ABCMdb

ABCC6 p.Arg1164*

None has been submitted yet.

Publications

PMID: 11179012 [PubMed] Ringpfeil F et al: "Compound heterozygosity for a recurrent 16.5-kb Alu-mediated deletion mutation and single-base-pair substitutions in the ABCC6 gene results in pseudoxanthoma elasticum."

No. Sentence Comment

24 OF AFFECTED FAMILY MEMBERS COMPLEMENTARY MUTATION PHENOTYPE a When Studied At Disease Onset 1 (German) 61 9 2 R1164X Skin-cobblestoning on neck, antecubital fossae, and wrists, sagging skin in axillae and bilateral groin; eyes-angioid streaks, central vision loss; CVS-claudication, ischemic attack; other-ovarian cancer 2 (British) 60 Unknown 3 R1164X Skin-moderate to severe involvement; eyes-loss of vision 3 (British) 41 Unknown 3 R1141X Skin-cobblestoning on neck, axillae, and bilateral groin; eyes-angioid streaks; CVS-coronary artery disease, GI bleeding 4 (Greek) 60 51 2 3736-1GrA Skin-cobblestoning in axillae, bilateral groin, and antecubital fossae; eyes-angioid streaks, central vision loss, macular degeneration; CVS-angina, abdominal pain, loss of peripheral pulses; other-depression, chronic fatigue syndrome a CVS p cardiovascular system; GI p gastrointestinal. Login to comment
43 Haplotype analysis with 12 microsatellite markers (left side) spanning ~9 cM of 16p13.1 allowed assignment of phase of a deletion mutation (D) and a nonsense mutation (R1164X), as indicated at the bottom of the haplotypes. Login to comment
56 Clinical Assessment of Families with PXE Members of families 1, 3, and 4 were personally examined at least by one of the authors; information on Table 2 Haplotypes of Affected Individuals in Four Unrelated Families with PXE MARKER a HAPLOTYPE FOR b del/R1164X del/R1141X; Family 3 del/3736-1GrA; Family 4Family 1 Family 2 D16S3114 4 4 10 5 9 6 9 4 D16S500 6 3 4 10 4 8 6 10 D16S2619 2 1 3 2 2 3 2 2 D16S3079 2 3 2 3 1 9 8 7 D16S3060 4 2 8 2 7 4 5 8 D16S405 8 3 4 3 4 8 3 4 D16B9622 2 2 2 2 1 2 3 1 D16S764 4 2 3 2 2 2 3 2 D16S79 8 0 3 3 3 3 3 2 D16S3103 7 1 3 1 9 3 7 4 D16S3017 3 2 4 1 5 4 2 4 D16S499 1 5 5 1 8 7 5 8 D16S3036 8 8 7 7 8 11 4 6 a The distances between the listed markers are as follows: telomere, D16S3114 (1.9 cM) D16S500 (0.5 cM) D16S2619 (0.7 cM) D16S3079 (0.5 cM) D16S3060 (22 kb) D16S405 (430 kb) D16B9622 (0.7 kb) ABCC6 (317 kb) D16S764 (8 kb) D16S79 (1.5 cM) D16S3103 (0.4 cM) D16S3017 (0.9 cM) D16S499 (1.5 cM) D16S3036, centromere. Login to comment
59 The shared haplotype in alleles containing the R1164X mutation in families 1 and 2 is in boldface italics. Login to comment
70 Comparative sequencing of the proband`s PCR product revealed an apparently homozygous single-base-pair substitution, 3490CrT, which resulted in replacement of a codon for arginine by a stop codon, a mutation designated "R1164X" (fig. 2A). Login to comment
72 CSGE and sequence analysis of other members of this family indicated that the older, clinically affected brother (II-2) of the proband similarly appeared homozygous for the mutation R1164X. Login to comment
74 The proband`s maternal aunt (I-10) and paternal uncle (I-1) showed the normal allele only, whereas the proband`s younger brother (II-7) was clearly heterozygous for the mutation R1164X. Login to comment
75 Sequence analysis of the children (generation III) of the two affected individuals revealed that five of them were heterozygous for the mutation R1164X, whereas two of them (III-2 and III-8) were apparently homozygous for the normal sequence. Login to comment
78 The inheritance of the latter allele conferred heterozygous carrier status of the mutation R1164X to individuals II-7, III-1, III-4, III-5, III-7, and III-9 (fig. 1). Login to comment
80 Collectively, these findings suggest that the proband (II-5) and her clinically affected older brother (II-2) had inherited from their father a nonsense mutation R1164X in exon 24 of the ABCC6 gene, and they had inherited from their mother a deletion mutation spanning exon 24 of the gene, thus reducing the paternal nonsense mutation to hemizygosity. Login to comment
93 Initial mutation detection by PCR amplification of ABCC6, followed by CSGE and nucleotide sequencing, demonstrated the presence of an apparently homozygous R1164X mutation in both the proband and his older brother. Login to comment
95 Restriction-enzyme digestion with AciI revealed that, of the proband`s three children, the daughter and the younger son showed evidence for the wild-type allele only, while the middle child was clearly heterozygous for the R1164X mutation. Login to comment
96 The two children of the proband`s daughter, who were examined at the ages of 12 and 10 years, respectively, were clinically normal and did not show evidence for the R1164X mutation. Login to comment
97 If the proband were truly homozygous for the R1164X mutation, his children would be expected to be heterozygous carriers of this mutation. Login to comment
146 The deletion mutation in each of these four families is associated with single-base-pair substitutions, two of them being the same one-R1164X in families 1 and 2. Login to comment
148 Thus, a founder effect for the R1164X mutation cannot be excluded with certainty, despite the apparently diverse ethnic backgrounds of these two families (table 1). Login to comment
154 In each family, the proband was initially shown to be apparently homozygous for a nucleotide substitution, resulting in either a nonsense mutation (R1164X, R1164X, and R1141X in families 1, 2, and 3, respectively) or a splice-site mutation (3736-1GrA in family 4). Login to comment
180 Exon 24 encodes a segment of MRP6 residing within TMSD3, and the mutations R1141X and R1164X are predicted to result in the synthesis of a truncated polypeptide entirely devoid of NBF2 (fig. 4A). Login to comment

PMID: 11427982 [PubMed] Uitto J et al: "Molecular genetics of pseudoxanthoma elasticum: a metabolic disorder at the environment-genome interface?"

No. Sentence Comment

75 Thisraisesthequestionoftherelationshipbetweenthe MRP6mutationsandthemanifestationsinPXE affectingtheelasticfibersinvariousorgans.Itmaywell Opinion CR1339C G1345R TRENDS in Molecular Medicine 10 kb NBF2NBF1 0.5 kb Extracellular Intracellular GS 5' 3' R1138Q R1164X R1141X R1138W 2787+1G T A455P R518Q R1114P R1314W (a) (b) (c) EcoRI SmaI SmaI SmaI SacI SacI SmaI N GS 2542delG 1944del22 4220insAGAA 3775delT 3736-1G A Fig. 3. Login to comment

PMID: 11439001 [PubMed] Meloni I et al: "Pseudoxanthoma elasticum: Point mutations in the ABCC6 gene and a large deletion including also ABCC1 and MYH11."

No. Sentence Comment

6 Mutation analysis on the other allele of the family, as well as on two additional sporadic cases, revealed nonsense (Y227X, R518X, R1164X) and frame-shift (c.960delC) mutations in ABCC6 (MRP6) further confirming the role of this multi-drug resistance gene in the etiology of pseudoxanthoma elasticum. Login to comment
57 Two of them (R518X and R1164X) are C to T transitions in a CpG dinucleotide causing a substitution of arginine (CGA) with a stop codon (TGA); they were identified in exon 12 and exon 24 in the two sporadic cases in the heterozygous state (patients 11 and 12). Login to comment
95 Mutations and variants in ABCC6 nt change Mutations 681 C ->G 960delC 1552 C ->T 3490 C ->T Non pathogenic variants 1233 T ->C 1245 G ->A 1838 T->G 1890 C->G c.3506+83 C ->A protein change Y227X frame-shift from I320 R518X R1164X N411N N415N V614A T630T _ exon 7 11 exon 8 family exon 12 11 exon 24 12 exon 10 11 exon 10 11 exon 14 11, 12 exon patient 11 11 12 exon 14 exon 24 11 11, 12 11, 12 Re-evaluation of the phenotype in the family with the large deletion did not reveal significant additional manifestations, suggesting that heterozygous ABCC1 and MYH11 deletion does not give rise to an obvious phenotype. Login to comment

PMID: 11493310 [PubMed] Ringpfeil F et al: "Molecular genetics of pseudoxanthoma elasticum."

No. Sentence Comment

74 Three recurrent mutations, R1141X, R1164X, and Del exon 23-29, are boxed (see text). Login to comment
87 Among the PTC causing mutations, two recurrent nonsense mutations, R1141X and R1164X, have been identified Figure . Login to comment

PMID: 11536079 [PubMed] Le Saux O et al: "A spectrum of ABCC6 mutations is responsible for pseudoxanthoma elasticum."

No. Sentence Comment

85 PXE Mutations The most-prevalent mutations detected in the ABCC6 gene were missense substitutions (21 [58.3%] mutations, Table 1 ABCC6 Mutations in a Cohort of Patients with PXE CHANGE IN STATUS a ORIGIN(S)b EXON(S)c REFERENCE(S)Amino Acid Nucleotide … 179-195del ht Belgium 2 Present study … 938-939insT ch, ht SA, UK 8 Present study N411K 1233TrG ht US 10 Present study A455P 1363GrC Nd Nd 11 Uitto et al. (2001) R518Q 1553GrA ch, ht Belgium 12 Present study, Uitto et al. (2001) F568S 1703TrC ch US 13 Present study … ABCC6del15 hm SA 15 Present study … 1944del22 ht Holland 16 Bergen et al. (2000) … 1995delG ht Germany 16 Present study L673P 2018TrC ch SA 16 Present study R765Q 2294GrA ht Germany 18 Present study Y768X 2304CrA ch, ht SA 18 Present study … 2322delC ht US 18 Present study … 2542delG Nd Nd 19 Uitto et al. (2001) … IVS21ϩ1GrT ch US, Germany i-21 Present study, Uitto et al. (2001) R1030X 3088CrT ht SA, UK 23 Present study R1114P 3341GrC hm UK 24 Present study S1121W 3362CrG ch Germany 24 Present study R1138W 3412CrT hm Nd 24 Ringpfeil et al. (2000) R1138P 3413GrC ch Germany 24 Present study R1138Q 3413GrA ch UK, US 24 Present study, Ringpfeil et al. (2000) R1141X 3421CrT All All 24 Present study and othersd R1164X 3490CrT ch Germany, UK 24 Ringpfeil et al. (2001) G1203D 3608GrA ch Germany 25 Present study … IVS26-1GrA ch Belgium i-26 Present study, Ringpfeil et al. (2000, 2001) Q1237X 3709CrT ch Belgium 26 Present study … 3775delT ht, hm SA, US, Holland 27 Present study, Bergen et al. (2000) V1298F 3892GrT ht US 28 Present study T1301I 3902CrT ch Belgium 28 Present study G1302R 3904GrA hm US 28 Present study A1303P 3907GrC ch Belgium 28 Present study R1314W 3940CrT hm US 28 Present study R1314Q 3941GrA ch Germany 28 Present study G1321S 3961GrA ht US 28 Present study R1339C 4015CrT All SA, US 28 Present study, Struk et al. (2000) Q1347H 4041GrC hm US 28 Present study D1361N 4081GrA ch Germany 29 Present study … 4104delC ch Belgium 29 Present study R1398X 4192CrT ch Belgium 29 Present study … ABCC6del23-29 ch US 23-29 Present study, Ringpfeil et al. (2001) … 4220insAGAA ht Holland 30 Bergen et al. (2000) I1424T 4271TrC ht US 30 Present study … ABCC6del ht Holland all Bergen et al. (2000) a Nd p not determined; hm p homozygote; ht p heterozygote; ch p compound heterozygote. Login to comment

PMID: 11776382 [PubMed] Wang J et al: "ABCC6 gene polymorphism associated with variation in plasma lipoproteins."

No. Sentence Comment

67 Primer sequences to amplify coding regions of ABCC6 Product Exon Primer sequence 5Ј to 3Ј size (bp) 1 F: GAGACTTAGCGACAGACAGAC 142 R: TCTGCAGCCAAACCAAGCCTG 2 F: CTGCCTTGTACCATCCTAAGG 225 R: CATTGCCTGGTTCCAGGCTC 3 F: GCCTACCAGTTTGCTGTGAC 259 R: TTGTTCTCCACTGTGGCAGG 4 F: TTGCCTGCCACAGTGGAGAAC 344 R: GACTGGCTTGTGTGTGTCAC 5 F: AGAACCACTAGGAAAGCCAGG 321 R: GAGACCTCAAAGTGGAACAGG 6 F: CACAGTTCGTCCTGTCTTCC 268 R: CGAAGAAGAAAGCACTGAGGC 7 F: TGACTTACCCAGGGTCACAC 268 R: TCTGAAGTAGCATCAGGTGAG 8 F: GCCTCTTAAGTGGGTACTCAG 482 R: GCACCAGATGTATAGGCAGAG 9 F: CGACTGATCCTCCACATCTG 368 R: TGAATGCGTTCTCAGCTGCTG 10 F: GAGAGGTTGGCCTAAGAGAC 417 R: CTCTTCCAGCCTCTTGAATGC 11 F: GACCTCCTATCTCATCCTGTG 401 R: GCAGCTCACAGACGACAAGA 12 F: TTGCTGAAGGGTGGCTGTCA 419 R: GAACAGGATCCAGAATGAGTG 13 F: AGGCTGCCCTATCCATGCTTGC 273 R: GGAAGCTGGAGCCAGGTGTAG 14 F: GCTGTTGCCACACATCTTGAG 317 R: ATGGCGTGATCTGCACGTGTCA 15 F: GATTTCTTCCTGCAGCCTCTG 292 R: TGGAAACCTACACCACCTCTC 16 F: CAGATGTGCACAGGATAGTTC 428 R: GTGAGAGGTGGAGAGAATGAG 17 F: CTCATTCTCTCCACCTCTCAC 413 R: TATTGAGCACCTAGCACGTGC 18 F: CATGTTGAGCTGTACCTCACC 361 R: ACTTGGGTTAGGACTGGATGC 19 F: AGTAGAGATAGGGCTTAGCCG 420 R: CACTCCATTCATGCCAGTAGG 20 F: GAAATGGATGGTCAGAGCGG 239 R: GTGGTCCCTTCAGCTACTTC 21 F: AGAGTACAGAGTGTACCCAG 331 R: GTGAGTATCACTGCCAAGTG 22 F: AAATGGTGCTCCTGGTGGGA 492 R: GACGTTTTGCACACTGTTCC 23 F: GAGCCATCATCATGCTACTG 603 R: TCCAGCTGGGTGAAACCTCA 24 F: TTCTGGAAACTACCTCTCTATGTC 341 R: ATACAATATGACCTCAGGTCTCAC 25 F: GTGTCATCTTCCTCTACTCC 370 R: CTTCAAAGGTCCCACTAGCA 26 F: TGAAGGAAGAGAGGGACCTG 443 R: GTGACTCTGACCTATAGTGG 27 F: CCATCTTGTGTGAAGTCTTAGAG 255 R: CCTTTGGCCTAAACTCCATGAA 28 F: TGGAAAGAGAGATGGAAGGTAG 521 R: AGCACACTTGTACTGCAGCTG 29 F: CTCCAGGATCAGCATCATCC 436 R: CAGAGACTGTGTCAGAGCTTG 30 F: GCAGGAACAGGCTTCCTATC 618 R: CTCCATAGAAGTCCTGCTTTCC 31 F: GAAAGCAGGACTTCTATGGAG 343 R: GAGCAAACACAGGTCTAGACTC A rare ABCC6 mutation in PXE with dyslipidemia The sequencing strategy outlined earlier resulted in the identification of homozygosity for a novel ABCC6 mutation in the PXE subject with dyslipidemia, namely, R1164X (OMIM 603234.0013). Login to comment
88 ABCC6 sequence polymorphisms Exon Nucleotide Amino acid Allele frequencies 10 1256TϾC N411 1256C 0.42 in Caucasians 1268GϾA V415 1268A 0.42 in Caucasians 14 1864TϾC VϾA614a A614 0.17 in Chinese 0.27 in Oji-Cree 0.32 in South Asians 0.41 in Africans 0.45 in Caucasians 0.56 in Inuit 15 1913GϾC T630 1913C 0.40 in Caucasians 1919CϾA HϾQ632 Q632 0.40 in Caucasians 19 2513CϾT A830 2513T 0.08 in Caucasians 24 3513CϾT R1164X X1164 Absent from 223 samples 27 3826GϾA RϾQ1268a Q1268 0.04 in Africans 0.06 in Chinese 0.14 in Oji-Cree 0.16 in South Asians 0.17 in Inuit 0.30 in Caucasians 28 4001CϾT D1326 4001T 0.03 in Caucasians a These SNPs were determined in several ethnic groups because of ease of analysis Table 3. Login to comment

PMID: 12673275 [PubMed] Hu X et al: "ABCC6/MRP6 mutations: further insight into the molecular pathology of pseudoxanthoma elasticum."

No. Sentence Comment

38 Table 2 Summary of ABCC6/MRP6 mutations associated with PXE known today: our data combined with those of the literature Mutation Protein alteration Nucleotide substitution Location Reference Nonsense Q378X 1132C > T Exon 9 19,20 R518X 1552C > T Exon 2 41 Q749X 2247C > T Exon 17 This study Y768X 2304C > A Exon 18 22 R1030X 3088C > T Exon 23 22 R1141X 3421C > T Exon 24 12,20,22,38,39, this study R1164X 3490C > T Exon 24 12,41 Q1237X 3709C > T Exon 26 22 R1398X 4192C >T Exon 29 22 T364R Missense N411K 1091C > G Exon 9 20 A455P 1233T > G Exon 10 22 R518Q 1363G > C Exon 11 38 F568S 1553G > A Exon 12 22,38 L673P 1703T > C Exon 13 22 R765Q 2018T > C Exon 16 22 R1114P 2294G > A Exon 18 22, this study R1114H 3341G > C Exon 24 22 S1121W 3341G > A Exon 24 This study T1130M 3362C > G Exon 24 22 R1138W 3390C > T Exon 24 This study R1138Q 3412C > T Exon 24 12 R1138P 3413G > A Exon 24 12,22 G1203D 3413G > C Exon 24 22 R1221C 3608G > A Exon 25 22 V1298F 3663C > T Exon 26 This study T1301I 3892G > T Exon 28 22 G1302R 3902C > T Exon 28 22 A1303P 3904G > A Exon 28 22, this study R1314W 3907G > C Exon 28 22, this study R1314Q 3940C > T Exon 28 22 G1321S 3941G > A Exon 28 22 R1339C 3961G > A Exon 28 22 Q1347H 4015C > T Exon 28 22,39 G1354R 4041G > C Exon 28 22 D1361N 4060G > C Exon 29 20,38 K1394N 4081G > A Exon 29 22 I1424T 4182G > T Exon 29 This study R1459C 4271T > C Exon 30 22 4377C > T Exon 30 This study Frameshift IVS17-12delT T Intron 17 This study IVS21+1G>T Intron 21 22,38 IVS26-1G>A Intron 26 12,21,22 179del 9 Exon 2 20 179-195del Exon 2 22 960del C Exon 8 41 1944del22 Exon 16 This study 1995delG Exon 16 22 2322delC Exon 18 22 2542delG Exon 19 41 3775delT Exon 27 This study 4104delC Exon 29 22 4182delG Exon 29 This study 938-939insT Exon 8 22 4220insAGAA Exon 30 This study Large deletion Exons 23-29 21, This study Exon 15 22 ABCC1, ABCC6 41, this study Mutation types The mutation types found in this study are summarized in Table 1. Login to comment

PMID: 12850230 [PubMed] Hu X et al: "Pseudoxanthoma elasticum: a clinical, histopathological, and molecular update."

No. Sentence Comment

193 TABLE 3 Summary of ABCC6 Mutations in PXE Patients Mutation Protein Alteration Nucleotide Substitution Location Reference Nonsense Q378X 1132C Ͼ T Exon 9 16,107 R518X 1552C Ͼ T Exon 12 88 Y768X 2304C Ͼ A Exon 18 67 R1030X 3088C Ͼ T Exon 23 67 R1141X 3421C Ͼ T Exon 24 12,45,67,107,111,112,133 R1164X 3490C Ͼ T Exon 24 88,112 Q1237X 3709C Ͼ T Exon 26 67 R1398X 4192C Ͼ T Exon 29 67 Missense T364R 1091C Ͼ G Exon 9 107 N411K 1233T Ͼ G Exon 10 67 A455P 1363G Ͼ C Exon 11 142 R518Q 1553G Ͼ A Exon 12 67,142 F568S 1703T Ͼ C Exon 13 67 L673P 2018T Ͼ C Exon 16 67 R765Q 2294G Ͼ A Exon 18 67 R1114P 3341G Ͼ C Exon 24 67 S1121W 3362C Ͼ G Exon 24 67 R1138W 3412C Ͼ T Exon 24 111 R1138Q 3413G Ͼ A Exon 24 67,111 R1138P 3413G Ͼ C Exon 24 67 G1203D 3608G Ͼ A Exon 25 67 V1298F 3892G Ͼ T Exon 28 67 T13011 3902C Ͼ T Exon 28 67 G1302R 3904G Ͼ A Exon 28 67 A1303P 3907G Ͼ C Exon 28 67 R1314W 3940C Ͼ T Exon 28 67 R1314Q 3941G Ͼ A Exon 28 67 G1321S 3961G Ͼ A Exon 28 67 R1339C 4015C Ͼ T Exon 28 67,133 Q1347H 4041G Ͼ C Exon 28 67 G1354R 4060G Ͼ C Exon 29 107,142 D1361N 4081G Ͼ A Exon 29 67 11424T 4271T Ͼ C Exon 30 67 Frameshift Splicing IVS21 ϩ 1G ϾT Intron 21 67,142 IVS26-1G ϾA Intron 26 67,111,112 Deletion 179del9 Exon 2 107 179-195del Exon 2 67 960delC Exon 8 88 1944del22 Exon 16 12 1995delG Exon 16 67 2322delC Exon 18 67 2542delG Exon 19 67 3775delT Exon 27 12,67 4101delC Exon 29 67 Insertion 938-939insT Exon 8 67 4220insAGAA Exon 30 12 Intragenic deletion Exon 23-29 67,112 Exon 15 67 Intergenic deletion ABCC6 12,88 LOCAL RETINAL TRANSPORT FUNCTION OF ABCC6 ABCC6 Expression in the Retina Bergen et al detected ABCC6 expression in various tissues in man.12 Low expression levels of ABCC6 were observed in the retina as well as other tissues usually affected by PXE, including skin and vessel wall. Login to comment

PMID: 15086542 [PubMed] Chassaing N et al: "Novel ABCC6 mutations in pseudoxanthoma elasticum."

No. Sentence Comment

33 1552C4T 12 1 0 0 18 France F 31 R1141X 3421C4T 24 1 0 0 W1223X 3668G4A 26 19-1 France M 18 R1164X/? Login to comment
34 3490C4T 24 1 0 0 19-2 M 15 R1164X/? Login to comment

PMID: 15894595 [PubMed] Chassaing N et al: "Pseudoxanthoma elasticum: a clinical, pathophysiological and genetic update including 11 novel ABCC6 mutations."

No. Sentence Comment

378 Interestingly, among the 49 different missense mutations in ABCC6 (42 previously published and seven new ones in the present study), the majority (43) replace critical amino acids in intracellular domains (seven and 19 mutations are located in I1424T R1459C 4220insAGAA 4318delA G1354R D1361N K1394N E1400K R1298X 410delC 418delG 3775delT R1275X R1221C D1238H W1223X Q1237X IVS26-1G→A R1114C R1114H R1114P S1121W M1127T T1130M R1138P R1138Q R1138W R1141X R1164X R765Q A766D Y768X A781V 2322delC IVS19-2delAG T364R R391G Q378X Q363_R373del 938_939insT 960delC IVS8+2delTG G199X Y227X 179_195del 179_187del G226R V74del Q749X IVS17-12delTT IVS14-5T→G IVS13-29T→A R600G V1298F G1299S T1301I G1302R A1303P S1307P R1314Q R1314W G1321S L1335P R1339C P1346S Q1347H R1030X F1048del R807Q V810M A820P 254delG L673P 1944_1966del 1995delG R518Q R518X K502M A455P G992R IVS21+1G→T G1203DF568SN411K C440G IVS25-3C→A 3544dupC Ex23_29del 30 Ex15del ABCC6del 252015105 Figure 10 Position of the mutations in the ABCC6 gene. Login to comment
379 Table 2 ABCC6 mutations Nucleotide variation Protein alteration Location (gene ) Location (protein) Reference Missense 676 GRA G226R Exon 7 CL 3 This study 1091 CRG T364R Exon 9 TS 7 63, 78 1171 ARG R391G Exon 9 CL 4 88 1233 TRG N411K Exon 10 CL 4 63, 90 1318 TRG C440G Exon 10 TS 8 63 1363 GRC A455P Exon 11 TS 9 86 1505 ART K502M Exon 12 CL 5 This study 1553 GRA R518Q Exon 12 CL 5 63, 86, 88, 90 1703 TRC F568S Exon 13 ECL 5 90 1798 CRT R600G Exon 14 CL 6 63 2018 TRC L673P Exon 16 NBF 1 90 2294 GRA R765Q Exon 18 NBF 1 87, 90 2297 CRA A766D Exon 18 NBF 1 88 2342 CRT A781V Exon 18 NBF 1 This study 2420 GRA R807Q Exon 19 NBF 1 This study 2428 GRA V810M Exon 19 NBF1 63 2458 GRC A820P Exon 19 NBF1 63 2965 GRC G992R Exon 22 ECL 6 This study 3340 CRT R1114C Exon 24 CL 8 63 3341 GRA R1114H Exon 24 CL 8 87 3341 GRC R1114P Exon 24 CL 8 90 3362 CRG S1121W Exon 24 CL 8 90 3380 CRT M1127T Exon 24 CL 8 63 3389 CRT T1130M Exon 24 CL 8 63, 87, 88 3412 CRT R1138W Exon 24 CL 8 17 3413 GRC R1138P Exon 24 CL 8 90 3413 GRA R1138Q Exon 24 CL 8 17, 63, 88, 90 3608 GRA G1203D Exon 25 TS17 90 3663 CRT R1221C Exon 26 COOH 87 3712 GRC D1238H Exon 26 COOH 88 3892 GRT V1298F Exon 28 NBF 2 90 3895 GRA G1299S Exon 28 NBF 2 This study 3902 CRT T1301I Exon 28 NBF 2 90 3904 GRA G1302R Exon 28 NBF 2 87, 90 3907 GRC A1303P Exon 28 NBF 2 87, 90 3919 TRC S1307P Exon 28 NBF 2 This study 3940 CRT R1314W Exon 28 NBF 2 90 3941 GRA R1314Q Exon 28 NBF 2 90 3961 GRA G1321S Exon 28 NBF 2 90 4004 TRC L1335P Exon 28 NBF 2 88 4015 CRT R1339C Exon 28 NBF 2 18, 63, 90 4036 CRT P1346S Exon 28 NBF 2 63 4041 GRC Q1347H Exon 28 NBF 2 90 4060 GRC G1354R Exon 29 NBF 2 78, 86 4081 GRA D1361N Exon 29 NBF 2 90 4182 GRT K1394N Exon 29 NBF 2 87 4198 GRA E1400K Exon 29 NBF 2 63, 88 4271 TRC I1424T Exon 30 NBF 2 90 4377 CRT R1459C Exon 30 NBF 2 87 Nonsense 595 CRT G199X Exon 5 89 681 CRG Y227X Exon 7 84 1132 CRT Q378X Exon 9 63, 78, 83 1552 CRT R518X Exon 12 63, 84, 88 2245 CRT Q749X Exon 17 87 2304 CRA Y768X Exon 18 90 3088 CRT R1030X Exon 23 63, 90 3421 CRT R1141X Exon 24 15, 17, 18, 63, 78, 85, 87, 88, 90 3490 CRT R1164X Exon 24 84, 85, 88 3668 GRA W1223X Exon 26 88 3709 CRT Q1237X Exon 26 90 3823 CRT R1275X Exon 27 63 4192 CRT R1398X Exon 29 90 Splicing alteration IVS8+2delTG Intron 8 This study IVS13-29 TRA Intron 13 This study IVS14-5 TRG Intron 14 This study IVS17-12delTT Intron 17 87 IVS18-2delAG Intron 17 63 IVS21+1 GRT Intron 21 86, 90 IVS25-3 CRA Intron 25 88 IVS26-1 GRA Intron 26 17, 63, 90 Insertion 938_939insT Frameshift Exon 8 90 3544dupC Frameshift Exon 25 63 4220insAGAA Frameshift Exon 30 15, 87 Small deletion 179_187del Frameshift Exon 2 78 179_195del Frameshift Exon 2 90 Pseudoxanthoma elasticum www.jmedgenet.com NBF1 and NBF2, respectively), four are located in transmembrane domains, and only two mutations have been identified in extracellular domains. Login to comment

PMID: 16086317 [PubMed] Miksch S et al: "Molecular genetics of pseudoxanthoma elasticum: type and frequency of mutations in ABCC6."

No. Sentence Comment

147 The c.3490C4T (p.R1164X) mutation identified in our initial mutation screen [Struk et al., 2000] cosegregated with the (323- 165-null-137) haplotype. Login to comment
148 In our current study we identified the p.R1164X mutation in nine PXE chromosomes, segregating with five distinct and unrelated haplotypes, which suggests that this location is more likely a mutational hotspot in ABCC6. Login to comment
246 PXE Mutations While most mutations are unique variants that represent the typical allelic heterogeneity of a recessive disease, we observed five mutations (p.R1141X [26%], p.I1000_S1403delW1404fsX1463 [11%], p.R1164X [5.3%], p.Q378X [3.5%], and c.278711G4T [3%]) at higher frequencies that accounted for almost 50% (exactly 48.8%) of the PXE mutations. Login to comment
263 The p.R1164X mutation occurs at a nonconserved arginyl residue, and the nine chromosomes carrying this mutation represent five haplotype groups. Login to comment
266 Similarly to p.R1164X, the six chromosomes that carry the p.Q378X mutation represent four independent haplotypes. Login to comment

PMID: 17617515 [PubMed] Pfendner EG et al: "Mutation detection in the ABCC6 gene and genotype-phenotype analysis in a large international case series affected by pseudoxanthoma elasticum."

No. Sentence Comment

248 Of these, R1339C, R1164X and 2787+1gRc represented 5.0%, 4.7% and 2.8%, respectively, of the 316 alleles identified. Login to comment
250 The high incidence of R1339C in the South African population is probably due to a founder effect.26 Conversely, R1164X (0/40 alleles) and 2787+1gRc (0 of 40 alleles) were absent in the South African case series but were prevalent in the European and American patient populations. Login to comment
254 Collectively, the mutations in exons 24 and 28, including the common mutations R1141X and del 23-29, accounted for 71.5% of all the 316 mutations identified in this study (table 2), and the 11 most prevalent mutations (R1141X, del23-29, R1339C, R1164X, 2787+1GRT, G1302R, R1138Q, R1138W, Q378X, R1314W, R518Q) accounted for 70% (223 of 316) of the mutant alleles identified (table 2). Login to comment
262 Genotype-phenotype correlations The comparison of subjects whose mutations would probably have resulted in no functional protein with those whose mutations would probably have resulted in some functional Table 2 Distinct mutations identified in the international case series of 271 patients with PXE Nucleotide change*À Predicted consequenceÀ Frequency (alleles) Exon-intron location Domain affected` Mutant alleles (%) References1 c.105delA p.S37fsX80 2 2 0.6 28 c.177-185del9 p.R60_Y62del 1 2 0.3 9, 28 c.179del12ins3 p. R60_W64del L60_R61ins 1 2 0.3 c.220-1gRc SJ 1 IVS 2 0.3 c.724gRt p.E242X 1 7 0.3 c.938insT FS 1 8 0.3 25 c.998+2delT SJ 1 IVS 8 0.3 2, 21 c.998+2del2 SJ 1 IVS 8 0.3 18 c.951cRg p.S317R 2 9 TM6 0.6 28 c.1087cRt p.Q363X 1 9 0.3 c.1091gRa p.T364R 1 9 TM7 0.3 9, 19, 21, 28 c.1132cRt p.Q378X 4 9 1.2 9, 17-19, 28, 37 c.1144cRt p.R382W 2 9 IC4 0.6 c.1171aRg p.R391G 3 9 IC4 0.9 9, 18, 28, 37 c.1176gRc p.K392N 1 9 IC4 0.3 c.1388tRa p.L463H 1 11 TM9 0.3 c.1484tRa p.L495H 1 12 IC5 0.3 28 c.1552cRt p.R518X 2 12 0.6 18, 19, 27, 28, 37 c.1553gRa p.R518Q 4 12 IC5 1.2 18, 19, 24, 28, 31 c.1603tRc p.S535P 1 12 TM10 0.3 c.1703tRc p.F568S 1 13 TM11 0.3 24 c.1798cRt p.R600C 1 14 TM11 0.3 c.1857insC FS 1 14 0.3 c.1987gRt p.G663C 1 16 NBF1 0.3 c.1999delG FS 1 16 0.3 c.2070+5GRA SJ 2 IVS 16 0.6 c.2093aRc p.Q698P 2 17 NBF1 0.6 c.2097gRt p.E699D 1 17 NBF1 0.3 c.2177tRc p.L726P 1 17 NBF1 0.3 c.2237ins10 FS 2 17 0.6 c.2252tRa p.M751K 1 18 NBF1 0.3 20, 37 c.2263gRa p.G755R 2 18 NBF1 0.6 c.2278cRt p.R760W 3 18 NBF1 0.9 20, 28, 32, 37 c.2294gRa p.R765Q 2 18 NBF1 0.6 20-22, 25, 28, 32, 37 c.2329gRa p.D777N 1 18 NBF1 0.3 c.2359gRt p.V787I 1 18 NBF1 0.3 c.2432cRt p.T811M 1 19 IC6 0.3 6 c.2643gRt p.R881S 1 20 IC6 0.3 c.2787+1GRT SJ 9 IVS 21 2.8 17, 20, 24, 28, 31, 37 c.2814cRg p.Y938X 1 22 0.3 c.2820insC FS 1 22 0.3 c.2831cRt p.T944I 1 22 TM12 0.3 c.2848gRa p.A950T 1 22 TM12 0.3 c.2974gRc p.G992R 1 22 TM13 0.3 2, 42 c.3340cRt p.R1114C 2 24 IC8 0.6 19, 28, 32, 37, 41 c.3389cRt p.T1130M 3 24 IC8 0.9 18, 19, 21, 22, 28, 30, 32, 37, 41 c.3398gRc p.G1133A 1 24 IC8 0.3 c.3412gRa p.R1138W 7 24 IC8 2.2 28, 30, 37 c.3413cRt p.R1138Q 7 24 IC8 2.2 18, 19, 24, 25, 28, 30, 32, 37, 41 c.3415gRa p.A1139T 2 24 IC8 0.6 c.3415gRa & c.2070+5GRA* p.A1139T & SJ 1 24, IVS 16 IC8 0.3 c.3415gRa & c.4335delG* p.A1139T & FS 1 24, 30 IC8 0.3 c.3421cRt p.R1141X 92 24 29.3 5, 9, 15,18, 19, 21, 22, 24, 28, 30-32, 33, 37, 41 c.3427cRt p.Q1143X 1 24 0.3 c.3490cRt p.R1164X 15 24 4.7 18, 27, 28, 31, 33 c.3491gRa p.R1164Q 1 24 IC8 0.3 28 c.3661cRt p.R1221C 1 26 IC9 0.3 21, 22, 28, 29 c.3662gRa p.R1221H 2 26 IC9 0.6 40 c.3676cRa p.L1226I 1 26 IC9 0.3 c.3722gRa p.W1241X 2 26 0.6 c.3774insC FS 2 27 0.6 c.3775delT p.G1259fsX1272 3 27 0.9 15, 25, 28, 41 c.3880-3882del p.K1294del 1 27 0.3 c.3883-5GRA SJ 1 IVS 27 0.3 c.3892gRt p.V1298F 1 28 NBF2 0.3 25 c.3904gRa p.G1302R 7 28 NBF2 2.2 21, 22, 25, 28 c.3907gRc p.A1303P 1 28 NBF2 0.3 21, 22, 25, 28 c.3912delG FS 1 28 0.3 28 c.3940cRt p.R1314W 4 28 NBF2 1.2 24, 25, 32, 36 c.3941gRa p.R1314Q 1 28 NBF2 0.3 25, 28, 32, 36, 41 c.4004tRa p.L1335Q 1 28 NBF2 0.3 c.4015cRt p.R1339C 16 28 NBF2 5.0 19, 25, 28, 33 c.4016gRa p.R1339H 2 28 NBF2 0.6 c.4025tRc p.I1342T 1 28 NBF2 0.3 protein did not yield significant differences. Login to comment

PMID: 21167005 [PubMed] Larusso J et al: "Pseudoxanthoma elasticum: a streamlined, ethnicity-based mutation detection strategy."

No. Sentence Comment

52 Exon 24 also harbored other mutations (p.R1138Q, p.R1164X, and p.R1164Q) that did not appear to have a predilection for specific ethnicities. Login to comment

PMID: 16763870 [PubMed] Ladewig MS et al: "[Pseudoxanthoma elasticum]."

No. Sentence Comment

272 Internetadressen PXE-Selbsthilfegruppe Deutschland : http://www.pxe-groenblad.de PXE International: http://www.pxe.org Tabelle 5 PXE verursachende Mutationen imabcc6-Gen Klassifikation Lokalisation Gen Protein Missense Exon 9 Exon 9 Exon 10 Exon 10 Exon 11 Exon 12 Exon 13 Exon 14 Exon 16 Exon 18 Exon 18 Exon 18 Exon 18 Exon 19 Exon 19 Exon 19 Exon 22 Exon 24 Exon 24 Exon 24 Exon 24 Exon 24 Exon 24 Exon 24 Exon 24 Exon 24 Exon 25 Exon 26 Exon 26 Exon 26 Exon 28 Exon 28 Exon 28 Exon 28 Exon 28 Exon 28 Exon 28 Exon 28 Exon 28 Exon 28 Exon 28 Exon 28 Exon 28 Exon 29 Exon 29 Exon 29 Exon 29 Exon 29 Exon 30 Exon 30 Exon 30 c.1091CaG c.1171AaG c.1233TaG c.1318TaG c.1363GaC c.1553GaA c.1703TaC c.1798CaT c.2018TaC c.2252TaA c.2278CaT c.2294GaA c.2297CaA c.2428GaA c.2458GaC c.2552TaC c.2855TaG c.3340CaT c.3341GaA c.3341GaC c.3362CaG c.3380CaT c.3389CaT c.3412CaT c.3413GaA c.3413GaC c.3608GaA c.3661CaT c.3712GaC c.3715TaC c.3892GaT c.3902CaT c.3904GaA c.3907GaC c.3932GaA c.3940CaT c.3941GaA c.3961GaA c.3976GaA c.4004TaC c.4015CaT c.4036CaT c.4041GaC c.4060GaC c.4069CaT c.4081GaA c.4182GaT c.4198GaA c.4209CaA c.4271TaC c.4377CaT p.T364R p.R391G p.N411K p.C440G p.A455P p.R518Q p.F568S p.R600G p.L673P p.M751K p.R760W p.R765Q p.A766D p.V810M p.A820P p.L851P p.F952C p.R1114C p.R1114H p.R1114P p.S1121W p.M1127T p.T1130M p.R1138W p.R1138Q p.R1138P p.G1203D p.R1221C p.D1238H p.Y1239H p.V1298F p.T1301I p.G1302R p.A1303P p.G1311E p.R1314W p.R1314Q p.G1321S p.D1326N p.L1335P p.R1339C p.P1346S p.Q1347H p.G1354R p.R1357W p.D1361N p.K1394N p.E1400K p.S1403R p.I1424T p.R1459C Klassifikation Lokalisation Gen Protein Nonsense Exon 9 Exon 12 Exon 17 Exon 18 Exon 23 Exon 24 Exon 24 Exon 26 Exon 26 Exon 27 Exon 29 c.1132CaT c.1552CaT c.2247CaT c.2304CaA c.3088CaT c.3421CaT c.3490CaT c.3668GaA c.3709CaT c.3823CaT c.4192CaT p.Q378X p.R518X p.Q749X p.Y768X p.R1030X p.R1141X p.R1164X p.W1223X p.Q1237X p.R1275X p.R1398X Spleißstellen Intron 21 Intron 25 Intron 26 c.2787+1GaT c.3634-3CaA c.3736-1GaA Insertion Exon 8 Exon 25 Exon 30 c.938-939insT c.3544dupC c.4220insAGAA Deletion Exon 2 Exon 2 Exon 3 Exon 8 Exon 9 Exon 16 Exon 16 Exon 18 Exon 19 Exon 22 Exon 27 Exon 29 Exon 29 Exon 30 Exon 31 c.179del9 c.179-195del c.220-222del c.960delC c.1088-1120del c.1944del22 c.1995delG c.2322delC c.2542delG c.2835-2850del16 c.3775delT c.4101delC c.4182delG c.4318delA c.4434delA Intragenische Deletion Exon 15 Exon 18 Exon 23-29 delEx15 delEx18 delEx23-29 Intergenische Deletion ABCC6 delABCC6 Fazit für die Praxis Eine spezifische Behandlung der Grunderkrankung ist nicht bekannt. Login to comment

PMID: 17251343 [PubMed] Shi Y et al: "Development of a rapid, reliable genetic test for pseudoxanthoma elasticum."

No. Sentence Comment

82 Nuclease Digestion Fragment Sizes of Common Mutations in PXE Exon 24 and 28 Amino acid change Base change Fragment lengths (bp) p.T1130M c.3389CϾT 251,257/508 p.R1138W c.3412CϾT 274,234/508 p.R1138Q c.3413GϾA 275,233/508 p.R1141X c.3421CϾT 281,227/508 p.R1164X c.3490CϾT 352,156/508 p.G1302R c.3904GϾA 116,289/405 p.R1314Q c.3941GϾA 153,252/405 p.R1339C c.4015CϾT 227,178/405 The total lengths of the amplicons are listed after the slash. Login to comment
107 The two most prevalent mutations were the nonsense mutations c.3421CϾT (p.R1141X) and c.3490CϾT (p.R1164X) in exon 24. c.3421CϾT is the most common mutation found in PXE patients of European origin.14,19,20,23,29 c.3490CϾT is a common mutation in individuals of British descent.16,21 Two DNA samples carried the c.3490CϾT (p.R1339C) missense mutation in one exon 28 allele, and in both cases, IVS28 ϩ 49CϾT was also present. Login to comment

PMID: 19054062 [PubMed] Li Q et al: "Pseudoxanthoma elasticum: clinical phenotypes, molecular genetics and putative pathomechanisms."

No. Sentence Comment

68 Identification of additional recurrent nonsense mutations (p.Q378X in exon 9, p.R518X in exon 12 and p.R1164X in exon 24) as well as clustering of the missense mutations to exons 24 and 28 corresponding to the NBFs that are critical for the ATP binding and hydrolysis have allowed the development of streamlined mutation detection strategies to facilitate identification of mutations in the ABCC6 gene with the overall detection rate of up to 99% (for review see reference 26). Login to comment

PMID: 23702584 [PubMed] Zhou Y et al: "Premature termination codon read-through in the ABCC6 gene: potential treatment for pseudoxanthoma elasticum."

No. Sentence Comment

34 Testing of two mutant constructs, p.R1164X and p.R1275X, in the presence of varying concentrations of PTC124 indicated that the highest level of expression was noted with 5 mg ml 1 , as quantified by In-Cell ELISA (Figure 2). Login to comment
38 Different pseudoxanthoma elasticum (PXE)- associated nonsense mutations tested for PTC124 read-through Mutation Nucleotide sequence1 Location (exon) Mutation frequency (%)2 p.R1141X TGA-A 24 54 p.R1164X TGA-C 24 10 p.R518X TGA-G 12 1.2 p.R1398X TGA-G 29 1.2 p.Q378X TAG-A 9 o1 p.Q1143X TAG-G 24 o1 p.R1275X TGA-C 27 o1 1 The sequence depicts the stop codon (bold) followed by the nucleotide shown. Login to comment
53 In this system, injection of 1to 4-cell-stage zebrafish embryos with a morpholino corresponding to the exon 7/intron 7 border of the 12 R1275X R1164X 10 8 6 4 2 0 0 1.2 2.5 5 10 PTC124 (&#b5;g ml-1) 20 40 Normalized OD at 460 nm Figure 2. Login to comment
54 Read-through efficiency of stop codon mutations p.R1275X and p.R1164X by PTC124 in different concentrations. Login to comment

PMID: 25264593 [PubMed] Hosen MJ et al: "Efficiency of exome sequencing for the molecular diagnosis of pseudoxanthoma elasticum."

No. Sentence Comment

89 List of mutations found by WES and SS Gene Nucleotide change Protein change Patient ID Hom/Het WES SS Known/PUR Reference ABCC6 c.C118T p.(P40S) P10 Het O O PUR ABCC6 c.998 &#fe; 2 998 &#fe; 3del TG P8 Het O O PUR ABCC6 c.T1484A p.(L495H) P7 Het O O Known Miksch et al., 2005 ABCC6 c.G1553A p.(R518Q) P11 Hom O O Known Uitto et al., 2001 ABCC6 c.G1553A p.(R518Q) P12, P13, P14 Het O O Known Uitto et al., 2001 ABCC6 c.G2263A p.(G755R) P11 Het O O Known Pfendner et al., 2007 ABCC6 c.G2294A p.(R765Q) P3 Het O O Known Le Saux et al., 2001 ABCC6 del2860_2865 P12, P13,14 Het O O PUR ABCC6 c.T2911C p.(W971R) P11 Het O O PUR ABCC6 Ex23_24del P2 Hom O O Known Ringpfeil et al., 2001 ABCC6 c.T3032C p.(L1011P) P9 Hom O O PUR ABCC6 c.C3190T p.(A1064T) P7 Het O O Known Miksch et al., 2005 ABCC6 c.G3413A p.(R1138Q) P11 Het O O Known Le Saux O, 2011 ABCC6 c.C3421T p.(R1141X) P4 Hom O O Known Bergen et al., 2000 ABCC6 c.C3421T p.(R1141X) P52 , P8, P162 Het O O Known Bergen et al., 2000 ABCC6 c.C3490T p.(R1164X) P6, P15 Hom O O Known Struk et al., 2000 ABCC6 c.G4198A p.(E1400K) P10 Het O O Known Chassaing et al., 2004 ABCC6 c.C4216A p.(Q1406K) P3 Het O O PUR GGCX c.C1321T p.(R441C) P7 Het O O PUR Het, heterozygous; Hom, homozygous; PUR, previously unreported; SS, Sanger sequencing; WES, whole-exome sequencing. Login to comment