ABCA4 p.Ser1317Ala
[switch to full view]Comments [show]
None has been submitted yet.
PMID: 21721517
[PubMed]
Tsybovsky Y et al: "Posttranslational modifications of the photoreceptor-specific ABC transporter ABCA4."
No.
Sentence
Comment
79
T901A, S1185A, T1313A, and S1317A mutations were introduced by overlap extension polymerase chain reaction using Pfu DNA polymerase and the following mutagenic primers (with introduced mutations shown in bold): T901Af, gagcccctagccgaggaaacg; T901Ar, cgtttcctcggctaggggctc; S1185Af, ctaagggtttcgccac- cacgtgt; S1185Ar, acacgtggtggcgaaacccttag; T1313Af, gctgga- caggccccccaggac; T1313Ar, gtcctggggggcctgtccagc; S1317Af, gacaccccaggacgccaatgtctgc; S1317Ar, gcagacattggcgtcctgggg- tgtc.
X
ABCA4 p.Ser1317Ala 21721517:79:27
status: NEW81 S1185A, T1313A, and S1317A were constructed with ABCA4 FseI-Fwd (agatttttgagccctgtggc) and ABCA4-Sbf I-rev (ccctggtgctgcacctgc) primers and subcloned into the FseI and SbfI sites.
X
ABCA4 p.Ser1317Ala 21721517:81:20
status: NEW187 To reveal possible biological roles of ABCA4 phosphorylation, we created ABCA4 constructs with alanine mutations in the most conserved phosphorylation sites, namely, T901A, S1185A, T1313A, and S1317A.
X
ABCA4 p.Ser1317Ala 21721517:187:193
status: NEW189 The S1185A, T1313A, and, to a lesser extent, S1317A mutants localized to intracellular vesicles like wild-type ABCA445 and demonstrated comparable expression levels (Figure 5A,B).
X
ABCA4 p.Ser1317Ala 21721517:189:45
status: NEW227 These results agree well with the reduced levels of basal or all-trans-retinal-stimulated activity shown for S1317A or S1185A and T1313A mutants, respectively, of ABCA4 expressed in mammalian cells (Table 1).
X
ABCA4 p.Ser1317Ala 21721517:227:109
status: NEW253 The T901A mutant is poorly expressed, and the level of expression of the S1317A mutant is reduced compared to those of wild-type ABCA4 and the other ABCA4 mutants.
X
ABCA4 p.Ser1317Ala 21721517:253:73
status: NEW255 WT and mutants S1185A, T1313A, and, to a lesser extent, S1317A localize to intracellular vesicles.
X
ABCA4 p.Ser1317Ala 21721517:255:56
status: NEW259 Basal and All-trans-Retinal-Stimulated Activity of Human ABCA4 Variants with Mutated Phosphorylation Sites sample basal activity (nmol mg-1 min-1 ) retinal-stimulated activity (nmol mg-1 min-1 ) wild-type 37.5 ± 1.1 91.7 ± 1.5 S1185A 39.0 ± 1.4 61.6 ± 2.2 T1313A 37.5 ± 1.6 74.5 ± 2.4 S1317A 8.5 ± 0.9 13.5 ± 1.1 Figure 6.
X
ABCA4 p.Ser1317Ala 21721517:259:315
status: NEW298 The S1185A, T1313A, and S1317A mutants localized to intracellular vesicles (Figure 5B), suggestive of nativelike folding, although the lower expression level of T1317A could indicate possible destabilization.
X
ABCA4 p.Ser1317Ala 21721517:298:24
status: NEW