ABCMdb

ABCC2 p.Thr1477Met

None has been submitted yet.

Publications

PMID: 21691255 [PubMed] Megaraj V et al: "Functional analysis of nonsynonymous single nucleotide polymorphisms of multidrug resistance-associated protein 2 (ABCC2)."

No. Sentence Comment

2 Objectives To characterize the transport function of human wild-type (WT) MRP2 and four SNP variants, S789F, A1450T, V417I, and T1477M. Login to comment
7 V417I showed decreased apparent affinity for LTC4, E23G, and E217G, whereas transport was similar between wild-type (WT) and T1477M, except for a modest increase in TUDC transport. Login to comment
10 V417I in membrane spanning domain 1 selectively decreased the apparent affinity for the glutathione and glucuronide conjugated substrates, whereas the T1477M SNP in the carboxyl terminus altered only TUDC transport. Login to comment
48 Construction of recombinant baculovirus containing multidrug resistance protein 2 The plasmid (pEF6/V5-His-TOPO; Invitrogen) containing the WT MRP2 (NM_000392) or its SNP variants S789F, A1450T, V417I, and T1477M, was used to create the MRP2 baculovirus expression vector. Login to comment
49 The pENTR 4 vector (Invitrogen) was mutated to generate a Hind III site using Quik Change II site-directed mutagenesis Kit (Stratagene; La Jolla, California, USA) using primers Hind IIIF and Hind IIIR (Hind IIIF: AGGCTCCAC- CATGGGAAGCTTCAGTCGACTGGATC; Hind IIIR: Table 1 Nucleotide sequence of variants in MRP2 leading to amino acid changes in multidrug resistance-associated protein 2 and their allelic frequencya SNP position Amino acid change Exon Location Allelic frequency Functional consequencesb C2366T S789F 18 NBD1 (D loop) 0.01 (Japanese) 52 G4348A A1450T 31 NBD2 (immediately after the ABC signature motif) 0.01 (Japanese) 52 G1249A V417I 10 MSD1 (between transmembrane helices 7 and 8) 0.125/0.312/0.184 (Japanese/Iranian/Moroccan) 27,46,47,52,58,59 C4430T T1477M 31 Carboxy terminal 0.006 (Japanese) MSD, membrane-spanning domain; NBD, nucleotide-binding domain; SNP, single nucleotide polymorphism. Login to comment
56 The pENTR4M containing the WT, S789F, A1450T, V417I, and T1477M SNPs were sequenced (MWG Biotech, Inc., Huntsville, Alabama, USA). Login to comment
96 There are no reports on the effects of SNP T1477M in the carboxy terminal on MRP2 function or expression; despite its low allelic frequency, the location of this SNP was of interest because the function of this portion of MRP2 is rarely studied [29]. Login to comment
97 Protein expression of wild-type multidrug resistance-associated protein 2 and single nucleotide polymorphism variants in Sf9 cells WT MRP2 and the SNP variants S789F, A1450T, V417I, and T1477M were expressed in Sf9 cells using recombinant baculovirus. Login to comment
101 Statistical analysis of triplicate experiments showed that MRP2 expression was significantly reduced approximately 40% for S789F and T1477M variants, located in NBD1 and carboxy terminal region, respectively. Login to comment
108 LTC4 and E23G were transported with classic Michaelis-Menten kinetics by WT MRP2; however, E217G and TUDC demonstrated positive Fig. 1 8000 6000 4000 Density(%)INT/mm2 2000 0 T1477M * V417IA1450TS789F * WTEV 185 KD EV WT S789F A1450T V417I T1477M (a) (b) Expression of WT multidrug resistance-associated protein 2 (MRP2) and its variants in Sf9 plasma membranes. Login to comment
125 The T1477M SNP located in the carboxyl terminal region induced modest but significant changes, and showed both increased Km (50%) and Vmax (13%) for TUDC, but a decrease in the Vmax for E23G (20%), whereas it did not influence the transport of other substrates (Fig. 2a-d; Table 2). Login to comment
136 Four SNPs were selected for characterization, one in each of the two NBDs (S789F in NBD1 and A1450T in NBD2), one in MSD1 (V417I), and one in the carboxy terminal (T1477M), to probe how changes in these portions of MRP2 protein might impact its transport properties. Login to comment
150 These data imply that valine 417 plays a critical and selective role in binding of glutathione Table 2 Kinetic parameters for transport of substrates by wild-type multidrug resistance-associated protein 2 and four single nucleotide polymorphism variants Substrates Kinetic parameters WT S789F A1450T V417I T1477M LTC4 Km 4 (1.8-6.5) 3 (1.8-4.4) 3 (2-3.6) 9 (7.8-12.7)* 6 (3.5-9) Vmax 1464 (1314-1713) 732 (648-816)* 658 (618-699)* 1366 (1200-1531) 1659 (1373-1945) E23G Km 103 (73-133) 235 (173-296)* 106 (64-148) 212 (95-330) 172 (88-230) Vmax 1458 (1339-1578) 615 (558-671)* 855 (746-964)* 1794 (1454-2134) 1157 (975-1338)* E217bG Km 84 (64-104) 72 (67-76) 88 (75-100) 263 (241-285)* 94 (89-100) Vmax 3154 (2691-3617) 1799 (1732-1866)* 2665 (2422-2907) 2647 (2520-2773) 2646 (2555-2737) HC 2.2 (1.4-3) 2.4 (2.1-2.6) 2 (1.6-2.4) 1.1 (1.1-1.2)* 1.8 (1.7-1.9) TUDC Km 71 (65-78) 64 (71-96) 71 (57-86) 74 (70-79) 109 (103-116)* Vmax 595 (563-627) 359 (343-376)* 424 (376-472)* 577 (553-600) 671 (645-699)* HC 2 (1.7-2.3) 2.3 (1.9-2.6) 1.8 (1.3-2.3) 2.6 (2.3-2.8) 2.2 (2-2.4) The kinetic parameters [Km (mmol/l); Vmax (pmol/mg/min); HC] of ATP-dependent transport of LTC4, E23G, E217G, and TUDC were determined in Sf9 plasma membrane vesicles. Login to comment
166 Interestingly, the T1477M SNP located in the carboxy terminal region caused a selective decrease in the apparent affinity for TUDC but had no effect on the transport properties of other substrates. Login to comment
168 Quantitative immunoblot analysis demonstrated a decreased expression of approximately 40% for two of the SNPs, S789Fand T1477M, relative to WT MRP2. Login to comment
185 Similarly, expression of T1477M, in which the SNP is located 68 amino acid residues from the C-terminal of MRP2, was decreased to 62% of WT MRP2. Login to comment
188 Although the amino acid change in T1477M could contribute to the localization signal, it is located in a good distance from the C-terminal, suggesting an alternative mechanism for its decreased expression. Login to comment
189 From our studies, the data suggest that individuals with S789F and T1477M polymorphisms may have a lower expression level of MRP2 protein in the apical membrane of cells, and consequently, a reduced ability to export substrates. Login to comment
199 V417I selectively inhibited the transport of glutathione and glucuronide-conjugated substrates, whereas T1477M only altered the transport of TUDC, a hydrophilic bile acid. Login to comment

PMID: 16847695 [PubMed] Nies AT et al: "The apical conjugate efflux pump ABCC2 (MRP2)."

No. Sentence Comment

151 These Abcc2-deficient mice are apparently healthy and fertile, as are Table 3 (continued) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references damaging transport function [47] Exon 30 c.4175_4180del6 p.R1392_M1393del2 DJS No ABCC2 protein in liver [170] Impaired sorting and trafficking [79] [79, 170] Exon 31 c.4348 G>A p.A1450T Possibly damaging Reduced protein levels [50] T: 0.010 [62] [62] Exon 31 c.4430 C>T p.T1477M Benign T: 0.006 [51] Exon 32 c.4544 G>A p.C1515Y Benign A: 0.047 rs8187710 A: 0.116 rs17222568 NCBI National Center for Biotechnology Information, SNP single nucleotide polymorphism, DJS Dubin-Johnson syndrome a As recommended by the Human Genome Variation Society (http://www.hgvs.org/mutnomen) and by ref [26], nucleotide position +1 is the A of the ATG of the translation initiation codon in the ABCC2 cDNA sequence, "c." Login to comment
152 These Abcc2-deficient mice are apparently healthy and fertile, as are Table 3 (continued) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references damaging transport function [47] Exon 30 c.4175_4180del6 p.R1392_M1393del2 DJS No ABCC2 protein in liver [170] Impaired sorting and trafficking [79] [79, 170] Exon 31 c.4348 G>A p.A1450T Possibly damaging Reduced protein levels [50] T: 0.010 [62] [62] Exon 31 c.4430 C>T p.T1477M Benign T: 0.006 [51] Exon 32 c.4544 G>A p.C1515Y Benign A: 0.047 rs8187710 A: 0.116 rs17222568 NCBI National Center for Biotechnology Information, SNP single nucleotide polymorphism, DJS Dubin-Johnson syndrome a As recommended by the Human Genome Variation Society (http://www.hgvs.org/mutnomen) and by ref [26], nucleotide position +1 is the A of the ATG of the translation initiation codon in the ABCC2 cDNA sequence, "c." Login to comment