ABCMdb

ABCC7 p.Glu115Lys

None has been submitted yet.

Publications

PMID: 9417117 [PubMed] Lu Y et al: "Co- and posttranslational translocation mechanisms direct cystic fibrosis transmembrane conductance regulator N terminus transmembrane assembly."

No. Sentence Comment

47 CFTR mutations ⌬E115, E116K, E115K/E116K, and G126D were engineered by PCR overlap extension (35) using sense primers: 1) CCGGATAA- CAAGGAACGCTCTATC, 2) GATAACAAGGAGAAACGCTCTATCGCG, 3) AACAAGAAAAAACGGTCCATCGCGATTTATCTAGGC, 4) GATTTATC- TAGGCATAGACTTATGCCTTCTC, respectively, and complimentary antisense primers (not shown) to generate overlapping 5Ј and 3Ј PCR fragments. Login to comment
49 PCR fragments from this "fusion" reaction were digested with AvaI/XbaI and ligated into AvaI/XbaI-digested pSPCFTR vector. Plasmids TM1-2.P encoding ⌬E115, E116K, E115K/E116K, and G126D mutations were generated by PCR amplification of respective mutant pSPCFTR plasmids using sense primer (SP6 promoter) and antisense primer 5) AAATTTGGTCAC- CTTGTTGGAAAGGAGACT. Login to comment
52 Plasmids TM1-2.P encoding mutations E116K/G126D and E115K/E116K/G126D were constructed by PCR overlap extension using primers 2 and 3 and pSPCFTR(G126D) template. Login to comment
53 Similarly, plasmids TM1-2.P containing E92A/K95A mutations together with (a) E115K/E116K, (b) E116K/G126D, or (c) E115K/E116K/G126D were generated by PCR overlap extension using the following strategies: (a) primer 3 (pSPCFTR(E92A/ K95A) template); (b) primer 2 and (5Ј template pSPCFTR(E92A/K95A) and 3Ј template pSPCFTR(G126D); (c) primer 3 (5Ј template pSPCFTR(E92A/ K95A) 3Ј template pSPCFTR(G126D)). Login to comment
55 Plasmids encoding G85E together with E115K/E116K, E116K/G126D or E115K/E116K/G126D mutations were made in the identical manner except that pSPCFTR(G85E) was used as the template for the initial 5Ј PCR reactions. Login to comment
123 However, the double mutations E115K/E116K, E116K/G126D and the triple mutation E115K/E116K/G126D all reduced N-linked glycosylation to approximately 20% of chains, a 65-70% reduction from WT levels (Fig. 3A, lanes 7-15). Login to comment
126 PK digestion of mutant ggTM2.P chains (⌬E115, E116K, and E115K/E116K) indicated that the introduction of basic residues flanking the N terminus of TM2, altered TM2 translocation specificity and enabled TM2 to translocate C terminus flanking sequences in a subset of chains. Login to comment
127 This was particularly evident for the E115K/E116K mutant (Fig. 3B, lanes 1-9, upward ar- FIG. 2. Login to comment
139 For the remaining two mutants, E116K/G126D and E115K/E116K/G126D, little or no translocation of the P reporter was observed (lanes 10-15). Login to comment
143 CFTR cDNA encoding mutations, ⌬E115, E116K, E115K/E116K, E116K/G126D or E115K/E116K/G126D was therefore truncated at codon Asn186 , and the topology of chains was determined in RRL (Fig. 4). Login to comment
154 However, TM2 mutations E116K/G126D and E115K/E116K/G126D had a relatively minor but reproducible effect on CFTR N terminus topology, 82 and 79% of WT translocation activity, respectively (Fig. 4B, lanes 16-24 and Fig. 5, A and B). Login to comment
155 When the TM1 mutation G85E was introduced into chains containing E116K/G126D or E115K/E116K/G126D mutations, translocation efficiency was further reduced to 45% and 48% of WT levels, respectively (Fig. 5, A and B). Login to comment
159 Thus an efficient signal sequence in either the TM1 or the TM2 position was sufficient to ensure proper CFTR N terminus topology. We also observed that the E115K/E116K mutation, which partially reversed TM2 translocation specificity, was more disruptive than other TM2 mutations. Login to comment
160 Only 55% of truncated E115K/E116K chains achieved correct topology (Fig. 5C), and the G85E mutation had little effect on these chains. Login to comment
50 Plasmids TM1-2.P encoding DE115, E116K, E115K/E116K, and G126D mutations were generated by PCR amplification of respective mutant pSPCFTR plasmids using sense primer (SP6 promoter) and antisense primer 5) AAATTTGGTCAC- CTTGTTGGAAAGGAGACT. Login to comment
54 Similarly, plasmids TM12.P containing E92A/K95A mutations together with (a) E115K/E116K, (b) E116K/G126D, or (c) E115K/E116K/G126D were generated by PCR overlap extension using the following strategies: (a) primer 3 (pSPCFTR(E92A/ K95A) template); (b) primer 2 and (59 template pSPCFTR(E92A/K95A) and 39 template pSPCFTR(G126D); (c) primer 3 (59 template pSPCFTR(E92A/ K95A) 39 template pSPCFTR(G126D)). Login to comment
56 Plasmids encoding G85E together with E115K/E116K, E116K/G126D or E115K/E116K/G126D mutations were made in the identical manner except that pSPCFTR(G85E) was used as the template for the initial 59 PCR reactions. Login to comment
124 However, the double mutations E115K/E116K, E116K/G126D and the triple mutation E115K/E116K/G126D all reduced N-linked glycosylation to approximately 20% of chains, a 65-70% reduction from WT levels (Fig. 3A, lanes 7-15). Login to comment
128 This was particularly evident for the E115K/E116K mutant (Fig. 3B, lanes 1-9, upward ar- FIG. 2. Login to comment
140 For the remaining two mutants, E116K/G126D and E115K/E116K/G126D, little or no translocation of the P reporter was observed (lanes 10-15). Login to comment