ABCD3 p.Glu277Asp
[switch to full view]Comments [show]
None has been submitted yet.
PMID: 10207018
[PubMed]
Imanaka T et al: "Characterization of the 70-kDa peroxisomal membrane protein, an ATP binding cassette transporter."
No.
Sentence
Comment
51
Construction of Mutant cDNAs-A mutant version of PMP70 containing mutations in EAA-like motif, designated as PMP70 (E277D/ E278D), was constructed by asymmetric PCR using pME18S/PMP70 as a template. Two oligonucleotides (the site of substitution is underlined), with 5Ј-660 AAGCCATTTTTAGACATAGTTTTGTA685 -3Ј and 5Ј-875 GG- CAATTTCTTCACTATTAGTAGTAAGCCG846 -3Ј were used in the first step, and a 220-bp fragment was generated by PCR.
X
ABCD3 p.Glu277Asp 10207018:51:116
status: NEW53 The fragment containing the mutations of E277D and E278D was ligated into the HpaI-KpnI sites of pME18S/PMP70.
X
ABCD3 p.Glu277Asp 10207018:53:41
status: NEW164 We chose to mutate the two glutamic acids (Glu277 and Glu278 ) in the EAA-like motif of PMP70 to aspartic acids (E277D/E278D), because aspartic acid resulting from a change of the corresponding glutamic acids (Glu291 ) in ALDP is known to be the site of mutation causing FIG. 5.
X
ABCD3 p.Glu277Asp 10207018:164:113
status: NEW173 In the cells overexpressing PMP70 (E277D/E278D and K479A), the amount of PMP70 increased about 2-3-fold compared with that in Neo cells (Fig. 8, A and B).
X
ABCD3 p.Glu277Asp 10207018:173:35
status: NEW165 We chose to mutate the two glutamic acids (Glu277 and Glu278 ) in the EAA-like motif of PMP70 to aspartic acids (E277D/E278D), because aspartic acid resulting from a change of the corresponding glutamic acids (Glu291 ) in ALDP is known to be the site of mutation causing FIG. 5.
X
ABCD3 p.Glu277Asp 10207018:165:113
status: NEW174 In the cells overexpressing PMP70 (E277D/E278D and K479A), the amount of PMP70 increased about 2-3-fold compared with that in Neo cells (Fig. 8, A and B).
X
ABCD3 p.Glu277Asp 10207018:174:35
status: NEW