ABCMdb

ABCA4 p.Lys969Met

None has been submitted yet.

Publications

PMID: 22735453 [PubMed] Quazi F et al: "ABCA4 is an N-retinylidene-phosphatidylethanolamine and phosphatidylethanolamine importer."

No. Sentence Comment

66 This was examined using donor proteoliposomes reconstituted with wild-type (WT) ABCA4 or the ATPase deficient K969M/K1978M double mutant (ABCA4-MM) (Fig. 2d). Login to comment
93 (d) Effect of ATP, ADP and AMP-PNP on [3H] ATR transfer from donor proteoliposomes reconstituted with WT ABCA4 or the ATPase-impaired K969M/K1978M double mutant (ABCA4-MM) purified from transfected HEK293 cells. Login to comment
145 To gain further insight into the molecular mechanisms underlying ABCA4-mediated transport activity and Stargardt disease, we examined the functional properties of ABCA4-containing G863A and N965S mutations associated with Stargardt disease and Walker A mutations, K969M in NBD1, K1978M in NBD2 and the double mutant K969M/1978M. Login to comment
146 The K1978M mutant expressed at the same level as WT ABCA4, whereas the G863A, N965S, K969M and K969M/ K1978M mutants expressed within 50% that of WT ABCA4. Login to comment
172 Addition of ATP resulted in release of the substrate from the G863A, N965S and K1978M mutants, but impaired release from the K969M mutant and no significant release from the K969M/K1978M double mutant. Login to comment
189 However, retinal readily reacts with PE, I a E ABCA4 W i l d - t y p e G 8 6 3 A N 9 6 5 S K 9 6 9 M K 9 6 9 M / K 1 9 7 8 M K 1 9 7 8 M ABCA4 kDa 250 250 I E I E I E I E I E 150 100 75 50 37 25 e % N-retinylidene PE binding 120 - ATP + ATP 100 80 60 40 20 0 G 8 6 3 A M M N 9 6 5 S K 9 6 9 M K 1 9 7 8 M W T b G 8 6 3 A M M N 9 6 5 S K 9 6 9 M K 1 9 7 8 M 120 % Retinal transfer * * 100 80 60 40 20 0 W T c G863A N965S Retinal (µM) 250 % Basal ATPase activity 200 150 100 WT 50 0 0 10 20 30 40 50 60 d MM Retinal (µM) K969M K1978M % Basal ATPase activity 250 WT 200 150 100 50 0 0 10 20 30 40 50 60 f % NBD-PE flippase activity * * 120 100 80 60 40 20 0 G 8 6 3 A M M N 9 6 5 S K 9 6 9 M K 1 9 7 8 M W T Figure 6 | Effect of Walker A and Stargardt mutations on ATR transfer activity. Login to comment

PMID: 20633576 [PubMed] Molday RS et al: "Defective lipid transport and biosynthesis in recessive and dominant Stargardt macular degeneration."

No. Sentence Comment

2042 Heterologous expression of ABCA4 has been used to study the effect of mutations in the Walker A motifs (K969M in NBD1 and K1978M in NBD2) on the basal and retinal activated activities of purified and reconstituted ABCA4 [114]. Login to comment
2044 However, the K969M/K1978M double mutant and the K969M single mutant showed little or no basal or retinal-stimulated ATPase activity. Login to comment

PMID: 19230850 [PubMed] Molday RS et al: "The role of the photoreceptor ABC transporter ABCA4 in lipid transport and Stargardt macular degeneration."

No. Sentence Comment

142 The basal and retinal activated activities of both NBDs were also investigated by expressing and analyzing ABCA4 containing Walker A mutations (K969M for NBD1) and K1978M for NBD2) known to inhibit ATP hydrolysis [35,37]. Login to comment
145 The double K969M/ K1978M double mutant and the K969M single mutant showed no basal or retinal stimulated ATPase activity, whereas the K1978M mutant in NBD2 exhibited basal ATPase activity but not retinal stimulated activity. Login to comment

PMID: 12888572 [PubMed] Ahn J et al: "Functional interaction between the two halves of the photoreceptor-specific ATP binding cassette protein ABCR (ABCA4). Evidence for a non-exchangeable ADP in the first nucleotide binding domain."

No. Sentence Comment

54 K969M and K1978M mutations were inserted by QuikChange site-directed mutagenesis (Stratagene) using PfuTurbo DNA polymerase and the following mutagenic primers (introduced mutations in bold): K969M, CCACAATGGAGCTGGGATGACCACCACCTTGTCC and GGACAAG- GTGGTGGTCATCCCAGCTCCATTGTGG; K1978M, GAATGGTGCC- GGCATGACAACCACATTCAAGATGC and GCATCTTGAATGTGGT- TGTCATGCCGGCACCATTC. Login to comment
55 The AflII-ClaI (1.9 kb) and the Eco72I (0.26 kb) fragments of the resulting PCR products containing the K969M and K1978M mutations, respectively, were cloned into the original pcABCR. Login to comment
56 For the K969M/K1978M double mutant, the AflII-FseI restriction fragment of pcABCR[K1978M] was replaced with that of pcABCR[K969M]. Login to comment
158 With ABCR, the lysine to methionine substitution in the NBD1 (K969M) and NBD2 (K1978M) or in both (K969M/ K1978M) significantly reduced the basal ATPase activity of ABCR and abolished retinal activation (Fig. 4A). Login to comment
179 The photoaffinity labeling intensities of the single mutants (K969M and K1978M) were similar to wild-type ABCR relative to the amount of purified ABCR stained with Coomassie Blue (Fig. 4B). Login to comment
180 A small reduction in labeling, however, was observed for the K969M/K1978M double mutant. Login to comment
210 WT, wild-type; K969M, in NBD1; K1978M, in NBD2; MM, K969M/K1978M double mutant; NCM, N-half co-expressed with C-half containing a K1978M mutation. Login to comment
211 B, ATP photoaffinity labeling was carried out by irradiating membranes from COS-1 cells expressing wild-type (WT), K969M, K1978M, or K969M/K1978M double mutant (MM) with 3 ␮M 8-azido-[␣-32 P]ATP. Login to comment
209 WT, wild-type; K969M, in NBD1; K1978M, in NBD2; MM, K969M/K1978M double mutant; NCM, N-half co-expressed with C-half containing a K1978M mutation. Login to comment

PMID: 11804194 [PubMed] Sun H et al: "Mechanistic studies of ABCR, the ABC transporter in photoreceptor outer segments responsible for autosomal recessive Stargardt disease."

No. Sentence Comment

107 (D) Synthetic substitutions of a conserved lysine in the Walker A motif of NBD-1 (K969M), NBD-2 (K1978M), or both (K969M/K1978M). Login to comment
114 When purified, reconstituted, and tested for ATPase activity, the synthetic mutations show (1) that mutations in NBD-1 (G966D or K969M), either alone or in combination with mutations in NBD-2 (G966D/G1975D or K969M/K1978M), abolish both basal and retinal-stimulated ATP hydrolysis and (2) that mutations in NBD-2 (G1975D or K1978M) do not alter the basal ATPase activity but lead to inhibition rather than stimulation of ATP hydrolysis by retinal (Fig. 4(C) and (D)), a pattern noted above for the naturally occurring NBD-2 mutations G1961E, G1977S, and E2096K. Login to comment

PMID: 24097981 [PubMed] Quazi F et al: "Differential phospholipid substrates and directional transport by ATP-binding cassette proteins ABCA1, ABCA7, and ABCA4 and disease-causing mutants."

No. Sentence Comment

66 Corresponding ABCA4 mutations determined by amino acid alignment with ABCA1 included S100P, W605S, F608L, T959I, N965S, C1502R, T1537M, R2107P, and P2180L. Login to comment
67 ABCA1-MM was constructed to harbor the Walker A-motif lysine-to-methionine mutations K939M/K1952M by the nested PCR method; ABCA4-MM had the corresponding K969M/ K1969M Walker A mutations (37), and ABCA7-MM had the Lipid Transport Activity of ABCA Transporters NOVEMBER 29, 2013ߦVOLUME 288ߦNUMBER 48 JOURNAL OF BIOLOGICAL CHEMISTRY 34415 at SEMMELWEIS UNIV OF MEDICINE on December 3, K847M/K1833M Walker A mutations. Login to comment
69 ABCA1-MM was constructed to harbor the Walker A-motif lysine-to-methionine mutations K939M/K1952M by the nested PCR method; ABCA4-MM had the corresponding K969M/ K1969M Walker A mutations (37), and ABCA7-MM had the Lipid Transport Activity of ABCA Transporters NOVEMBER 29, 2013ߦVOLUME 288ߦNUMBER 48 JOURNAL OF BIOLOGICAL CHEMISTRY 34415 at SEMMELWEIS UNIV OF MEDICINE on December 3, K847M/K1833M Walker A mutations. Login to comment