ABCC4 p.Met744Val

[switch to full view]
Comments [show]
Publications
PMID: 18464048 [PubMed] Gradhand U et al: "Pharmacogenomics of MRP transporters (ABCC1-5) and BCRP (ABCG2)."
No. Sentence Comment
191 MRP4 protein has been detected in human kidney (van Aubel et al., 2002), lung (Torky et al., 2005), liver (Rius et al., 2003), prostate (Lee et al., 2000), brain (Nies et al., 2004), pancreas (König et al., 2005), lymphocytes (Schuetz et al., 1999), and platelets Figure 4 Predicted membrance topology of MRP4 (ABCC4) based on hydrophobicity analysis. Locations of the non-synonymous polymorphisms are indicated with arrows. See Table 4 for allele frequencies and description of funtional consequences. NH2 COOH NBD NBD Val854Phe Ile18Leu Ile866Val Arg531Gln Tyr556Cys Thr1142Met Glu757Lys Val776Ile Gly187Trp Lys304Asn in out Membrane Cys171Gly Pro403Leu Lys498Glu Met744Val Met1272Val MRP4 (ABCC4) COOH NBD NBD Val854Phe Ile866Val Arg531Gln Tyr556Cys Thr1142Met Glu757Lys Val776Ile Gly187Trp Lys304AsnCys171Gly Pro403Leu Lys498Glu Met744Val Met1272Val COOH NBD NBD Val854Phe Ile866Val Arg531Gln Tyr556Cys Thr1142Met Glu757Lys Val776Ile Gly187Trp Lys304AsnCys171Gly Pro403Leu Lys498Glu Met744Val Met1272Val (Jedlitschky et al., 2004).
X
ABCC4 p.Met744Val 18464048:191:671
status: NEW
X
ABCC4 p.Met744Val 18464048:191:838
status: NEW
X
ABCC4 p.Met744Val 18464048:191:992
status: NEW
Login to comment

236 Following the discovery and Table 4 MRP4 (ABCC4) Single nucleotide polymorphisms. Location, allele frequency and functional effects. Position in coding sequence Amino acid exchange Location Allele frequency Effect NCBI ID ReferenceAf Ca Jp others 52A>C Ile18Leu Exon 1 - 1.1 [1] 0 [2] - No influence on expression and localization in liver [1] rs11568681 511T>G Cys171Gly Exon 4 - 0 [1] [2] - - rs4148460 559G>T Gly187Trp Exon 5 - 2.2 [1] 0 [2] - No influence on expression and localization in liver [1] rs11568658 912G>T Lys304Asn Exon 8 - 9.9 [1] [2] - No influence on expression and localization in liver [1] rs2274407 1208T>C Pro403Leu Exon 9 - - - - - rs11568705 1492A>G Lys498Glu Exon 11 - - - - - rs11568669 1592G>A Arg531Gln Exon 12 - 0.6 [1] 0 [2] - No influence on expression and localization in liver [1] 1667A>G Tyr556Cys Exon 13 - 0.6 [1] 0 [2] - No influence on expression and localization in liver [1] 2230A>G Met744Val Exon 18 - - - - - rs9282570 2269G>A Glu757Lys Exon 18 - 0.6 [1] [2] - No influence on expression and localization in liver [1] rs3765534 2326G>A Val776Ile Exon 19 - 0.6 [1] 0 [2] - No influence on expression and localization in liver [1] 2560G>T Val854Phe Exon 21 - 1.7 [1] 0 [2] - No influence on expression and localization in liver [1] rs11568694 2596A>G Ile866Val Exon 21 - 2.8 [1] 0 [2] - No influence on expression and localization in liver [1] 3425C>T Thr1142Met Exon 27 - 1.6 [1] 0 [2] - No influence on expression and localization in liver [1] rs11568644 3814A>G Met1272Val Exon 30 - - - - - rs1134217 Reference without frequency means that SNP was detected but no frequency determined.
X
ABCC4 p.Met744Val 18464048:236:925
status: NEW
Login to comment

PMID: 21619426 [PubMed] Stieger B et al: "Pharmacogenetics of drug transporters in the enterohepatic circulation."
No. Sentence Comment
117 Gene name Transporter SNP Protein Population size (n) In vitro function Ref. Liver efflux transporters (cont.) SLC47A1 (cont.) MATE1 (cont.) c.1490G>C c.149G>T p.C497S p.C497F N/A Reduced, unchanged or increased transport activities (substrate dependent) [170,229] c.1557G>C p.Q519H N/A Unchanged [170] ABCC4 MRP4 c.232C>G p.P78A N/A Increased intracellular drug accumulation (substrate dependent), lower transport protein expression [161] c.559C>T p.G187W N/A Increased intracellular drug accumulation, reduced transport protein expression Slightly reduced function [161] [162] c.877A>G p.K293E N/A Unchanged [161] c.912G>T p.K304N N/A Unchanged Unchanged [161] [162] c.1208C>T p.P403L N/A Increased intracellular drug accumulation [161] c.1460G>A p.G487E N/A Increased intracellular drug accumulation Reduced transport activity (substrate dependent) [161] [162] c.1492A>G p.K498E N/A Unaltered [161] c.1667A>G p.Y556C N/A Increased transport activity [162] c.2269G>A p.E575K N/A Increased transport activity [162] c.2230A>G p.M744V N/A Unchanged [161] c.2326G>A p.V776I N/A Reduced transport activity [162] c.2459G>T p.R820I N/A Reduced transport activity [162] c.2560G>T p.V854F N/A Unchanged [162] c.2596A>G p.I866V N/A Unchanged [162] c.2867G>C p.C956S N/A Reduced intracellular drug accumulation [161] c.3211G>A p.V1071I N/A Unchanged [161] c.3425C>T p.T1142M N/A Increased transport activity [162] For more information on members of the SLC superfamily of transporters please consult [301] and for more information of ABC transporters please consult [302].
X
ABCC4 p.Met744Val 21619426:117:1028
status: NEW
Login to comment

PMID: 20103563 [PubMed] Klaassen CD et al: "Xenobiotic, bile acid, and cholesterol transporters: function and regulation."
No. Sentence Comment
7118 Nucleotide Change Amino Acid Change In Vitro Function Protein Expression/Localization ABCC1 MRP1 G128C C43S 1↔ Intracellular C218T T73I 1↔ Normal C257T S92F 2↔ Normal C350T T117M 2↔ Normal G689A R230Q ↔ Normal G1057A V353M N.D. N.D. G1299T R433S 2↔ Normal G1898A R633Q 2↔ Normal G2012T G671V ↔ Normal G2168A R723Q 2 Normal G2965A A989T 2↔ Normal G3140C C1047S 1↔ Normal G3173A R1058Q ↔ Normal C4535T S1512L ↔ Normal ABCC2 MRP2 C-24T N.D. N.D. G1058A R353H N.D. N.D. G1249A V417I ↔ Normal C2366T S789F 12 Intracellular T2780G L927R N.D. N.D. C3298T R1100C N.D. N.D. G3299A R1100H N.D. N.D. T3563A V1188E N.D. N.D. G4348A A1450T ↔ Normal/Intracellular G4544A C1515Y N.D. N.D. ABCC3 MRP3 G32A G11D ↔ Normal C202T H68Y N.D. N.D. G296A R99Q N.D. Normal C1037T S346F 2 Normal C1537A Q513K N.D. N.D. T1643A L548Q N.D. N.D. G1820A S607N 2 Normal C2221T Gln741STOP N.D. N.D. G2293C V765L ↔ Normal G2395A V799M N.D. N.D. C2758T P920S 1 Normal G2768A R923Q 1 Normal C3657A S1219R N.D. N.D. C3856G R1286G ↔ Normal G3890A R1297H N.D. N.D. C4042T R1348C 1 Normal A4094G Q1365R ↔ Normal C4141A R1381S ↔ Intracellular C4217T T1406M N.D. N.D. G4267A G1423R N.D. N.D. ABCC4 MRP4 C52A L18I N.D. N.D. C232G P78A 2↔ Normal T551C M184T N.D. N.D. G559T G187W 2 Reduced A877G K293E ↔ Normal G912T K304N ↔ Normal C1067T T356M N.D. N.D. C1208T P403L 2↔ Normal G1460A G487E 2 Normal A1492G K498E ↔ Normal A1875G I625M N.D. N.D. C2000T P667L N.D. N.D. A2230G M744V ↔ Normal G2269A E757K N.D. Intracellular G2459T R820I N.D. N.D. G2560T V854F N.D. N.D. G2698T V900L N.D. N.D. G2867C C956S 1↔ Normal G3211A V1071I ↔ Normal C3425T T1142M N.D. N.D. G3659A R1220Q N.D. N.D. A3941G Q1314R N.D. N.D. 2, reduced function; 1, increased function; ↔, no change in function; N.D. not determined.
X
ABCC4 p.Met744Val 20103563:7118:1599
status: NEW
Login to comment

7115 Nucleotide Change Amino Acid Change In Vitro Function Protein Expression/Localization ABCC1 MRP1 G128C C43S 1࢒ Intracellular C218T T73I 1࢒ Normal C257T S92F 2࢒ Normal C350T T117M 2࢒ Normal G689A R230Q ࢒ Normal G1057A V353M N.D. N.D. G1299T R433S 2࢒ Normal G1898A R633Q 2࢒ Normal G2012T G671V ࢒ Normal G2168A R723Q 2 Normal G2965A A989T 2࢒ Normal G3140C C1047S 1࢒ Normal G3173A R1058Q ࢒ Normal C4535T S1512L ࢒ Normal ABCC2 MRP2 C-24T N.D. N.D. G1058A R353H N.D. N.D. G1249A V417I ࢒ Normal C2366T S789F 12 Intracellular T2780G L927R N.D. N.D. C3298T R1100C N.D. N.D. G3299A R1100H N.D. N.D. T3563A V1188E N.D. N.D. G4348A A1450T ࢒ Normal/Intracellular G4544A C1515Y N.D. N.D. ABCC3 MRP3 G32A G11D ࢒ Normal C202T H68Y N.D. N.D. G296A R99Q N.D. Normal C1037T S346F 2 Normal C1537A Q513K N.D. N.D. T1643A L548Q N.D. N.D. G1820A S607N 2 Normal C2221T Gln741STOP N.D. N.D. G2293C V765L ࢒ Normal G2395A V799M N.D. N.D. C2758T P920S 1 Normal G2768A R923Q 1 Normal C3657A S1219R N.D. N.D. C3856G R1286G ࢒ Normal G3890A R1297H N.D. N.D. C4042T R1348C 1 Normal A4094G Q1365R ࢒ Normal C4141A R1381S ࢒ Intracellular C4217T T1406M N.D. N.D. G4267A G1423R N.D. N.D. ABCC4 MRP4 C52A L18I N.D. N.D. C232G P78A 2࢒ Normal T551C M184T N.D. N.D. G559T G187W 2 Reduced A877G K293E ࢒ Normal G912T K304N ࢒ Normal C1067T T356M N.D. N.D. C1208T P403L 2࢒ Normal G1460A G487E 2 Normal A1492G K498E ࢒ Normal A1875G I625M N.D. N.D. C2000T P667L N.D. N.D. A2230G M744V ࢒ Normal G2269A E757K N.D. Intracellular G2459T R820I N.D. N.D. G2560T V854F N.D. N.D. G2698T V900L N.D. N.D. G2867C C956S 1࢒ Normal G3211A V1071I ࢒ Normal C3425T T1142M N.D. N.D. G3659A R1220Q N.D. N.D. A3941G Q1314R N.D. N.D. 2, reduced function; 1, increased function; ࢒, no change in function; N.D. not determined.
X
ABCC4 p.Met744Val 20103563:7115:1575
status: NEW
Login to comment

PMID: 18364470 [PubMed] Abla N et al: "The human multidrug resistance protein 4 (MRP4, ABCC4): functional analysis of a highly polymorphic gene."
No. Sentence Comment
100 Only three nonsynonymous variants (G187W, K304N, and M744V) have frequencies higher than 5% in a given ethnic group.
X
ABCC4 p.Met744Val 18364470:100:53
status: NEW
Login to comment

110 Initially, ABCC4 haplotypes were inferred from all variable sites with a frequency higher than TABLE 1 Primers used for constructing the variants and the nonfunctional mutant by site-directed mutagenesis Variant Sequencea (5Ј-3Ј) P78A F: GAATGACGCACAGAAGGCTTCTTTAACAAGAGC R: GCTCTTGTTAAAGAAGCCTTCTGTGCGTCATTC G187W F: GTAACATGGCCATGTGGAAGACAACCACAG R: CTGTGGTTGTCTTCCACATGGCCATGTTAC K293E F: GTACGCCTGGGAAGAGTCATTTTCAAATC R: GATTTGAAAATGACTCTTCCCAGGCGTAC K304N F: CCAATTTGAGAAATAAGGAGATTTCCAAG R: CTTGGAAATCTCCTTATTTCTCAAATTGG P403L F: GCGCAACCGTCAGCTGCTGTCAGATGGTAAAAAG R: CTTTTTACCATCTGACAGCAGCTGACGGTTGCGC G487E F: CCCTGGGTGTTCTCGGAAACTCTGAGGAG R: CTCCTCAGAGTTTCCGAGAACACCCAGGG K498E F: GTAATATTTTATTTGGGAAGGAATACGAAAAGG R: CCTTTTCGTATTCCTTCCCAAATAAAATATTAC M744V F: GGGCAAACAAACAAAGTGTGCTAAATGTCACTG R: CAGTGACATTTAGCACACTTTGTTTGTTTGCCC C956S F: CGTCTGGATGCCATCTCTGCCATGTTTGTCATC R: GATGACAAACATGGCAGAGATGGCATCCAGACG V1071I F: CACAAGAAAAGATTGGCATTGTGGGAAG R: CTTCCCACAATGCCAATCTTTTCTTGTG G538D F: GGAACCACGCTGAGTGGAGACCAGAAAGCACGGGTAAACC R: GGTTTACCCGTGCTTTCTGGTCTCCACTCAGCGTGGTTCC F, forward; R, reverse.
X
ABCC4 p.Met744Val 18364470:110:773
status: NEW
Login to comment

126 Ten nonsynonymous variants were chosen for this study based on a frequency of Ն5% in the populations studied (G187W, K304N, and M744V), high evolutionary conservation (all variants with the exception of M744V), or a high Grantham value (G187W Ͼ C956S Ͼ P403L ϭ G487E Ͼ K304N).
X
ABCC4 p.Met744Val 18364470:126:134
status: NEW
X
ABCC4 p.Met744Val 18364470:126:209
status: NEW
Login to comment

145 The P78A and P403L TABLE 2 Selected genetic variants in ABCC4a Exon Nucleotide Position Golden Path Positionb Variant Flagb Nucleotide Change Amino Acid or Intronic Position Amino Acid Change Grantham Score Allele Frequencyc AA (n ϭ 160) CA (n ϭ 160) AS (n ϭ 120) ME (n ϭ 100) 1 -49 chr13:94751618 rs3751333 C Ͼ T 5Ј-UTR - - 0.013 0.019 0.102 0.03 1 52 chr13:94751518 rs11568681 C Ͼ A 18 Leu to Ile 5 0.006 0.044 0.034 0.01 1 IVS1ϩ10 chr13:94751486 rs11568682 C Ͼ T Intronic - - 0.006 0.019 0 0 2 IVS2ϩ7 chr13:94697891 rs11568700 C Ͼ T Intronic - - 0.031 0 0 0 3 IVS3-5 chr13:94697355 rs4148437 T Ͼ C Intronic - - 0.087 0.331 0.183 0.25 3d 232 chr13:94697304 rs11568689 C Ͼ G 78 Pro to Ala 27 0 0 0.008 0 4 IVS4-10 chr13:94685099 rs11568638 C Ͼ T Intronic - - 0.025 0 0 0 4 IVS4ϩ10 chr13:94684855 rs11568637 A Ͼ G Intronic - - 0.031 0 0.117 0 5 551 chr13:94661017 rs11568657 T Ͼ C 184 Met to Thr 81 0.013 0 0 0 5 559 chr13:94661009 rs11568658 G Ͼ T 187 Gly to Trp 184 0 0.025 0.108 0.130 6 669 chr13:94659805 rs899494 C Ͼ T 223 Syn 0.219 0.200 0.125 0.090 6 717 chr13:94659757 rs11568674 T Ͼ C 239 Syn 0 0 0.008 0 7 877 chr13:94658089 rs11568684 A Ͼ G 293 Lys to Glu 56 0.006 0 0 0 8 912 chr13:94657036 rs2274407 G Ͼ T 304 Lys to Asn 94 0.181 0.087 0.225 0.160 8 951 chr13:94656997 rs2274406 G Ͼ A 317 Syn 0.619 0.406 0.458 0.390 8 969 chr13:94656979 rs2274405 G Ͼ A 323 Syn 0.312 0.406 0.458 0.320 8 1035 chr13:94656913 rs11568703 G Ͼ A 345 Syn 0 0.013 0 0 8 1067 chr13:94656881 rs11568701 C Ͼ T 356 Thr to Met 81 0 0 0 0.010 8 IVS8ϩ8 chr13:94656779 rs11568702 T Ͼ A Intronic - 0 0.013 0 0 9 1208 chr13:94645146 rs11568705 C Ͼ T 403 Pro to Leu 98 0.006 0 0 0 11 1458 chr13:94637043 rs11568670 G Ͼ A 486 Syn 0 0.006 0 0 11 1460 chr13:94637041 rs11568668 G Ͼ A 487 Gly to Glu 98 0 0 0.008 0 11 1492 chr13:94637009 rs11568669 A Ͼ G 498 Lys to Glu 56 0.025 0 0 0 11 1497 chr13:94637004 rs1557070 C Ͼ T 499 Syn 0.238 0 0 0 14 1737 chr13:94620874 rs11568664 T Ͼ C 579 Syn 0.006 0 0 0 15 IVS15-7 chr13:94616629 rs11568696 A Ͼ G Intronic - 0.031 0 0 0 15 1875 chr13:94616572 rs11568699 A Ͼ G 625 Ile to Met 10 0.006 0 0 0 15 2000 chr13:94616447 rs11568697 C Ͼ T 667 Pro to Leu 98 0 0.006 0 0 15 2001 chr13:94616446 rs11568698 C Ͼ T 667 Syn 0.013 0 0 0 16 2100 chr13:94614708 rs11568666 C Ͼ T 700 Syn 0 0.013 0 0 18 2230 chr13:94613455 rs9282570 A Ͼ G 744 Met to Val 21 0.050 0 0 0 18 2269 chr13:94613416 rs3765534 G Ͼ A 757 Glu to Lys 56 0.025 0.013 0.033 0.030 19 2364 chr13:94611535 rs11568709 C Ͼ T 788 Syn 0.006 0 0 0 20 2459 chr13:94566253 rs11568659 G Ͼ T 820 Arg to Ile 97 0.006 0 0 0 21 2560 chr13:94533521 rs11568694 G Ͼ T 854 Val to Phe 50 0.006 0 0 0 21 2577 chr13:94533504 rs11568691 C Ͼ T 859 Syn 0 0.006 0 0 22 2698 chr13:94525795 rs11568673 G Ͼ T 900 Val to Leu 32 0 0.006 0 0.010 22 2712 chr13:94525781 rs1678339 G Ͼ A 904 Syn 0.156 0.031 0.217 0.020 23 2844 chr13:94524542 rs1189466 C Ͼ T 948 Syn 0.075 0.031 0.208 0.020 23 2847 chr13:94524539 rs11568708 C Ͼ T 949 Syn 0.019 0 0 0 23 2867 chr13:94524519 rs11568707 G Ͼ C 956 Cys to Ser 112 0.006 0 0 0 26 3211 chr13:94513114 rs11568653 G Ͼ A 1071 Val to Ile 29 0.006 0 0 0 26 3255 chr13:94513070 rs11568652 C Ͼ A 1085 Syn 0.013 0 0 0.010 26 3310 chr13:94513015 rs11568655 T Ͼ C 1104 Syn 0.100 0 0 0.010 26 3348 chr13:94512977 rs1751034 A Ͼ G 1116 Syn 0.231 0.169 0.242 0.200 27 3425 chr13:94503381 rs11568644 C Ͼ T 1142 Thr to Met 81 0 0.006 0 0 28 3609 chr13:94494541 rs11568695 G Ͼ A 1203 Syn 0.206 0 0 0.010 29 3659 chr13:94494013 rs11568639 G Ͼ A 1220 Arg to Gln 43 0.006 0 0 0 29 3723 chr13:94493949 rs11568640 C Ͼ T 1241 Syn 0.006 0 0 0 30 3774 chr13:94484956 rs11568704 G Ͼ A 1258 Syn 0.037 0 0 0 31 IVS31-3 chr13:94471940 rs9524765 C Ͼ T Intronic - 0.225 0 0 0.02 31 3941 chr13:94471867 rs11568688 A Ͼ G 1314 Gln to Arg 43 0.006 0 0 0 31 4016 chr13:94471792 rs3742106 T Ͼ G 3Ј-UTR - 0.287 0.388 0.467 0.470 Dashes indicate not relevant.
X
ABCC4 p.Met744Val 18364470:145:2584
status: NEW
X
ABCC4 p.Met744Val 18364470:145:2608
status: NEW
Login to comment