c.1021_1022dupTC p.Phe342Hisfs*28 S341P c.1021 T4C p.Ser341Pro R347H c.1040G4A p.Arg347His 1213delT c.1081delT p.Trp361Glyfs*8 1248+1G4A c.1116+1G4A 1259insA c.1130dupA p.Gln378Alafs*4 W401X(TAG) c.1202G4A p.Trp401* W401X(TGA) c.1203G4A p.Trp401* 1341+1G4A c.1209+1G4A 1461ins4 c.1329_1330insAGAT p.Ile444Argfs*3 1525-1G4A c.1393-1G4A S466X c.1397C4A or c.1397C4G p.Ser466* L467P c.1400 T4C p.Leu467Pro S489X c.1466C4A p.Ser489* S492F c.1475C4T p.Ser492Phe 1677delTA c.1545_1546delTA p.Tyr515* V520F c.1558G4T p.Val520Phe 1717-1G4A c.1585-1G4A 1717-8G4A c.1585-8G4A S549R c.1645 A4C p.Ser549Arg S549N c.1646G4A p.Ser549Asn S549R c.1647 T4G p.Ser549Arg Q552X c.1654C4T p.Gln552* A559T c.1675G4A p.Ala559Thr 1811+1.6kbA4G c.1680-886 A4G 1812-1G4A c.1680-1G4A R560K c.1679G4A p.Arg560Lys E585X c.1753G4T p.Glu585* 1898+3 A4G c.1766+3 A4G 2143delT c.2012delT p.Leu671* 2184insA c.2052_2053insA p.Gln685Thrfs*4 2184delA c.2052delA p.Lys684Asnfs*38 R709X c.2125C4T p.Arg709* K710X c.2128 A4T p.Lys710* 2307insA c.2175dupA p.Glu726Argfs*4 L732X c.2195 T4G p.Leu732* 2347delG c.2215delG p.Val739Tyrfs*16 R764X c.2290C4T p.Arg764* 2585delT c.2453delT p.Leu818Trpfs*3 E822X c.2464G4T p.Glu822* 2622+1G4A c.2490+1G4A E831X c.2491G4T p.Glu831* W846X c.2537G4A p.Trp846* W846X (2670TGG4TGA) c.2538G4A p.Trp846* R851X c.2551C4T p.Arg851* 2711delT c.2583delT p.Phe861Leufs*3 S945L c.2834C4T p.Ser945Leu 2789+2insA c.2657+2_2657+3insA Q890X c.2668C4T p.Gln890* L927P c.2780 T4C p.Leu927Pro 3007delG c.2875delG p.Ala959Hisfs*9 G970R c.2908G4C p.Gly970Arg 3120G4A c.2988G4A function variants that cause CF disease when paired together; (ii) variants that retain residual CFTR function and are compatible with milder phenotypes such as CFTR-RD; (iii) variants with no clinical consequences; and (iv) variants of unproven or uncertain clinical relevance. Login to comment

[hide] Identification and frequencies of cystic fibrosis ... Clin Biochem. 2015 Oct 21. pii: S0009-9120(15)00473-7. doi: 10.1016/j.clinbiochem.2015.10.007. Pepermans X, Mellado S, Chialina S, Wagener M, Gallardo L, Lande H, Bordino W, Baran D, Bours V, Leal T
Identification and frequencies of cystic fibrosis mutations in central Argentina.
Clin Biochem. 2015 Oct 21. pii: S0009-9120(15)00473-7. doi: 10.1016/j.clinbiochem.2015.10.007., [PMID:26500004]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
99 rs name HGVS p. name HGVS c. name Legacy name n (%) Screening panel CFTR1 database CFTR2 database rs199826652 p.Phe508del c.1521_1523delCTT F508del 94 (56.6) Yes Yes CF-causing rs113993959 p.Gly542* c.1624G N T G542X 7 (4.2) Yes Yes CF-causing No p.Asn1303Lys c.3909C N G N1303K 5 (3) Yes Yes CF-causing rs74767530 p.Arg1162* c.3484C N T R1162X 4 (2.4) Yes Yes CF-causing rs75961395 p.Gly85Glu c.254G N A G85E 3 (1.8) Yes Yes CF-causing rs78756941 NA c.489 + 1G N T 621 + 1G N T 3 (1.8) Yes Yes CF-causing rs76713772 NA c.1585-1G N A 1717-1G N A 3 (1.8) Yes Yes CF-causing No p.Lys684Serfs*38 c.2051_2052delAAinsG 2183AA N G 3 (1.8) Yes Yes CF-causing rs397508173 p.Ser4* c.11C N A S4X 2 (1.2) No Yes No rs121909011 p.Arg334Trp c.1000C N T R334W 2 (1.2) Yes Yes CF-causing rs77010898 p.Trp1282* c.3846G N A W1282X 2 (1.2) Yes Yes CF-causing rs397508141 p.Leu34_Gln39del c.100_117delTTGTCAGACATATACCAA 232del18 1 (0.6) No Yes No No p.Leu49Pro c.146 T N C L49P &#a7; 1 (0.6) No No No rs77834169 p.Arg117Cys c.349C N T R117C 1 (0.6) Yes Yes CF-causing No p.Arg117Pro c.350G N C R117P 1 (0.6) No Yes No rs80282562 p.Gly178Arg c.532G N A G178R 1 (0.6) Yes Yes CF-causing rs121908803 p.Pro205Ser c.613C N T P205S 1 (0.6) No Yes CF-causing rs121908752 p.Leu206Trp c.617 T N G L206W 1 (0.6) Yes Yes CF-causing No p.Arg347Pro c.1040G N C R347P 1 (0.6) Yes Yes CF-causing rs397508155 p.Tyr362* c.1086 T N A Y362X 1 (0.6) No Yes No rs74597325 p.Arg553* c.1657C N T R553X 1 (0.6) Yes Yes CF-causing rs1800098 + rs1800100 p.[Gly576Ala(;)Arg668Cys] c. Login to comment
126 Genotype N Frequency (%) Total N Total frequency (%) Category I: p.Phe508del/p.Phe508del p.Phe508del/p.Phe508del 30 36.1 30 36.1 Category II: p.Phe508del/Other p.Phe508del/p.Gly542* 5 6 p.Phe508del/p.Asn1303Lys 3 3.6 p.Phe508del/p.Gly85Glu 2 2.4 p.Phe508del/c.1585-1G N A 2 2.4 p.Phe508del/c.2051_2052delAAinsG 2 2.4 p.Phe508del/p.Trp1282* 2 2.4 p.Phe508del/p.Arg117Pro 1 1.2 p.Phe508del/p.Pro205Ser 1 1.2 p.Phe508del/p.Leu206Trp 1 1.2 p.Phe508del/p.Arg553* 1 1.2 p.Phe508del/p.Ser589Ile 1 1.2 p.Phe508del/p.Ser737Phe 1 1.2 p.Phe508del/p.Arg1162* 1 1.2 p.Phe508del/c.1766 + 1G N A 1 1.2 p.Phe508del/p.Leu34_Gln39del 1 1.2 p.Phe508del/p.Leu812Phefs*11 1 1.2 p.Phe508del/c.3140-26A N G 1 1.2 p.Phe508del/c.3873 + 1G N A 1 1.2 p.Phe508del/p.Ser1297Phefs*5 1 1.2 p.Phe508del/c.4242_4242 + 1delGGinsTT 1 1.2 p.Phe508del/c.489 + 1G N T 1 1.2 31 37.5 Category III: Other/other p.Gly542*/p.Asn1303Lys 1 1.2 p.Asn1303Lys/p.Gly85Glu 1 1.2 c.489 + 1G N T/p.Lys684Serfs*38 1 1.2 c.489 + 1G N T/p.Gly542* 1 1.2 p.Arg1162*/p.Ser4* 1 1.2 p.Arg1162*/p.Tyr362* 1 1.2 p.Arg334Trp/c.1585-1G N A 1 1.2 p.Arg334Trp/p.Ser821Argfs*4 1 1.2 p.Arg347Pro/p.Ser4* 1 1.2 c.2657 + 5G N A/p.Tyr852Leufs*44 # 1 1.2 p.Arg1162*/p.Leu49Pro # 1 1.2 11 13.2 Category IV: A single mutation p.Phe508del/WT 3 3.6 c.2988 + 1G N A/WT 1 1.2 p.Arg117Cys/WT 1 1.2 p.Gly178Arg/WT 1 1.2 p.[Gly576Ala(;)Arg668Cys]/TG11-5T 1 1.2 7 8.4 Category V: Wild type 4 4.8 #: new mutation submitted to CFTR1 database [1]; other = other mutation than p.Phe508del. Login to comment

[hide] Newborn Screening for Cystic Fibrosis in Californi... Pediatrics. 2015 Dec;136(6):1062-72. doi: 10.1542/peds.2015-0811. Epub 2015 Nov 16. Kharrazi M, Yang J, Bishop T, Lessing S, Young S, Graham S, Pearl M, Chow H, Ho T, Currier R, Gaffney L, Feuchtbaum L
Newborn Screening for Cystic Fibrosis in California.
Pediatrics. 2015 Dec;136(6):1062-72. doi: 10.1542/peds.2015-0811. Epub 2015 Nov 16., [PMID:26574590]

Abstract [show]
OBJECTIVES: This article describes the methods used and the program performance results for the first 5 years of newborn screening for cystic fibrosis (CF) in California. METHODS: From July 16, 2007, to June 30, 2012, a total of 2 573 293 newborns were screened for CF by using a 3-step model: (1) measuring immunoreactive trypsinogen in all dried blood spot specimens; (2) testing 28 to 40 selected cystic fibrosis transmembrane conductance regulator (CFTR) mutations in specimens with immunoreactive trypsinogen values >/=62 ng/mL (top 1.6%); and (3) performing DNA sequencing on specimens found to have only 1 mutation in step 2. Infants with >/=2 mutations/variants were referred to CF care centers for diagnostic evaluation and follow-up. Infants with 1 mutation were considered carriers and their parents offered telephone genetic counseling. RESULTS: Overall, 345 CF cases, 533 CFTR-related metabolic syndrome cases, and 1617 carriers were detected; 28 cases of CF were missed. Of the 345 CF cases, 20 (5.8%) infants were initially assessed as having CFTR-related metabolic syndrome, and their CF diagnosis occurred after age 6 months (median follow-up: 4.5 years). Program sensitivity was 92%, and the positive predictive value was 34%. CF prevalence was 1 in 6899 births. A total of 303 CFTR mutations were identified, including 78 novel variants. The median age at referral to a CF care center was 34 days (18 and 37 days for step 2 and 3 screening test-positive infants, respectively). CONCLUSIONS: The 3-step model had high detection and low false-positive levels in this diverse population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
77 July 16, 2007 c.164+2T.A (296+2T.A) 28 c.254G.A (G85E) c.274-1G.A (406-1G.A) c.489+1G.T (621+1G.T) c.579+1G.T (711+1G.T) c.595C.T (H199Y) c.933_935delCTT (F311del) c.1000C.T (R334W) c.1519_1521delATC (I507del) c.1521_1523delCTT (F508del) c.1585-1G.A (1717-1G.A) c.1624G.T (G5423) c.1646G.A (S549N) c.1652G.A (G551D) c.1657C.T (R5533) c.1675G.A (A559T) c.1680-1G.A (1812-1G.A) c.1973-1985del13insAGAAA (2105-2117del13insAGAAA) c.2175_2176insA (2307insA) c.2988+1G.A (3120+1G.A) c.3196C.T (R1066C) c.3266G.A (W10893) c.3485G.T (R11623) c.3611G.A (W12043 [3743G.A]) c.3717+12191C.T (3849+10kbC.T) c.3744delA (3876delA) c.3846G.A (W12823) c.3909C.G (N1303K) October 4, 2007 c.1153_1154insAT (1288insTA) 29 December 12, 2007 c.54-5940_273+10250del21kb (CFTRdele2,3(21kb)) 38 c.531delT (663delT) c.613C.T (P205S) c.803delA (935delA) c.1475C.T (S492F) c.1923_1931del9insA (2055del9.A) c.223C.T (R753) c.293A.G (Q98R) c.3140-26A.G (3272-26A.G) August 12, 2008 c.988G.T (G3303) 40 c.3612G.A (W12043 [3744G.A]) c.3659delC (3791delC) c.164+2T.A (296+2T.A), removed cDNA, complementary DNA. Login to comment