ABCMdb

ABCC6 p.Arg1164*

ClinVar:	c.3490C>T , p.Arg1164* D , Pathogenic
LOVD-ABCC6:	p.Arg1164* D p.Arg1164Gln D

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Compound heterozygosity for a recurrent 16.5-kb Al... Am J Hum Genet. 2001 Mar;68(3):642-52. Epub 2001 Feb 9. Ringpfeil F, Nakano A, Uitto J, Pulkkinen L
Compound heterozygosity for a recurrent 16.5-kb Alu-mediated deletion mutation and single-base-pair substitutions in the ABCC6 gene results in pseudoxanthoma elasticum.
Am J Hum Genet. 2001 Mar;68(3):642-52. Epub 2001 Feb 9., [PMID:11179012]

Abstract [show]
Pseudoxanthoma elasticum (PXE) is a systemic heritable disorder affecting the elastic structures in the skin, eyes, and cardiovascular system, with considerable morbidity and mortality. Recently, mutations in the ABCC6 gene (also referred to as "MRP6" or "eMOAT") encoding multidrug-resistance protein 6 (MRP6), a putative transmembrane ABC transporter protein of unknown function, have been disclosed. Most of the genetic lesions delineated thus far consist of single-base-pair substitutions resulting in nonsense, missense, or splice-site mutations. In this study, we examined four multiplex families with PXE inherited in an autosomal recessive pattern. In each family, the proband was a compound heterozygote for a single-base-pair-substitution mutation and a novel, approximately 16.5-kb deletion mutation spanning the site of the single-base-pair substitution in trans. The deletion mutation was shown to extend from intron 22 to intron 29, resulting in out-of-frame deletion of 1,213 nucleotides from the corresponding mRNA and causing elimination of 505 amino acids from the MRP6 polypeptide. The deletion breakpoints were precisely the same in all four families, which were of different ethnic backgrounds, and haplotype analysis by 13 microsatellite markers suggested that the deletion had occurred independently. Deletion breakpoints within introns 22 and 29 were embedded within AluSx repeat sequences, specifically in a 16-bp segment of DNA, suggesting Alu-mediated homologous recombination as a mechanism.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
24 OF AFFECTED FAMILY MEMBERS COMPLEMENTARY MUTATION PHENOTYPE a When Studied At Disease Onset 1 (German) 61 9 2 R1164X Skin-cobblestoning on neck, antecubital fossae, and wrists, sagging skin in axillae and bilateral groin; eyes-angioid streaks, central vision loss; CVS-claudication, ischemic attack; other-ovarian cancer 2 (British) 60 Unknown 3 R1164X Skin-moderate to severe involvement; eyes-loss of vision 3 (British) 41 Unknown 3 R1141X Skin-cobblestoning on neck, axillae, and bilateral groin; eyes-angioid streaks; CVS-coronary artery disease, GI bleeding 4 (Greek) 60 51 2 3736-1GrA Skin-cobblestoning in axillae, bilateral groin, and antecubital fossae; eyes-angioid streaks, central vision loss, macular degeneration; CVS-angina, abdominal pain, loss of peripheral pulses; other-depression, chronic fatigue syndrome a CVS p cardiovascular system; GI p gastrointestinal. Login to comment
43 Haplotype analysis with 12 microsatellite markers (left side) spanning ~9 cM of 16p13.1 allowed assignment of phase of a deletion mutation (D) and a nonsense mutation (R1164X), as indicated at the bottom of the haplotypes. Login to comment
56 Clinical Assessment of Families with PXE Members of families 1, 3, and 4 were personally examined at least by one of the authors; information on Table 2 Haplotypes of Affected Individuals in Four Unrelated Families with PXE MARKER a HAPLOTYPE FOR b del/R1164X del/R1141X; Family 3 del/3736-1GrA; Family 4Family 1 Family 2 D16S3114 4 4 10 5 9 6 9 4 D16S500 6 3 4 10 4 8 6 10 D16S2619 2 1 3 2 2 3 2 2 D16S3079 2 3 2 3 1 9 8 7 D16S3060 4 2 8 2 7 4 5 8 D16S405 8 3 4 3 4 8 3 4 D16B9622 2 2 2 2 1 2 3 1 D16S764 4 2 3 2 2 2 3 2 D16S79 8 0 3 3 3 3 3 2 D16S3103 7 1 3 1 9 3 7 4 D16S3017 3 2 4 1 5 4 2 4 D16S499 1 5 5 1 8 7 5 8 D16S3036 8 8 7 7 8 11 4 6 a The distances between the listed markers are as follows: telomere, D16S3114 (1.9 cM) D16S500 (0.5 cM) D16S2619 (0.7 cM) D16S3079 (0.5 cM) D16S3060 (22 kb) D16S405 (430 kb) D16B9622 (0.7 kb) ABCC6 (317 kb) D16S764 (8 kb) D16S79 (1.5 cM) D16S3103 (0.4 cM) D16S3017 (0.9 cM) D16S499 (1.5 cM) D16S3036, centromere. Login to comment
59 The shared haplotype in alleles containing the R1164X mutation in families 1 and 2 is in boldface italics. Login to comment
70 Comparative sequencing of the proband`s PCR product revealed an apparently homozygous single-base-pair substitution, 3490CrT, which resulted in replacement of a codon for arginine by a stop codon, a mutation designated "R1164X" (fig. 2A). Login to comment
72 CSGE and sequence analysis of other members of this family indicated that the older, clinically affected brother (II-2) of the proband similarly appeared homozygous for the mutation R1164X. Login to comment
74 The proband`s maternal aunt (I-10) and paternal uncle (I-1) showed the normal allele only, whereas the proband`s younger brother (II-7) was clearly heterozygous for the mutation R1164X. Login to comment
75 Sequence analysis of the children (generation III) of the two affected individuals revealed that five of them were heterozygous for the mutation R1164X, whereas two of them (III-2 and III-8) were apparently homozygous for the normal sequence. Login to comment
78 The inheritance of the latter allele conferred heterozygous carrier status of the mutation R1164X to individuals II-7, III-1, III-4, III-5, III-7, and III-9 (fig. 1). Login to comment
80 Collectively, these findings suggest that the proband (II-5) and her clinically affected older brother (II-2) had inherited from their father a nonsense mutation R1164X in exon 24 of the ABCC6 gene, and they had inherited from their mother a deletion mutation spanning exon 24 of the gene, thus reducing the paternal nonsense mutation to hemizygosity. Login to comment
93 Initial mutation detection by PCR amplification of ABCC6, followed by CSGE and nucleotide sequencing, demonstrated the presence of an apparently homozygous R1164X mutation in both the proband and his older brother. Login to comment
95 Restriction-enzyme digestion with AciI revealed that, of the proband`s three children, the daughter and the younger son showed evidence for the wild-type allele only, while the middle child was clearly heterozygous for the R1164X mutation. Login to comment
96 The two children of the proband`s daughter, who were examined at the ages of 12 and 10 years, respectively, were clinically normal and did not show evidence for the R1164X mutation. Login to comment
97 If the proband were truly homozygous for the R1164X mutation, his children would be expected to be heterozygous carriers of this mutation. Login to comment
146 The deletion mutation in each of these four families is associated with single-base-pair substitutions, two of them being the same one-R1164X in families 1 and 2. Login to comment
148 Thus, a founder effect for the R1164X mutation cannot be excluded with certainty, despite the apparently diverse ethnic backgrounds of these two families (table 1). Login to comment
154 In each family, the proband was initially shown to be apparently homozygous for a nucleotide substitution, resulting in either a nonsense mutation (R1164X, R1164X, and R1141X in families 1, 2, and 3, respectively) or a splice-site mutation (3736-1GrA in family 4). Login to comment
180 Exon 24 encodes a segment of MRP6 residing within TMSD3, and the mutations R1141X and R1164X are predicted to result in the synthesis of a truncated polypeptide entirely devoid of NBF2 (fig. 4A). Login to comment

[hide] Molecular genetics of pseudoxanthoma elasticum: a ... Trends Mol Med. 2001 Jan;7(1):13-7. Uitto J, Pulkkinen L, Ringpfeil F
Molecular genetics of pseudoxanthoma elasticum: a metabolic disorder at the environment-genome interface?
Trends Mol Med. 2001 Jan;7(1):13-7., [PMID:11427982]

Abstract [show]
Pseudoxanthoma elasticum (PXE) is a relatively rare heritable disorder affecting the skin, eyes and cardiovascular system, with considerable morbidity and mortality. The disease affects the elastic fibers of affected organs, which become progressively calcified. Thus, PXE has been considered as a prototypic heritable connective tissue disorder affecting the elastic fiber system. Recently, PXE has been linked to mutations in the MRP6/ABCC6 gene, a member of the ABC transporter family, expressed primarily in the liver and the kidneys. This information, together with clinical observations suggesting environmental, hormonal and/or dietary modulation of the disease, raises the intriguing possibility that PXE is a primary metabolic disorder at the environment-genome interface.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
75 Thisraisesthequestionoftherelationshipbetweenthe MRP6mutationsandthemanifestationsinPXE affectingtheelasticfibersinvariousorgans.Itmaywell Opinion CR1339C G1345R TRENDS in Molecular Medicine 10 kb NBF2NBF1 0.5 kb Extracellular Intracellular GS 5' 3' R1138Q R1164X R1141X R1138W 2787+1G T A455P R518Q R1114P R1314W (a) (b) (c) EcoRI SmaI SmaI SmaI SacI SacI SmaI N GS 2542delG 1944del22 4220insAGAA 3775delT 3736-1G A Fig. 3. Login to comment

[hide] Pseudoxanthoma elasticum: Point mutations in the A... Hum Mutat. 2001;18(1):85. Meloni I, Rubegni P, De Aloe G, Bruttini M, Pianigiani E, Cusano R, Seri M, Mondillo S, Federico A, Bardelli AM, Andreassi L, Fimiani M, Renieri A
Pseudoxanthoma elasticum: Point mutations in the ABCC6 gene and a large deletion including also ABCC1 and MYH11.
Hum Mutat. 2001;18(1):85., [PMID:11439001]

Abstract [show]
Pseudoxanthoma elasticum (PXE) is a mendelian disorder characterized by calcification of elastic fibers in skin, arteries, and retina. It results in dermal lesions, arterial insufficiency and retinal hemorrhages, leading to macular degeneration. PXE is transmitted either as an autosomal dominant or recessive trait and several sporadic cases have been observed. Mutations in the ABCC6 gene have been identified very recently in patients. Here, we report on a large Italian family affected by pseudoxanthoma elasticum for which linkage analysis had pointed to a region encompassing markers D16S3069-D16S405-D16S3103; hemizygosity of marker D16S405 allowed us to detect a submicroscopic deletion of at least 900 kb involving ABCC6, ABCC1, and MYH11. Mutation analysis on the other allele of the family, as well as on two additional sporadic cases, revealed nonsense (Y227X, R518X, R1164X) and frame-shift (c.960delC) mutations in ABCC6 (MRP6) further confirming the role of this multi-drug resistance gene in the etiology of pseudoxanthoma elasticum. Furthermore, clinical re-examination of members of the family harboring the deletion led to the detection of additional features, potentially caused by the deletion of the MYH11 gene. In the course of the analysis five nonpathogenic variants were found in ABCC6: 1233T>C, 1245G>A, 1838 T>G (V614A), 1890C>G, and 3506+83C>A. Hum Mutat 18:85, 2001.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 Mutation analysis on the other allele of the family, as well as on two additional sporadic cases, revealed nonsense (Y227X, R518X, R1164X) and frame-shift (c.960delC) mutations in ABCC6 (MRP6) further confirming the role of this multi-drug resistance gene in the etiology of pseudoxanthoma elasticum. Login to comment
57 Two of them (R518X and R1164X) are C to T transitions in a CpG dinucleotide causing a substitution of arginine (CGA) with a stop codon (TGA); they were identified in exon 12 and exon 24 in the two sporadic cases in the heterozygous state (patients 11 and 12). Login to comment
95 Mutations and variants in ABCC6 nt change Mutations 681 C ->G 960delC 1552 C ->T 3490 C ->T Non pathogenic variants 1233 T ->C 1245 G ->A 1838 T->G 1890 C->G c.3506+83 C ->A protein change Y227X frame-shift from I320 R518X R1164X N411N N415N V614A T630T _ exon 7 11 exon 8 family exon 12 11 exon 24 12 exon 10 11 exon 10 11 exon 14 11, 12 exon patient 11 11 12 exon 14 exon 24 11 11, 12 11, 12 Re-evaluation of the phenotype in the family with the large deletion did not reveal significant additional manifestations, suggesting that heterozygous ABCC1 and MYH11 deletion does not give rise to an obvious phenotype. Login to comment

[hide] Molecular genetics of pseudoxanthoma elasticum. Exp Dermatol. 2001 Aug;10(4):221-8. Ringpfeil F, Pulkkinen L, Uitto J
Molecular genetics of pseudoxanthoma elasticum.
Exp Dermatol. 2001 Aug;10(4):221-8., [PMID:11493310]

Abstract [show]
Pseudoxanthoma elasticum (PXE), a systemic heritable connective tissue disorder, is characterized by progressive calcification of elastic structures in the skin, the eyes and the cardiovascular system, with considerable intra- and interfamilial phenotypic variability. Recently, underlying genetic defects have been identified in the ABCC6 gene, which resides on the chromosomal locus 16p13.1 and encodes the MRP6 protein, a member of the ATP-binding cassette (ABC) family of proteins. The affected individuals are homozygous or compound heterozygous for a spectrum of genetic lesions, including nonsense and missense mutations, or deletions and splice-site alterations, confirming the autosomal recessive nature of this condition. Analysis of the deduced primary sequence suggests that MRP6 is a transmembrane transporter, but its function has not been delineated yet. Surprisingly, however, MRP6 is expressed primarily, if not exclusively, in the liver and the kidneys, suggesting that PXE may be a primary metabolic disorder with secondary involvement of elastic fibers. Identification of mutations in the ABCC6 gene in PXE provides a means for prenatal and presymptomatic testing in families at risk for recurrence. DNA-based analyses will also identify heterozygous carriers who may be at risk for development of limited manifestations of the disease as a result of compounding genetic factors and/or environmental modifiers.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 Three recurrent mutations, R1141X, R1164X, and Del exon 23-29, are boxed (see text). Login to comment
87 Among the PTC causing mutations, two recurrent nonsense mutations, R1141X and R1164X, have been identified Figure . Login to comment

[hide] A spectrum of ABCC6 mutations is responsible for p... Am J Hum Genet. 2001 Oct;69(4):749-64. Epub 2001 Aug 31. Le Saux O, Beck K, Sachsinger C, Silvestri C, Treiber C, Goring HH, Johnson EW, De Paepe A, Pope FM, Pasquali-Ronchetti I, Bercovitch L, Marais AS, Viljoen DL, Terry SF, Boyd CD
A spectrum of ABCC6 mutations is responsible for pseudoxanthoma elasticum.
Am J Hum Genet. 2001 Oct;69(4):749-64. Epub 2001 Aug 31., [PMID:11536079]

Abstract [show]
To better understand the pathogenetics of pseudoxanthoma elasticum (PXE), we performed a mutational analysis of ATP-binding cassette subfamily C member 6 (ABCC6) in 122 unrelated patients with PXE, the largest cohort of patients yet studied. Thirty-six mutations were characterized, and, among these, 28 were novel variants (for a total of 43 PXE mutations known to date). Twenty-one alleles were missense variants, six were small insertions or deletions, five were nonsense, two were alleles likely to result in aberrant mRNA splicing, and two were large deletions involving ABCC6. Although most mutations appeared to be unique variants, two disease-causing alleles occurred frequently in apparently unrelated individuals. R1141X was found in our patient cohort at a frequency of 18.8% and was preponderant in European patients. ABCC6del23-29 occurred at a frequency of 12.9% and was prevalent in patients from the United States. These results suggested that R1141X and ABCC6del23-29 might have been derived regionally from founder alleles. Putative disease-causing mutations were identified in approximately 64% of the 244 chromosomes studied, and 85.2% of the 122 patients were found to have at least one disease-causing allele. Our results suggest that a fraction of the undetected mutant alleles could be either genomic rearrangements or mutations occurring in noncoding regions of the ABCC6 gene. The distribution pattern of ABCC6 mutations revealed a cluster of disease-causing variants within exons encoding a large C-terminal cytoplasmic loop and in the C-terminal nucleotide-binding domain (NBD2). We discuss the potential structural and functional significance of this mutation pattern within the context of the complex relationship between the PXE phenotype and the function of ABCC6.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
85 PXE Mutations The most-prevalent mutations detected in the ABCC6 gene were missense substitutions (21 [58.3%] mutations, Table 1 ABCC6 Mutations in a Cohort of Patients with PXE CHANGE IN STATUS a ORIGIN(S)b EXON(S)c REFERENCE(S)Amino Acid Nucleotide … 179-195del ht Belgium 2 Present study … 938-939insT ch, ht SA, UK 8 Present study N411K 1233TrG ht US 10 Present study A455P 1363GrC Nd Nd 11 Uitto et al. (2001) R518Q 1553GrA ch, ht Belgium 12 Present study, Uitto et al. (2001) F568S 1703TrC ch US 13 Present study … ABCC6del15 hm SA 15 Present study … 1944del22 ht Holland 16 Bergen et al. (2000) … 1995delG ht Germany 16 Present study L673P 2018TrC ch SA 16 Present study R765Q 2294GrA ht Germany 18 Present study Y768X 2304CrA ch, ht SA 18 Present study … 2322delC ht US 18 Present study … 2542delG Nd Nd 19 Uitto et al. (2001) … IVS21ϩ1GrT ch US, Germany i-21 Present study, Uitto et al. (2001) R1030X 3088CrT ht SA, UK 23 Present study R1114P 3341GrC hm UK 24 Present study S1121W 3362CrG ch Germany 24 Present study R1138W 3412CrT hm Nd 24 Ringpfeil et al. (2000) R1138P 3413GrC ch Germany 24 Present study R1138Q 3413GrA ch UK, US 24 Present study, Ringpfeil et al. (2000) R1141X 3421CrT All All 24 Present study and othersd R1164X 3490CrT ch Germany, UK 24 Ringpfeil et al. (2001) G1203D 3608GrA ch Germany 25 Present study … IVS26-1GrA ch Belgium i-26 Present study, Ringpfeil et al. (2000, 2001) Q1237X 3709CrT ch Belgium 26 Present study … 3775delT ht, hm SA, US, Holland 27 Present study, Bergen et al. (2000) V1298F 3892GrT ht US 28 Present study T1301I 3902CrT ch Belgium 28 Present study G1302R 3904GrA hm US 28 Present study A1303P 3907GrC ch Belgium 28 Present study R1314W 3940CrT hm US 28 Present study R1314Q 3941GrA ch Germany 28 Present study G1321S 3961GrA ht US 28 Present study R1339C 4015CrT All SA, US 28 Present study, Struk et al. (2000) Q1347H 4041GrC hm US 28 Present study D1361N 4081GrA ch Germany 29 Present study … 4104delC ch Belgium 29 Present study R1398X 4192CrT ch Belgium 29 Present study … ABCC6del23-29 ch US 23-29 Present study, Ringpfeil et al. (2001) … 4220insAGAA ht Holland 30 Bergen et al. (2000) I1424T 4271TrC ht US 30 Present study … ABCC6del ht Holland all Bergen et al. (2000) a Nd p not determined; hm p homozygote; ht p heterozygote; ch p compound heterozygote. Login to comment

[hide] ABCC6 gene polymorphism associated with variation ... J Hum Genet. 2001;46(12):699-705. Wang J, Near S, Young K, Connelly PW, Hegele RA
ABCC6 gene polymorphism associated with variation in plasma lipoproteins.
J Hum Genet. 2001;46(12):699-705., [PMID:11776382]

Abstract [show]
The ATP cassette-binding (ABC) gene superfamily contains more than 40 members, many of which are involved in cellular lipid transport. The most prominent example is ABCA1, mutations in which affect plasma high-density lipoprotein (HDL) cholesterol concentration. ABCC6 is another member of the ABC gene family, and mutations in ABCC6 were recently shown to cause pseudoxanthoma elasticum (PXE). A Canadian patient with PXE was referred for assessment of moderately severe type IV hyperlipoproteinemia with hypoalphalipoproteinemia, which was refractory to pharmacological treatment. We identified intron-exon boundaries of ABCC6 to sequence genomic DNA from this patient to find the disease mutation. We report (1) identification of a set of amplification primers for the 31 exons of ABCC6; (2) identification of the ABCC6 R>X1164 nonsense mutation in the PXE subject with dyslipidemia; (3) identification of common amino acid variants and silent nucleotide variants in ABCC6, with a range of allele frequencies across ethnic groups; (4) evidence consistent with a possible pseudogene encoding 9 exons with sequence homology to ABCC6; and (5) association of the ABCC6 R>Q1268 variant with plasma triglyceride and HDL cholesterol. The results suggest that ABCC6 may be a determinant of plasma lipoproteins.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
67 Primer sequences to amplify coding regions of ABCC6 Product Exon Primer sequence 5Ј to 3Ј size (bp) 1 F: GAGACTTAGCGACAGACAGAC 142 R: TCTGCAGCCAAACCAAGCCTG 2 F: CTGCCTTGTACCATCCTAAGG 225 R: CATTGCCTGGTTCCAGGCTC 3 F: GCCTACCAGTTTGCTGTGAC 259 R: TTGTTCTCCACTGTGGCAGG 4 F: TTGCCTGCCACAGTGGAGAAC 344 R: GACTGGCTTGTGTGTGTCAC 5 F: AGAACCACTAGGAAAGCCAGG 321 R: GAGACCTCAAAGTGGAACAGG 6 F: CACAGTTCGTCCTGTCTTCC 268 R: CGAAGAAGAAAGCACTGAGGC 7 F: TGACTTACCCAGGGTCACAC 268 R: TCTGAAGTAGCATCAGGTGAG 8 F: GCCTCTTAAGTGGGTACTCAG 482 R: GCACCAGATGTATAGGCAGAG 9 F: CGACTGATCCTCCACATCTG 368 R: TGAATGCGTTCTCAGCTGCTG 10 F: GAGAGGTTGGCCTAAGAGAC 417 R: CTCTTCCAGCCTCTTGAATGC 11 F: GACCTCCTATCTCATCCTGTG 401 R: GCAGCTCACAGACGACAAGA 12 F: TTGCTGAAGGGTGGCTGTCA 419 R: GAACAGGATCCAGAATGAGTG 13 F: AGGCTGCCCTATCCATGCTTGC 273 R: GGAAGCTGGAGCCAGGTGTAG 14 F: GCTGTTGCCACACATCTTGAG 317 R: ATGGCGTGATCTGCACGTGTCA 15 F: GATTTCTTCCTGCAGCCTCTG 292 R: TGGAAACCTACACCACCTCTC 16 F: CAGATGTGCACAGGATAGTTC 428 R: GTGAGAGGTGGAGAGAATGAG 17 F: CTCATTCTCTCCACCTCTCAC 413 R: TATTGAGCACCTAGCACGTGC 18 F: CATGTTGAGCTGTACCTCACC 361 R: ACTTGGGTTAGGACTGGATGC 19 F: AGTAGAGATAGGGCTTAGCCG 420 R: CACTCCATTCATGCCAGTAGG 20 F: GAAATGGATGGTCAGAGCGG 239 R: GTGGTCCCTTCAGCTACTTC 21 F: AGAGTACAGAGTGTACCCAG 331 R: GTGAGTATCACTGCCAAGTG 22 F: AAATGGTGCTCCTGGTGGGA 492 R: GACGTTTTGCACACTGTTCC 23 F: GAGCCATCATCATGCTACTG 603 R: TCCAGCTGGGTGAAACCTCA 24 F: TTCTGGAAACTACCTCTCTATGTC 341 R: ATACAATATGACCTCAGGTCTCAC 25 F: GTGTCATCTTCCTCTACTCC 370 R: CTTCAAAGGTCCCACTAGCA 26 F: TGAAGGAAGAGAGGGACCTG 443 R: GTGACTCTGACCTATAGTGG 27 F: CCATCTTGTGTGAAGTCTTAGAG 255 R: CCTTTGGCCTAAACTCCATGAA 28 F: TGGAAAGAGAGATGGAAGGTAG 521 R: AGCACACTTGTACTGCAGCTG 29 F: CTCCAGGATCAGCATCATCC 436 R: CAGAGACTGTGTCAGAGCTTG 30 F: GCAGGAACAGGCTTCCTATC 618 R: CTCCATAGAAGTCCTGCTTTCC 31 F: GAAAGCAGGACTTCTATGGAG 343 R: GAGCAAACACAGGTCTAGACTC A rare ABCC6 mutation in PXE with dyslipidemia The sequencing strategy outlined earlier resulted in the identification of homozygosity for a novel ABCC6 mutation in the PXE subject with dyslipidemia, namely, R1164X (OMIM 603234.0013). Login to comment
88 ABCC6 sequence polymorphisms Exon Nucleotide Amino acid Allele frequencies 10 1256TϾC N411 1256C 0.42 in Caucasians 1268GϾA V415 1268A 0.42 in Caucasians 14 1864TϾC VϾA614a A614 0.17 in Chinese 0.27 in Oji-Cree 0.32 in South Asians 0.41 in Africans 0.45 in Caucasians 0.56 in Inuit 15 1913GϾC T630 1913C 0.40 in Caucasians 1919CϾA HϾQ632 Q632 0.40 in Caucasians 19 2513CϾT A830 2513T 0.08 in Caucasians 24 3513CϾT R1164X X1164 Absent from 223 samples 27 3826GϾA RϾQ1268a Q1268 0.04 in Africans 0.06 in Chinese 0.14 in Oji-Cree 0.16 in South Asians 0.17 in Inuit 0.30 in Caucasians 28 4001CϾT D1326 4001T 0.03 in Caucasians a These SNPs were determined in several ethnic groups because of ease of analysis Table 3. Login to comment

[hide] ABCC6/MRP6 mutations: further insight into the mol... Eur J Hum Genet. 2003 Mar;11(3):215-24. Hu X, Plomp A, Wijnholds J, Ten Brink J, van Soest S, van den Born LI, Leys A, Peek R, de Jong PT, Bergen AA
ABCC6/MRP6 mutations: further insight into the molecular pathology of pseudoxanthoma elasticum.
Eur J Hum Genet. 2003 Mar;11(3):215-24., [PMID:12673275]

Abstract [show]
Pseudoxanthoma elasticum (PXE) is a hereditary disease characterized by progressive dystrophic mineralization of the elastic fibres. PXE patients frequently present with skin lesions and visual acuity loss. Recently, we and others showed that PXE is caused by mutations in the ABCC6/MRP6 gene. However, the molecular pathology of PXE is complicated by yet unknown factors causing the variable clinical expression of the disease. In addition, the presence of ABCC6/MRP6 pseudogenes and multiple ABCC6/MRP6-associated deletions complicate interpretation of molecular genetic studies. In this study, we present the mutation spectrum of ABCC6/MRP6 in 59 PXE patients from the Netherlands. We detected 17 different mutations in 65 alleles. The majority of mutations occurred in the NBF1 (nucleotide binding fold) domain, in the eighth cytoplasmatic loop between the 15th and 16th transmembrane regions, and in NBF2 of the predicted ABCC6/MRP6 protein. The R1141X mutation was by far the most common mutation identified in 19 (32.2%) patients. The second most frequent mutation, an intragenic deletion from exon 23 to exon 29 in ABCC6/MRP6, was detected in 11 (18.6%) of the patients. Our data include 11 novel ABCC6/MRP6 mutations, as well as additional segregation data relevant to the molecular pathology of PXE in a limited number of patients and families. The consequences of our data for the molecular pathology of PXE are discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
38 Table 2 Summary of ABCC6/MRP6 mutations associated with PXE known today: our data combined with those of the literature Mutation Protein alteration Nucleotide substitution Location Reference Nonsense Q378X 1132C > T Exon 9 19,20 R518X 1552C > T Exon 2 41 Q749X 2247C > T Exon 17 This study Y768X 2304C > A Exon 18 22 R1030X 3088C > T Exon 23 22 R1141X 3421C > T Exon 24 12,20,22,38,39, this study R1164X 3490C > T Exon 24 12,41 Q1237X 3709C > T Exon 26 22 R1398X 4192C >T Exon 29 22 T364R Missense N411K 1091C > G Exon 9 20 A455P 1233T > G Exon 10 22 R518Q 1363G > C Exon 11 38 F568S 1553G > A Exon 12 22,38 L673P 1703T > C Exon 13 22 R765Q 2018T > C Exon 16 22 R1114P 2294G > A Exon 18 22, this study R1114H 3341G > C Exon 24 22 S1121W 3341G > A Exon 24 This study T1130M 3362C > G Exon 24 22 R1138W 3390C > T Exon 24 This study R1138Q 3412C > T Exon 24 12 R1138P 3413G > A Exon 24 12,22 G1203D 3413G > C Exon 24 22 R1221C 3608G > A Exon 25 22 V1298F 3663C > T Exon 26 This study T1301I 3892G > T Exon 28 22 G1302R 3902C > T Exon 28 22 A1303P 3904G > A Exon 28 22, this study R1314W 3907G > C Exon 28 22, this study R1314Q 3940C > T Exon 28 22 G1321S 3941G > A Exon 28 22 R1339C 3961G > A Exon 28 22 Q1347H 4015C > T Exon 28 22,39 G1354R 4041G > C Exon 28 22 D1361N 4060G > C Exon 29 20,38 K1394N 4081G > A Exon 29 22 I1424T 4182G > T Exon 29 This study R1459C 4271T > C Exon 30 22 4377C > T Exon 30 This study Frameshift IVS17-12delT T Intron 17 This study IVS21+1G>T Intron 21 22,38 IVS26-1G>A Intron 26 12,21,22 179del 9 Exon 2 20 179-195del Exon 2 22 960del C Exon 8 41 1944del22 Exon 16 This study 1995delG Exon 16 22 2322delC Exon 18 22 2542delG Exon 19 41 3775delT Exon 27 This study 4104delC Exon 29 22 4182delG Exon 29 This study 938-939insT Exon 8 22 4220insAGAA Exon 30 This study Large deletion Exons 23-29 21, This study Exon 15 22 ABCC1, ABCC6 41, this study Mutation types The mutation types found in this study are summarized in Table 1. Login to comment

[hide] Pseudoxanthoma elasticum: a clinical, histopatholo... Surv Ophthalmol. 2003 Jul-Aug;48(4):424-38. Hu X, Plomp AS, van Soest S, Wijnholds J, de Jong PT, Bergen AA
Pseudoxanthoma elasticum: a clinical, histopathological, and molecular update.
Surv Ophthalmol. 2003 Jul-Aug;48(4):424-38., [PMID:12850230]

Abstract [show]
Pseudoxanthoma elasticum is an autosomally inherited disorder that is associated with the accumulation of mineralized and fragmented elastic fibers in the skin, Bruch's membrane in the retina, and vessel walls. The ophthalmic and dermatologic expression of pseudoxanthoma elasticum and its vascular complications are heterogeneous, with considerable variation in phenotype, progression, and mode of inheritance. Using linkage analysis and mutation detection techniques, mutations in the ABCC6 gene were recently implicated in the etiology of pseudoxanthoma elasticum. ABCC6 encodes the sixth member of the ATP-binding cassette transporter and multidrug resistance protein family (MRP6). In humans, this transmembrane protein is highly expressed in the liver and kidney. Lower expression was found in tissues affected by pseudoxanthoma elasticum, including skin, retina, and vessel walls. So far, the substrates transported by the ABCC6 protein and its physiological role in the etiology of pseudoxanthoma elasticum are not known. A functional transport study of rat MRP6 suggests that small peptides such as the endothelin receptor antagonist BQ123 are transported by MRP6. Similar molecules transported by ABCC6 in humans may be essential for extracellular matrix deposition or turnover of connective tissue at specific sites in the body. One of these sites is Bruch's membrane. This review is an update on etiology of pseudoxanthoma elasticum, including its clinical and genetic features, pathogenesis, and biomolecular basis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
193 TABLE 3 Summary of ABCC6 Mutations in PXE Patients Mutation Protein Alteration Nucleotide Substitution Location Reference Nonsense Q378X 1132C Ͼ T Exon 9 16,107 R518X 1552C Ͼ T Exon 12 88 Y768X 2304C Ͼ A Exon 18 67 R1030X 3088C Ͼ T Exon 23 67 R1141X 3421C Ͼ T Exon 24 12,45,67,107,111,112,133 R1164X 3490C Ͼ T Exon 24 88,112 Q1237X 3709C Ͼ T Exon 26 67 R1398X 4192C Ͼ T Exon 29 67 Missense T364R 1091C Ͼ G Exon 9 107 N411K 1233T Ͼ G Exon 10 67 A455P 1363G Ͼ C Exon 11 142 R518Q 1553G Ͼ A Exon 12 67,142 F568S 1703T Ͼ C Exon 13 67 L673P 2018T Ͼ C Exon 16 67 R765Q 2294G Ͼ A Exon 18 67 R1114P 3341G Ͼ C Exon 24 67 S1121W 3362C Ͼ G Exon 24 67 R1138W 3412C Ͼ T Exon 24 111 R1138Q 3413G Ͼ A Exon 24 67,111 R1138P 3413G Ͼ C Exon 24 67 G1203D 3608G Ͼ A Exon 25 67 V1298F 3892G Ͼ T Exon 28 67 T13011 3902C Ͼ T Exon 28 67 G1302R 3904G Ͼ A Exon 28 67 A1303P 3907G Ͼ C Exon 28 67 R1314W 3940C Ͼ T Exon 28 67 R1314Q 3941G Ͼ A Exon 28 67 G1321S 3961G Ͼ A Exon 28 67 R1339C 4015C Ͼ T Exon 28 67,133 Q1347H 4041G Ͼ C Exon 28 67 G1354R 4060G Ͼ C Exon 29 107,142 D1361N 4081G Ͼ A Exon 29 67 11424T 4271T Ͼ C Exon 30 67 Frameshift Splicing IVS21 ϩ 1G ϾT Intron 21 67,142 IVS26-1G ϾA Intron 26 67,111,112 Deletion 179del9 Exon 2 107 179-195del Exon 2 67 960delC Exon 8 88 1944del22 Exon 16 12 1995delG Exon 16 67 2322delC Exon 18 67 2542delG Exon 19 67 3775delT Exon 27 12,67 4101delC Exon 29 67 Insertion 938-939insT Exon 8 67 4220insAGAA Exon 30 12 Intragenic deletion Exon 23-29 67,112 Exon 15 67 Intergenic deletion ABCC6 12,88 LOCAL RETINAL TRANSPORT FUNCTION OF ABCC6 ABCC6 Expression in the Retina Bergen et al detected ABCC6 expression in various tissues in man.12 Low expression levels of ABCC6 were observed in the retina as well as other tissues usually affected by PXE, including skin and vessel wall. Login to comment

[hide] Novel ABCC6 mutations in pseudoxanthoma elasticum. J Invest Dermatol. 2004 Mar;122(3):608-13. Chassaing N, Martin L, Mazereeuw J, Barrie L, Nizard S, Bonafe JL, Calvas P, Hovnanian A
Novel ABCC6 mutations in pseudoxanthoma elasticum.
J Invest Dermatol. 2004 Mar;122(3):608-13., [PMID:15086542]

Abstract [show]
Pseudoxanthoma elasticum (PXE) is a heritable connective tissue disorder caused by mutations in an ABC (ATP-Binding Cassette) transporter gene (ABCC6), which manifests with cutaneous, ophthalmologic, and cardiovascular findings. We studied a cohort of 19 families with PXE, and identified 16 different mutations, nine of which were novel variants. The mutation detection rate was about 77%. We found that arginine codon 518 was, with the previously described R1141X and EX23_29del, a recurrently mutated amino acid (11.5% of the mutations detected for each variant R518Q and R518X). No clear delineation of genotype/phenotype correlation was identified, and marked intra-familial variability of the disease was seen in one family. One family with pseudodominant inheritance displayed three distinct ABCC6 mutations, providing further evidence for the probable exclusive recessive transmission of PXE. These data contribute to the expanding database of ABCC6 mutations, to the description of phenotypic variability, and inheritance in PXE, and should be helpful for genetic counselling.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
33 1552C4T 12 1 0 0 18 France F 31 R1141X 3421C4T 24 1 0 0 W1223X 3668G4A 26 19-1 France M 18 R1164X/? Login to comment
34 3490C4T 24 1 0 0 19-2 M 15 R1164X/? Login to comment

[hide] Pseudoxanthoma elasticum: a clinical, pathophysiol... J Med Genet. 2005 Dec;42(12):881-92. Epub 2005 May 13. Chassaing N, Martin L, Calvas P, Le Bert M, Hovnanian A
Pseudoxanthoma elasticum: a clinical, pathophysiological and genetic update including 11 novel ABCC6 mutations.
J Med Genet. 2005 Dec;42(12):881-92. Epub 2005 May 13., [PMID:15894595]

Abstract [show]
Pseudoxanthoma elasticum (PXE) is an inherited systemic disease of connective tissue primarily affecting the skin, retina, and cardiovascular system. It is characterised pathologically by elastic fibre mineralisation and fragmentation (so called "elastorrhexia"), and clinically by high heterogeneity in age of onset and the extent and severity of organ system involvement. PXE was recently associated with mutations in the ABCC6 (ATP binding cassette subtype C number 6) gene. At least one ABCC6 mutation is found in about 80% of patients. These mutations are identifiable in most of the 31 ABCC6 exons and consist of missense, nonsense, frameshift mutations, or large deletions. No correlation between the nature or location of the mutations and phenotype severity has yet been established. Recent findings support exclusive recessive inheritance. The proposed prevalence of PXE is 1/25,000, but this is probably an underestimate. ABCC6 encodes the protein ABCC6 (also known as MRP6), a member of the large ATP dependent transmembrane transporter family that is expressed predominantly in the liver and kidneys, and only to a lesser extent in tissues affected by PXE. The physiological substrates of ABCC6 remain to be determined, but the current hypothesis is that PXE should be considered to be a metabolic disease with undetermined circulating molecules interacting with the synthesis, turnover, or maintenance of elastic fibres.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
378 Interestingly, among the 49 different missense mutations in ABCC6 (42 previously published and seven new ones in the present study), the majority (43) replace critical amino acids in intracellular domains (seven and 19 mutations are located in I1424T R1459C 4220insAGAA 4318delA G1354R D1361N K1394N E1400K R1298X 410delC 418delG 3775delT R1275X R1221C D1238H W1223X Q1237X IVS26-1G→A R1114C R1114H R1114P S1121W M1127T T1130M R1138P R1138Q R1138W R1141X R1164X R765Q A766D Y768X A781V 2322delC IVS19-2delAG T364R R391G Q378X Q363_R373del 938_939insT 960delC IVS8+2delTG G199X Y227X 179_195del 179_187del G226R V74del Q749X IVS17-12delTT IVS14-5T→G IVS13-29T→A R600G V1298F G1299S T1301I G1302R A1303P S1307P R1314Q R1314W G1321S L1335P R1339C P1346S Q1347H R1030X F1048del R807Q V810M A820P 254delG L673P 1944_1966del 1995delG R518Q R518X K502M A455P G992R IVS21+1G→T G1203DF568SN411K C440G IVS25-3C→A 3544dupC Ex23_29del 30 Ex15del ABCC6del 252015105 Figure 10 Position of the mutations in the ABCC6 gene. Login to comment
379 Table 2 ABCC6 mutations Nucleotide variation Protein alteration Location (gene ) Location (protein) Reference Missense 676 GRA G226R Exon 7 CL 3 This study 1091 CRG T364R Exon 9 TS 7 63, 78 1171 ARG R391G Exon 9 CL 4 88 1233 TRG N411K Exon 10 CL 4 63, 90 1318 TRG C440G Exon 10 TS 8 63 1363 GRC A455P Exon 11 TS 9 86 1505 ART K502M Exon 12 CL 5 This study 1553 GRA R518Q Exon 12 CL 5 63, 86, 88, 90 1703 TRC F568S Exon 13 ECL 5 90 1798 CRT R600G Exon 14 CL 6 63 2018 TRC L673P Exon 16 NBF 1 90 2294 GRA R765Q Exon 18 NBF 1 87, 90 2297 CRA A766D Exon 18 NBF 1 88 2342 CRT A781V Exon 18 NBF 1 This study 2420 GRA R807Q Exon 19 NBF 1 This study 2428 GRA V810M Exon 19 NBF1 63 2458 GRC A820P Exon 19 NBF1 63 2965 GRC G992R Exon 22 ECL 6 This study 3340 CRT R1114C Exon 24 CL 8 63 3341 GRA R1114H Exon 24 CL 8 87 3341 GRC R1114P Exon 24 CL 8 90 3362 CRG S1121W Exon 24 CL 8 90 3380 CRT M1127T Exon 24 CL 8 63 3389 CRT T1130M Exon 24 CL 8 63, 87, 88 3412 CRT R1138W Exon 24 CL 8 17 3413 GRC R1138P Exon 24 CL 8 90 3413 GRA R1138Q Exon 24 CL 8 17, 63, 88, 90 3608 GRA G1203D Exon 25 TS17 90 3663 CRT R1221C Exon 26 COOH 87 3712 GRC D1238H Exon 26 COOH 88 3892 GRT V1298F Exon 28 NBF 2 90 3895 GRA G1299S Exon 28 NBF 2 This study 3902 CRT T1301I Exon 28 NBF 2 90 3904 GRA G1302R Exon 28 NBF 2 87, 90 3907 GRC A1303P Exon 28 NBF 2 87, 90 3919 TRC S1307P Exon 28 NBF 2 This study 3940 CRT R1314W Exon 28 NBF 2 90 3941 GRA R1314Q Exon 28 NBF 2 90 3961 GRA G1321S Exon 28 NBF 2 90 4004 TRC L1335P Exon 28 NBF 2 88 4015 CRT R1339C Exon 28 NBF 2 18, 63, 90 4036 CRT P1346S Exon 28 NBF 2 63 4041 GRC Q1347H Exon 28 NBF 2 90 4060 GRC G1354R Exon 29 NBF 2 78, 86 4081 GRA D1361N Exon 29 NBF 2 90 4182 GRT K1394N Exon 29 NBF 2 87 4198 GRA E1400K Exon 29 NBF 2 63, 88 4271 TRC I1424T Exon 30 NBF 2 90 4377 CRT R1459C Exon 30 NBF 2 87 Nonsense 595 CRT G199X Exon 5 89 681 CRG Y227X Exon 7 84 1132 CRT Q378X Exon 9 63, 78, 83 1552 CRT R518X Exon 12 63, 84, 88 2245 CRT Q749X Exon 17 87 2304 CRA Y768X Exon 18 90 3088 CRT R1030X Exon 23 63, 90 3421 CRT R1141X Exon 24 15, 17, 18, 63, 78, 85, 87, 88, 90 3490 CRT R1164X Exon 24 84, 85, 88 3668 GRA W1223X Exon 26 88 3709 CRT Q1237X Exon 26 90 3823 CRT R1275X Exon 27 63 4192 CRT R1398X Exon 29 90 Splicing alteration IVS8+2delTG Intron 8 This study IVS13-29 TRA Intron 13 This study IVS14-5 TRG Intron 14 This study IVS17-12delTT Intron 17 87 IVS18-2delAG Intron 17 63 IVS21+1 GRT Intron 21 86, 90 IVS25-3 CRA Intron 25 88 IVS26-1 GRA Intron 26 17, 63, 90 Insertion 938_939insT Frameshift Exon 8 90 3544dupC Frameshift Exon 25 63 4220insAGAA Frameshift Exon 30 15, 87 Small deletion 179_187del Frameshift Exon 2 78 179_195del Frameshift Exon 2 90 Pseudoxanthoma elasticum www.jmedgenet.com NBF1 and NBF2, respectively), four are located in transmembrane domains, and only two mutations have been identified in extracellular domains. Login to comment

[hide] Molecular genetics of pseudoxanthoma elasticum: ty... Hum Mutat. 2005 Sep;26(3):235-48. Miksch S, Lumsden A, Guenther UP, Foernzler D, Christen-Zach S, Daugherty C, Ramesar RK, Lebwohl M, Hohl D, Neldner KH, Lindpaintner K, Richards RI, Struk B
Molecular genetics of pseudoxanthoma elasticum: type and frequency of mutations in ABCC6.
Hum Mutat. 2005 Sep;26(3):235-48., [PMID:16086317]

Abstract [show]
Pseudoxanthoma elasticum (PXE) is a systemic heritable disorder that affects the elastic tissue in the skin, eye, and cardiovascular system. Mutations in the ABCC6 gene cause PXE. We performed a mutation screen in ABCC6 using haplotype analysis in conjunction with direct sequencing to achieve a mutation detection rate of 97%. This screen consisted of 170 PXE chromosomes in 81 families, and detected 59 distinct mutations (32 missense, eight nonsense, and six likely splice-site point mutations; one small insertion; and seven small and five large deletions). Forty-three of these mutations are novel variants, which increases the total number of PXE mutations to 121. While most mutations are rare, three nonsense mutations, a splice donor site mutation, and the large deletion comprising exons 23-29 (c.2996_4208del) were identified as relatively frequent PXE mutations at 26%, 5%, 3.5%, 3%, and 11%, respectively. Chromosomal haplotyping with two proximal and two distal polymorphic markers flanking ABCC6 demonstrated that most chromosomes that carry these relatively frequent PXE mutations have related haplotypes specific for these mutations, which suggests that these chromosomes originate from single founder mutations. The types of mutations found support loss-of-function as the molecular mechanism for the PXE phenotype. In 76 of the 81 families, the affected individuals were either homozygous for the same mutation or compound heterozygous for two mutations. In the remaining five families with one uncovered mutation, affected showed allelic compound heterozygosity for the cosegregating PXE haplotype. This demonstrates pseudo-dominance as the relevant inheritance mechanism, since disease transmission to the next generation always requires one mutant allelic variant from each parent. In contrast to other previous clinical and molecular claims, our results show evidence only for recessive PXE. This has profound consequences for the genetic counseling of families with PXE.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
147 The c.3490C4T (p.R1164X) mutation identified in our initial mutation screen [Struk et al., 2000] cosegregated with the (323- 165-null-137) haplotype. Login to comment
148 In our current study we identified the p.R1164X mutation in nine PXE chromosomes, segregating with five distinct and unrelated haplotypes, which suggests that this location is more likely a mutational hotspot in ABCC6. Login to comment
246 PXE Mutations While most mutations are unique variants that represent the typical allelic heterogeneity of a recessive disease, we observed five mutations (p.R1141X [26%], p.I1000_S1403delW1404fsX1463 [11%], p.R1164X [5.3%], p.Q378X [3.5%], and c.278711G4T [3%]) at higher frequencies that accounted for almost 50% (exactly 48.8%) of the PXE mutations. Login to comment
263 The p.R1164X mutation occurs at a nonconserved arginyl residue, and the nine chromosomes carrying this mutation represent five haplotype groups. Login to comment
266 Similarly to p.R1164X, the six chromosomes that carry the p.Q378X mutation represent four independent haplotypes. Login to comment

[hide] Mutation detection in the ABCC6 gene and genotype-... J Med Genet. 2007 Oct;44(10):621-8. Epub 2007 Jul 6. Pfendner EG, Vanakker OM, Terry SF, Vourthis S, McAndrew PE, McClain MR, Fratta S, Marais AS, Hariri S, Coucke PJ, Ramsay M, Viljoen D, Terry PF, De Paepe A, Uitto J, Bercovitch LG
Mutation detection in the ABCC6 gene and genotype-phenotype analysis in a large international case series affected by pseudoxanthoma elasticum.
J Med Genet. 2007 Oct;44(10):621-8. Epub 2007 Jul 6., [PMID:17617515]

Abstract [show]
BACKGROUND: Pseudoxanthoma elasticum (PXE), an autosomal recessive disorder with considerable phenotypic variability, mainly affects the eyes, skin and cardiovascular system, characterised by dystrophic mineralization of connective tissues. It is caused by mutations in the ABCC6 (ATP binding cassette family C member 6) gene, which encodes MRP6 (multidrug resistance-associated protein 6). OBJECTIVE: To investigate the mutation spectrum of ABCC6 and possible genotype-phenotype correlations. METHODS: Mutation data were collected on an international case series of 270 patients with PXE (239 probands, 31 affected family members). A denaturing high-performance liquid chromatography-based assay was developed to screen for mutations in all 31 exons, eliminating pseudogene coamplification. In 134 patients with a known phenotype and both mutations identified, genotype-phenotype correlations were assessed. RESULTS: In total, 316 mutant alleles in ABCC6, including 39 novel mutations, were identified in 239 probands. Mutations were found to cluster in exons 24 and 28, corresponding to the second nucleotide-binding fold and the last intracellular domain of the protein. Together with the recurrent R1141X and del23-29 mutations, these mutations accounted for 71.5% of the total individual mutations identified. Genotype-phenotype analysis failed to reveal a significant correlation between the types of mutations identified or their predicted effect on the expression of the protein and the age of onset and severity of the disease. CONCLUSIONS: This study emphasises the principal role of ABCC6 mutations in the pathogenesis of PXE, but the reasons for phenotypic variability remain to be explored.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
248 Of these, R1339C, R1164X and 2787+1gRc represented 5.0%, 4.7% and 2.8%, respectively, of the 316 alleles identified. Login to comment
250 The high incidence of R1339C in the South African population is probably due to a founder effect.26 Conversely, R1164X (0/40 alleles) and 2787+1gRc (0 of 40 alleles) were absent in the South African case series but were prevalent in the European and American patient populations. Login to comment
254 Collectively, the mutations in exons 24 and 28, including the common mutations R1141X and del 23-29, accounted for 71.5% of all the 316 mutations identified in this study (table 2), and the 11 most prevalent mutations (R1141X, del23-29, R1339C, R1164X, 2787+1GRT, G1302R, R1138Q, R1138W, Q378X, R1314W, R518Q) accounted for 70% (223 of 316) of the mutant alleles identified (table 2). Login to comment
262 Genotype-phenotype correlations The comparison of subjects whose mutations would probably have resulted in no functional protein with those whose mutations would probably have resulted in some functional Table 2 Distinct mutations identified in the international case series of 271 patients with PXE Nucleotide change*À Predicted consequenceÀ Frequency (alleles) Exon-intron location Domain affected` Mutant alleles (%) References1 c.105delA p.S37fsX80 2 2 0.6 28 c.177-185del9 p.R60_Y62del 1 2 0.3 9, 28 c.179del12ins3 p. R60_W64del L60_R61ins 1 2 0.3 c.220-1gRc SJ 1 IVS 2 0.3 c.724gRt p.E242X 1 7 0.3 c.938insT FS 1 8 0.3 25 c.998+2delT SJ 1 IVS 8 0.3 2, 21 c.998+2del2 SJ 1 IVS 8 0.3 18 c.951cRg p.S317R 2 9 TM6 0.6 28 c.1087cRt p.Q363X 1 9 0.3 c.1091gRa p.T364R 1 9 TM7 0.3 9, 19, 21, 28 c.1132cRt p.Q378X 4 9 1.2 9, 17-19, 28, 37 c.1144cRt p.R382W 2 9 IC4 0.6 c.1171aRg p.R391G 3 9 IC4 0.9 9, 18, 28, 37 c.1176gRc p.K392N 1 9 IC4 0.3 c.1388tRa p.L463H 1 11 TM9 0.3 c.1484tRa p.L495H 1 12 IC5 0.3 28 c.1552cRt p.R518X 2 12 0.6 18, 19, 27, 28, 37 c.1553gRa p.R518Q 4 12 IC5 1.2 18, 19, 24, 28, 31 c.1603tRc p.S535P 1 12 TM10 0.3 c.1703tRc p.F568S 1 13 TM11 0.3 24 c.1798cRt p.R600C 1 14 TM11 0.3 c.1857insC FS 1 14 0.3 c.1987gRt p.G663C 1 16 NBF1 0.3 c.1999delG FS 1 16 0.3 c.2070+5GRA SJ 2 IVS 16 0.6 c.2093aRc p.Q698P 2 17 NBF1 0.6 c.2097gRt p.E699D 1 17 NBF1 0.3 c.2177tRc p.L726P 1 17 NBF1 0.3 c.2237ins10 FS 2 17 0.6 c.2252tRa p.M751K 1 18 NBF1 0.3 20, 37 c.2263gRa p.G755R 2 18 NBF1 0.6 c.2278cRt p.R760W 3 18 NBF1 0.9 20, 28, 32, 37 c.2294gRa p.R765Q 2 18 NBF1 0.6 20-22, 25, 28, 32, 37 c.2329gRa p.D777N 1 18 NBF1 0.3 c.2359gRt p.V787I 1 18 NBF1 0.3 c.2432cRt p.T811M 1 19 IC6 0.3 6 c.2643gRt p.R881S 1 20 IC6 0.3 c.2787+1GRT SJ 9 IVS 21 2.8 17, 20, 24, 28, 31, 37 c.2814cRg p.Y938X 1 22 0.3 c.2820insC FS 1 22 0.3 c.2831cRt p.T944I 1 22 TM12 0.3 c.2848gRa p.A950T 1 22 TM12 0.3 c.2974gRc p.G992R 1 22 TM13 0.3 2, 42 c.3340cRt p.R1114C 2 24 IC8 0.6 19, 28, 32, 37, 41 c.3389cRt p.T1130M 3 24 IC8 0.9 18, 19, 21, 22, 28, 30, 32, 37, 41 c.3398gRc p.G1133A 1 24 IC8 0.3 c.3412gRa p.R1138W 7 24 IC8 2.2 28, 30, 37 c.3413cRt p.R1138Q 7 24 IC8 2.2 18, 19, 24, 25, 28, 30, 32, 37, 41 c.3415gRa p.A1139T 2 24 IC8 0.6 c.3415gRa & c.2070+5GRA* p.A1139T & SJ 1 24, IVS 16 IC8 0.3 c.3415gRa & c.4335delG* p.A1139T & FS 1 24, 30 IC8 0.3 c.3421cRt p.R1141X 92 24 29.3 5, 9, 15,18, 19, 21, 22, 24, 28, 30-32, 33, 37, 41 c.3427cRt p.Q1143X 1 24 0.3 c.3490cRt p.R1164X 15 24 4.7 18, 27, 28, 31, 33 c.3491gRa p.R1164Q 1 24 IC8 0.3 28 c.3661cRt p.R1221C 1 26 IC9 0.3 21, 22, 28, 29 c.3662gRa p.R1221H 2 26 IC9 0.6 40 c.3676cRa p.L1226I 1 26 IC9 0.3 c.3722gRa p.W1241X 2 26 0.6 c.3774insC FS 2 27 0.6 c.3775delT p.G1259fsX1272 3 27 0.9 15, 25, 28, 41 c.3880-3882del p.K1294del 1 27 0.3 c.3883-5GRA SJ 1 IVS 27 0.3 c.3892gRt p.V1298F 1 28 NBF2 0.3 25 c.3904gRa p.G1302R 7 28 NBF2 2.2 21, 22, 25, 28 c.3907gRc p.A1303P 1 28 NBF2 0.3 21, 22, 25, 28 c.3912delG FS 1 28 0.3 28 c.3940cRt p.R1314W 4 28 NBF2 1.2 24, 25, 32, 36 c.3941gRa p.R1314Q 1 28 NBF2 0.3 25, 28, 32, 36, 41 c.4004tRa p.L1335Q 1 28 NBF2 0.3 c.4015cRt p.R1339C 16 28 NBF2 5.0 19, 25, 28, 33 c.4016gRa p.R1339H 2 28 NBF2 0.6 c.4025tRc p.I1342T 1 28 NBF2 0.3 protein did not yield significant differences. Login to comment

[hide] Pseudoxanthoma elasticum: a streamlined, ethnicity... Clin Transl Sci. 2010 Dec;3(6):295-8. doi: 10.1111/j.1752-8062.2010.00243.x. Larusso J, Ringpfeil F, Uitto J
Pseudoxanthoma elasticum: a streamlined, ethnicity-based mutation detection strategy.
Clin Transl Sci. 2010 Dec;3(6):295-8. doi: 10.1111/j.1752-8062.2010.00243.x., [PMID:21167005]

Abstract [show]
Pseudoxanthoma elasticum (PXE), an autosomal recessive multisystem disorder, is caused by mutations in the ABCC6 gene, and approximately 300 distinct mutations representing >1000 mutant alleles have been disclosed thus far. Few population-based studies have reported mutational hotspots in some geographic areas. In this study, we attempted to correlate recurring mutations with the individuals' ethnic origin. Specifically, we plotted our international database of 70 families from distinct or mixed ethnic backgrounds against their mutations. The frequent p.R1141X mutation was distributed widely across Europe, while deletion of exons 23-29 (del23-29) was encountered in Northern Europe and in Northern Mediterranean countries. p.R1138W may be a marker for French descent, evidenced by its presence also in French Canadians. The splice site transition mutation 3736-1G-->A was seen in the neighboring countries Greece and Turkey, whereas 2542 delG occurs only in the Japanese. Two mutations seem to be present worldwide without evidence of a founder effect, p.Q378X and p.R1339C, suggesting the presence of mutational hotspots. Knowledge of this distribution will allow us to streamline mutation screening through a targeted, stepwise approach when the ethnicity of a patient is known. This will facilitate the identification of individuals at risk, improving their care to prevent ophthalmological and vascular disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
52 Exon 24 also harbored other mutations (p.R1138Q, p.R1164X, and p.R1164Q) that did not appear to have a predilection for specific ethnicities. Login to comment

[hide] [Pseudoxanthoma elasticum]. Ophthalmologe. 2006 Jun;103(6):537-51; quiz 552-3. Ladewig MS, Gotting C, Szliska C, Issa PC, Helb HM, Bedenicki I, Scholl HP, Holz FG
[Pseudoxanthoma elasticum].
Ophthalmologe. 2006 Jun;103(6):537-51; quiz 552-3., [PMID:16763870]

Abstract [show]
Pseudoxanthoma elasticum (PXE) is an inherited disorder that is associated with accumulation of mineralized and fragmented elastic fibers in the skin, vessel walls, and Bruch's membrane. Clinically, patients exhibit characteristic lesions of the skin (soft, ivory-colored papules in a reticular pattern that predominantly affect the neck), the posterior segment of the eye (peau d'orange, angioid streaks, choroidal neovascularizations), and the cardiovascular system (peripheral arterial occlusive disease, coronary occlusion, gastrointestinal bleeding). There is no causal therapy. Recent studies suggest that PXE is inherited almost exclusively as an autosomal recessive trait. Its prevalence has been estimated to be 1:25,000-100,000. The ABCC6 gene on chromosome 16p13.1 is associated with the disease. Mutations within the ABCC6 gene cause reduced or absent transmembraneous transport that leads to accumulation of substrate and calcification of elastic fibers. Although based on clinical features the diagnosis appears readily possible, variability in phenotypic expressions and the low prevalence may be responsible that the disease is underdiagnosed. This review covers current knowledge of PXE and presents therapeutic approaches.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
272 Internetadressen PXE-Selbsthilfegruppe Deutschland : http://www.pxe-groenblad.de PXE International: http://www.pxe.org Tabelle 5 PXE verursachende Mutationen imabcc6-Gen Klassifikation Lokalisation Gen Protein Missense Exon 9 Exon 9 Exon 10 Exon 10 Exon 11 Exon 12 Exon 13 Exon 14 Exon 16 Exon 18 Exon 18 Exon 18 Exon 18 Exon 19 Exon 19 Exon 19 Exon 22 Exon 24 Exon 24 Exon 24 Exon 24 Exon 24 Exon 24 Exon 24 Exon 24 Exon 24 Exon 25 Exon 26 Exon 26 Exon 26 Exon 28 Exon 28 Exon 28 Exon 28 Exon 28 Exon 28 Exon 28 Exon 28 Exon 28 Exon 28 Exon 28 Exon 28 Exon 28 Exon 29 Exon 29 Exon 29 Exon 29 Exon 29 Exon 30 Exon 30 Exon 30 c.1091CaG c.1171AaG c.1233TaG c.1318TaG c.1363GaC c.1553GaA c.1703TaC c.1798CaT c.2018TaC c.2252TaA c.2278CaT c.2294GaA c.2297CaA c.2428GaA c.2458GaC c.2552TaC c.2855TaG c.3340CaT c.3341GaA c.3341GaC c.3362CaG c.3380CaT c.3389CaT c.3412CaT c.3413GaA c.3413GaC c.3608GaA c.3661CaT c.3712GaC c.3715TaC c.3892GaT c.3902CaT c.3904GaA c.3907GaC c.3932GaA c.3940CaT c.3941GaA c.3961GaA c.3976GaA c.4004TaC c.4015CaT c.4036CaT c.4041GaC c.4060GaC c.4069CaT c.4081GaA c.4182GaT c.4198GaA c.4209CaA c.4271TaC c.4377CaT p.T364R p.R391G p.N411K p.C440G p.A455P p.R518Q p.F568S p.R600G p.L673P p.M751K p.R760W p.R765Q p.A766D p.V810M p.A820P p.L851P p.F952C p.R1114C p.R1114H p.R1114P p.S1121W p.M1127T p.T1130M p.R1138W p.R1138Q p.R1138P p.G1203D p.R1221C p.D1238H p.Y1239H p.V1298F p.T1301I p.G1302R p.A1303P p.G1311E p.R1314W p.R1314Q p.G1321S p.D1326N p.L1335P p.R1339C p.P1346S p.Q1347H p.G1354R p.R1357W p.D1361N p.K1394N p.E1400K p.S1403R p.I1424T p.R1459C Klassifikation Lokalisation Gen Protein Nonsense Exon 9 Exon 12 Exon 17 Exon 18 Exon 23 Exon 24 Exon 24 Exon 26 Exon 26 Exon 27 Exon 29 c.1132CaT c.1552CaT c.2247CaT c.2304CaA c.3088CaT c.3421CaT c.3490CaT c.3668GaA c.3709CaT c.3823CaT c.4192CaT p.Q378X p.R518X p.Q749X p.Y768X p.R1030X p.R1141X p.R1164X p.W1223X p.Q1237X p.R1275X p.R1398X Spleißstellen Intron 21 Intron 25 Intron 26 c.2787+1GaT c.3634-3CaA c.3736-1GaA Insertion Exon 8 Exon 25 Exon 30 c.938-939insT c.3544dupC c.4220insAGAA Deletion Exon 2 Exon 2 Exon 3 Exon 8 Exon 9 Exon 16 Exon 16 Exon 18 Exon 19 Exon 22 Exon 27 Exon 29 Exon 29 Exon 30 Exon 31 c.179del9 c.179-195del c.220-222del c.960delC c.1088-1120del c.1944del22 c.1995delG c.2322delC c.2542delG c.2835-2850del16 c.3775delT c.4101delC c.4182delG c.4318delA c.4434delA Intragenische Deletion Exon 15 Exon 18 Exon 23-29 delEx15 delEx18 delEx23-29 Intergenische Deletion ABCC6 delABCC6 Fazit für die Praxis Eine spezifische Behandlung der Grunderkrankung ist nicht bekannt. Login to comment

[hide] Development of a rapid, reliable genetic test for ... J Mol Diagn. 2007 Feb;9(1):105-12. Shi Y, Terry SF, Terry PF, Bercovitch LG, Gerard GF
Development of a rapid, reliable genetic test for pseudoxanthoma elasticum.
J Mol Diagn. 2007 Feb;9(1):105-12., [PMID:17251343]

Abstract [show]
Mutations in the human ABCC6 gene cause pseudoxanthoma elasticum (PXE), a hereditary disorder that impacts the skin, eyes, and cardiovascular system. Currently, the diagnosis of PXE is based on physical findings and histological examination of a biopsy of affected skin. We have combined two simple, polymerase chain reaction (PCR)-based methods to develop a rapid, reliable genetic assay for the majority of known PXE mutations. After PCR amplification and heteroduplex formation, mutations in exon 24 and exon 28 of the ABCC6 gene were detected with Surveyor nuclease, which cleaves double-stranded DNA at any mismatch site. Mutations originating from deletion of a segment of the ABCC6 gene between exon 23 and exon 29 (ex23_ex29del) were detected by long-range PCR. Size analysis of digestion fragments and long-range PCR products was performed by agarose gel electrophoresis. The methods accurately identified mutations or the absence thereof in 16 affected individuals as confirmed by DNA sequencing. Fifteen patients had one or two point mutations, and two of these individuals carried the ex23_ex29del in their second allele. This mutation detection and mapping strategy provides a simple and reliable genetic assay to assist in diagnosis of PXE, differential diagnosis of PXE-like conditions, and study of PXE genetics.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
82 Nuclease Digestion Fragment Sizes of Common Mutations in PXE Exon 24 and 28 Amino acid change Base change Fragment lengths (bp) p.T1130M c.3389CϾT 251,257/508 p.R1138W c.3412CϾT 274,234/508 p.R1138Q c.3413GϾA 275,233/508 p.R1141X c.3421CϾT 281,227/508 p.R1164X c.3490CϾT 352,156/508 p.G1302R c.3904GϾA 116,289/405 p.R1314Q c.3941GϾA 153,252/405 p.R1339C c.4015CϾT 227,178/405 The total lengths of the amplicons are listed after the slash. Login to comment
107 The two most prevalent mutations were the nonsense mutations c.3421CϾT (p.R1141X) and c.3490CϾT (p.R1164X) in exon 24. c.3421CϾT is the most common mutation found in PXE patients of European origin.14,19,20,23,29 c.3490CϾT is a common mutation in individuals of British descent.16,21 Two DNA samples carried the c.3490CϾT (p.R1339C) missense mutation in one exon 28 allele, and in both cases, IVS28 ϩ 49CϾT was also present. Login to comment

[hide] Pseudoxanthoma elasticum: clinical phenotypes, mol... Exp Dermatol. 2009 Jan;18(1):1-11. Epub 2008 Oct 22. Li Q, Jiang Q, Pfendner E, Varadi A, Uitto J
Pseudoxanthoma elasticum: clinical phenotypes, molecular genetics and putative pathomechanisms.
Exp Dermatol. 2009 Jan;18(1):1-11. Epub 2008 Oct 22., [PMID:19054062]

Abstract [show]
Pseudoxanthoma elasticum (PXE), a prototype of heritable multisystem disorders, is characterised by pathologic mineralisation of connective tissues, with primary clinical manifestations in the skin, eyes and the cardiovascular system. The causative gene was initially identified as ABCC6 which encodes an ABC transporter protein (ABCC6) expressed primarily in the liver and the kidneys. The critical role of ABCC6 in ectopic mineralisation has been confirmed by the development of Abcc6(-/-) knock-out mice which recapitulate the features of connective tissue mineralisation characteristic of PXE. Over 300 distinct loss-of-function mutations representative of over 1000 mutant alleles in ABCC6 have been identified by streamlined mutation detection strategies in this autosomal recessive disease. More recently, missense mutations in the GGCX gene, either in compound heterozygous state or digenic with a recurrent ABCC6 nonsense mutation (p.R1141X), have been identified in patients with PXE-like cutaneous findings and vitamin K-dependent coagulation factor deficiency. GGCX encodes a carboxylase which catalyses gamma-glutamyl carboxylation of coagulation factors as well as of matrix gla protein (MGP) which in fully carboxylated form serves as a systemic inhibitor of pathologic mineralisation. Collectively, these observations suggest the hypothesis that a consequence of loss-of-function mutations in the ABCC6 gene is the reduced vitamin K-dependent gamma-glutamyl carboxylation of MGP, with subsequent connective tissue mineralisation. Further progress in understanding the detailed pathomechanisms of PXE should provide novel strategies to counteract, and perhaps cure, this complex heritable disorder at the genome-environment interface.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
68 Identification of additional recurrent nonsense mutations (p.Q378X in exon 9, p.R518X in exon 12 and p.R1164X in exon 24) as well as clustering of the missense mutations to exons 24 and 28 corresponding to the NBFs that are critical for the ATP binding and hydrolysis have allowed the development of streamlined mutation detection strategies to facilitate identification of mutations in the ABCC6 gene with the overall detection rate of up to 99% (for review see reference 26). Login to comment

[hide] Premature termination codon read-through in the AB... J Invest Dermatol. 2013 Dec;133(12):2672-7. doi: 10.1038/jid.2013.234. Epub 2013 May 23. Zhou Y, Jiang Q, Takahagi S, Shao C, Uitto J
Premature termination codon read-through in the ABCC6 gene: potential treatment for pseudoxanthoma elasticum.
J Invest Dermatol. 2013 Dec;133(12):2672-7. doi: 10.1038/jid.2013.234. Epub 2013 May 23., [PMID:23702584]

Abstract [show]
Pseudoxanthoma elasticum (PXE) is an autosomal recessive disorder manifesting with ectopic connective tissue mineralization, caused by mutations in the ABCC6 gene, with ~35% of all mutations being premature termination mutations. In this study, we investigated the therapeutic potential of the nonsense codon read-through-inducing drug, PTC124, in treating PXE. The ability of this drug to facilitate read-through of nonsense mutations was examined in HEK293 cells transfected with human ABCC6 expression constructs harboring seven different PXE-associated nonsense mutations, and was evaluated by immunofluorescence and In-Cell ELISA. Our data demonstrated that PTC124 did not exhibit cytotoxicity in concentrations up to 20 mug ml(-1), and the facilitated read-through varied not only with dose but also with sequence context. Considering the redundancy of the genetic code, it was postulated that in case of the most common recurrent nonsense mutation, p.R1141X, the read-through may result in substitution of the arginine 1,141 by glycine, tryptophan, or cysteine. Their potential pathogenicity was tested in a recently developed zebrafish messenger RNA (mRNA) rescue assay, and demonstrated that all three mRNA transcripts were able to rescue abcc6a morpholino-induced phenotype of zebrafish. Thus, our results suggest that read-through of nonsense mutations in ABCC6 by PTC124 may have potential for pharmacologic treatment of PXE.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
34 Testing of two mutant constructs, p.R1164X and p.R1275X, in the presence of varying concentrations of PTC124 indicated that the highest level of expression was noted with 5 mg ml 1 , as quantified by In-Cell ELISA (Figure 2). Login to comment
38 Different pseudoxanthoma elasticum (PXE)- associated nonsense mutations tested for PTC124 read-through Mutation Nucleotide sequence1 Location (exon) Mutation frequency (%)2 p.R1141X TGA-A 24 54 p.R1164X TGA-C 24 10 p.R518X TGA-G 12 1.2 p.R1398X TGA-G 29 1.2 p.Q378X TAG-A 9 o1 p.Q1143X TAG-G 24 o1 p.R1275X TGA-C 27 o1 1 The sequence depicts the stop codon (bold) followed by the nucleotide shown. Login to comment
53 In this system, injection of 1to 4-cell-stage zebrafish embryos with a morpholino corresponding to the exon 7/intron 7 border of the 12 R1275X R1164X 10 8 6 4 2 0 0 1.2 2.5 5 10 PTC124 (&#b5;g ml-1) 20 40 Normalized OD at 460 nm Figure 2. Login to comment
54 Read-through efficiency of stop codon mutations p.R1275X and p.R1164X by PTC124 in different concentrations. Login to comment

[hide] Efficiency of exome sequencing for the molecular d... J Invest Dermatol. 2015 Apr;135(4):992-8. doi: 10.1038/jid.2014.421. Epub 2014 Sep 29. Hosen MJ, Van Nieuwerburgh F, Steyaert W, Deforce D, Martin L, Leftheriotis G, De Paepe A, Coucke PJ, Vanakker OM
Efficiency of exome sequencing for the molecular diagnosis of pseudoxanthoma elasticum.
J Invest Dermatol. 2015 Apr;135(4):992-8. doi: 10.1038/jid.2014.421. Epub 2014 Sep 29., [PMID:25264593]

Abstract [show]
The molecular etiology of pseudoxanthoma elasticum (PXE), an autosomal recessive connective tissue disorder, has become increasingly complex as not only mutations in ATP-binding cassette family C member 6 (ABCC6) but also ectonucleotide pyrophosphatase/phosphodiesterase 1 (ENPP1) and gamma-glutamyl carboxylase (GGCX) can cause resembling phenotypes. Identification of modifier genes, such as vascular endothelial growth factor A, has further contributed to the molecular heterogeneity of PXE. In such heterogeneous diseases, next-generation sequencing (NGS) allows to perform mutation screening of several genes in a single reaction. We explored whole-exome sequencing (WES) as an efficient diagnostic tool to identify the causal mutations in ABCC6, GGCX, ENPP1, and vitamin K epoxide reductase complex, subunit 1 (VKORC1) in 16 PXE patients. WES identified a causal ABCC6 mutation in 30 out of 32 alleles and one GGCX mutation, whereas no causal mutations in ENPP1 or VKORC1 were detected. Exomes with insufficient reads (20 depth) for the four genes and patients with single mutations were further evaluated by Sanger sequencing (SS), but no additional mutations were found. The potential of WES compared with targeted NGS is the ease to examine target genes and the opportunity to search for novel genes when targeted analysis is negative. Together with low cost, rapid and less laborious workflow, we conclude that WES complemented with SS can provide a tiered approach to molecular diagnostics of PXE.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
89 List of mutations found by WES and SS Gene Nucleotide change Protein change Patient ID Hom/Het WES SS Known/PUR Reference ABCC6 c.C118T p.(P40S) P10 Het O O PUR ABCC6 c.998 &#fe; 2 998 &#fe; 3del TG P8 Het O O PUR ABCC6 c.T1484A p.(L495H) P7 Het O O Known Miksch et al., 2005 ABCC6 c.G1553A p.(R518Q) P11 Hom O O Known Uitto et al., 2001 ABCC6 c.G1553A p.(R518Q) P12, P13, P14 Het O O Known Uitto et al., 2001 ABCC6 c.G2263A p.(G755R) P11 Het O O Known Pfendner et al., 2007 ABCC6 c.G2294A p.(R765Q) P3 Het O O Known Le Saux et al., 2001 ABCC6 del2860_2865 P12, P13,14 Het O O PUR ABCC6 c.T2911C p.(W971R) P11 Het O O PUR ABCC6 Ex23_24del P2 Hom O O Known Ringpfeil et al., 2001 ABCC6 c.T3032C p.(L1011P) P9 Hom O O PUR ABCC6 c.C3190T p.(A1064T) P7 Het O O Known Miksch et al., 2005 ABCC6 c.G3413A p.(R1138Q) P11 Het O O Known Le Saux O, 2011 ABCC6 c.C3421T p.(R1141X) P4 Hom O O Known Bergen et al., 2000 ABCC6 c.C3421T p.(R1141X) P52 , P8, P162 Het O O Known Bergen et al., 2000 ABCC6 c.C3490T p.(R1164X) P6, P15 Hom O O Known Struk et al., 2000 ABCC6 c.G4198A p.(E1400K) P10 Het O O Known Chassaing et al., 2004 ABCC6 c.C4216A p.(Q1406K) P3 Het O O PUR GGCX c.C1321T p.(R441C) P7 Het O O PUR Het, heterozygous; Hom, homozygous; PUR, previously unreported; SS, Sanger sequencing; WES, whole-exome sequencing. Login to comment