ABCMdb

ABCC4 p.Gly487Glu

None has been submitted yet.

Publications

PMID: 21619426 [PubMed] Stieger B et al: "Pharmacogenetics of drug transporters in the enterohepatic circulation."

No. Sentence Comment

117 Gene name Transporter SNP Protein Population size (n) In vitro function Ref. Liver efflux transporters (cont.) SLC47A1 (cont.) MATE1 (cont.) c.1490G>C c.149G>T p.C497S p.C497F N/A Reduced, unchanged or increased transport activities (substrate dependent) [170,229] c.1557G>C p.Q519H N/A Unchanged [170] ABCC4 MRP4 c.232C>G p.P78A N/A Increased intracellular drug accumulation (substrate dependent), lower transport protein expression [161] c.559C>T p.G187W N/A Increased intracellular drug accumulation, reduced transport protein expression Slightly reduced function [161] [162] c.877A>G p.K293E N/A Unchanged [161] c.912G>T p.K304N N/A Unchanged Unchanged [161] [162] c.1208C>T p.P403L N/A Increased intracellular drug accumulation [161] c.1460G>A p.G487E N/A Increased intracellular drug accumulation Reduced transport activity (substrate dependent) [161] [162] c.1492A>G p.K498E N/A Unaltered [161] c.1667A>G p.Y556C N/A Increased transport activity [162] c.2269G>A p.E575K N/A Increased transport activity [162] c.2230A>G p.M744V N/A Unchanged [161] c.2326G>A p.V776I N/A Reduced transport activity [162] c.2459G>T p.R820I N/A Reduced transport activity [162] c.2560G>T p.V854F N/A Unchanged [162] c.2596A>G p.I866V N/A Unchanged [162] c.2867G>C p.C956S N/A Reduced intracellular drug accumulation [161] c.3211G>A p.V1071I N/A Unchanged [161] c.3425C>T p.T1142M N/A Increased transport activity [162] For more information on members of the SLC superfamily of transporters please consult [301] and for more information of ABC transporters please consult [302]. Login to comment

PMID: 20103563 [PubMed] Klaassen CD et al: "Xenobiotic, bile acid, and cholesterol transporters: function and regulation."

No. Sentence Comment

7079 Two ABCC4 variants (G187W, G487E) demonstrate reduced in vitro MRP4 function as shown by higher intracellular accumulation of zidovudine and PMEA (Table 20) (Abla et al., 2008). Login to comment
7118 Nucleotide Change Amino Acid Change In Vitro Function Protein Expression/Localization ABCC1 MRP1 G128C C43S 1↔ Intracellular C218T T73I 1↔ Normal C257T S92F 2↔ Normal C350T T117M 2↔ Normal G689A R230Q ↔ Normal G1057A V353M N.D. N.D. G1299T R433S 2↔ Normal G1898A R633Q 2↔ Normal G2012T G671V ↔ Normal G2168A R723Q 2 Normal G2965A A989T 2↔ Normal G3140C C1047S 1↔ Normal G3173A R1058Q ↔ Normal C4535T S1512L ↔ Normal ABCC2 MRP2 C-24T N.D. N.D. G1058A R353H N.D. N.D. G1249A V417I ↔ Normal C2366T S789F 12 Intracellular T2780G L927R N.D. N.D. C3298T R1100C N.D. N.D. G3299A R1100H N.D. N.D. T3563A V1188E N.D. N.D. G4348A A1450T ↔ Normal/Intracellular G4544A C1515Y N.D. N.D. ABCC3 MRP3 G32A G11D ↔ Normal C202T H68Y N.D. N.D. G296A R99Q N.D. Normal C1037T S346F 2 Normal C1537A Q513K N.D. N.D. T1643A L548Q N.D. N.D. G1820A S607N 2 Normal C2221T Gln741STOP N.D. N.D. G2293C V765L ↔ Normal G2395A V799M N.D. N.D. C2758T P920S 1 Normal G2768A R923Q 1 Normal C3657A S1219R N.D. N.D. C3856G R1286G ↔ Normal G3890A R1297H N.D. N.D. C4042T R1348C 1 Normal A4094G Q1365R ↔ Normal C4141A R1381S ↔ Intracellular C4217T T1406M N.D. N.D. G4267A G1423R N.D. N.D. ABCC4 MRP4 C52A L18I N.D. N.D. C232G P78A 2↔ Normal T551C M184T N.D. N.D. G559T G187W 2 Reduced A877G K293E ↔ Normal G912T K304N ↔ Normal C1067T T356M N.D. N.D. C1208T P403L 2↔ Normal G1460A G487E 2 Normal A1492G K498E ↔ Normal A1875G I625M N.D. N.D. C2000T P667L N.D. N.D. A2230G M744V ↔ Normal G2269A E757K N.D. Intracellular G2459T R820I N.D. N.D. G2560T V854F N.D. N.D. G2698T V900L N.D. N.D. G2867C C956S 1↔ Normal G3211A V1071I ↔ Normal C3425T T1142M N.D. N.D. G3659A R1220Q N.D. N.D. A3941G Q1314R N.D. N.D. 2, reduced function; 1, increased function; ↔, no change in function; N.D. not determined. Login to comment
7076 Two ABCC4 variants (G187W, G487E) demonstrate reduced in vitro MRP4 function as shown by higher intracellular accumulation of zidovudine and PMEA (Table 20) (Abla et al., 2008). Login to comment
7115 Nucleotide Change Amino Acid Change In Vitro Function Protein Expression/Localization ABCC1 MRP1 G128C C43S 1࢒ Intracellular C218T T73I 1࢒ Normal C257T S92F 2࢒ Normal C350T T117M 2࢒ Normal G689A R230Q ࢒ Normal G1057A V353M N.D. N.D. G1299T R433S 2࢒ Normal G1898A R633Q 2࢒ Normal G2012T G671V ࢒ Normal G2168A R723Q 2 Normal G2965A A989T 2࢒ Normal G3140C C1047S 1࢒ Normal G3173A R1058Q ࢒ Normal C4535T S1512L ࢒ Normal ABCC2 MRP2 C-24T N.D. N.D. G1058A R353H N.D. N.D. G1249A V417I ࢒ Normal C2366T S789F 12 Intracellular T2780G L927R N.D. N.D. C3298T R1100C N.D. N.D. G3299A R1100H N.D. N.D. T3563A V1188E N.D. N.D. G4348A A1450T ࢒ Normal/Intracellular G4544A C1515Y N.D. N.D. ABCC3 MRP3 G32A G11D ࢒ Normal C202T H68Y N.D. N.D. G296A R99Q N.D. Normal C1037T S346F 2 Normal C1537A Q513K N.D. N.D. T1643A L548Q N.D. N.D. G1820A S607N 2 Normal C2221T Gln741STOP N.D. N.D. G2293C V765L ࢒ Normal G2395A V799M N.D. N.D. C2758T P920S 1 Normal G2768A R923Q 1 Normal C3657A S1219R N.D. N.D. C3856G R1286G ࢒ Normal G3890A R1297H N.D. N.D. C4042T R1348C 1 Normal A4094G Q1365R ࢒ Normal C4141A R1381S ࢒ Intracellular C4217T T1406M N.D. N.D. G4267A G1423R N.D. N.D. ABCC4 MRP4 C52A L18I N.D. N.D. C232G P78A 2࢒ Normal T551C M184T N.D. N.D. G559T G187W 2 Reduced A877G K293E ࢒ Normal G912T K304N ࢒ Normal C1067T T356M N.D. N.D. C1208T P403L 2࢒ Normal G1460A G487E 2 Normal A1492G K498E ࢒ Normal A1875G I625M N.D. N.D. C2000T P667L N.D. N.D. A2230G M744V ࢒ Normal G2269A E757K N.D. Intracellular G2459T R820I N.D. N.D. G2560T V854F N.D. N.D. G2698T V900L N.D. N.D. G2867C C956S 1࢒ Normal G3211A V1071I ࢒ Normal C3425T T1142M N.D. N.D. G3659A R1220Q N.D. N.D. A3941G Q1314R N.D. N.D. 2, reduced function; 1, increased function; ࢒, no change in function; N.D. not determined. Login to comment

PMID: 20799350 [PubMed] Kelly L et al: "Functional hot spots in human ATP-binding cassette transporter nucleotide binding domains."

No. Sentence Comment

48 Experimentally characterized nsSNPs, G487E and K498E (NBD1), and V1071I (NBD2) are indicated in red. Login to comment
72 Predictions of the Functional Effects of 40 nsSNPs in ABC Transporters Comon name HUGO name Mutation NBD Prediction BSEP ABCB11 E592Q NBD1 Neutral BSEP ABCB11 N591S NBD1 Neutral BSEP ABCB11 Q558H NBD1 Neutral BSEP ABCB11 V444A NBD1 Neutral BSEP ABCB11 E1186K NBD2 Disease MDR1 ABCB1 P1051A NBD2 Neutral MDR1 ABCB1 S1141T NBD2 Neutral MDR1 ABCB1 T1256K NBD2 Disease MDR1 ABCB1 V1251I NBD2 Neutral MDR1 ABCB1 W1108R NBD2 Disease MRP2 ABCC2 I670T NBD1 Disease MRP2 ABCC2 L849R NBD1 Disease MRP2 ABCC2 C1515Y NBD2 Disease MRP3 ABCC3 D770N NBD1 Neutral MRP3 ABCC3 K718M NBD1 Neutral MRP3 ABCC3 T809M NBD1 Disease MRP3 ABCC3 V765L NBD1 Disease MRP3 ABCC3 Q1365R NBD2 Disease MRP3 ABCC3 R1297H NBD2 Disease MRP3 ABCC3 R1348C NBD2 Disease MRP3 ABCC3 R1381S NBD2 Disease MRP4 ABCC4 G487E NBD1 Disease MRP4 ABCC4 K498E NBD1 Neutral MRP4 ABCC4 R1220Q NBD2 Neutral MRP4 ABCC4 T1142M NBD2 Neutral MRP4 ABCC4 V1071I NBD2 Neutral MRP6 ABCC6 I1330L NBD1 Neutral MRP6 ABCC6 I742V NBD1 Neutral MRP6 ABCC6 P664S NBD1 Neutral MRP6 ABCC6 R724K NBD1 Neutral MRP6 ABCC6 R769K NBD1 Neutral MRP6 ABCC6 A1291T NBD2 Neutral MRP6 ABCC6 E1369K NBD2 Neutral MRP6 ABCC6 G1327E NBD2 Disease MRP6 ABCC6 L1416R NBD2 Disease MRP6 ABCC6 R1268Q NBD2 Disease MRP6 ABCC6 R1461H NBD2 Disease MXR ABCG2 I206L NBD1 Neutral MXR ABCG2 P269S NBD1 Disease MXR ABCG2 Q141K NBD1 Neutral nsSNPs. Login to comment
84 The G487E nsSNP was found in only one Asian individual. Login to comment
105 The K498E variant had no effect on MRP4 transport, while the G487E variant showed moderate reduction in function (P < 0.05, Fig. 7). Login to comment
112 Structural models of MRP4 nsSNPs G487E, K498E, and V1071I. Login to comment
113 The models for G487E and K498E were based on the crystallographic structure of the human multidrug resistance protein MRP1 (PDB ID: 2CBZ). Login to comment
146 The distribution of disease-associated mutations is nonsymmetric in NBD1 and NBD2, rationalizing experimental work indicating that the two NBDs in an individual transporter are not functionally equivalent.34 Experimental characterization of ABCC4 nsSNPs and validation of a prediction model using a cell-based assay Predictions of functional impact of three ABCC4 nsSNPs (G487E, K498E, and V1071I) were chosen for experimental validation using HEK293 cells stably transfected with the reference transporter and its variants. Login to comment
147 Previously, we reported that the G487E nsSNP showed significantly reduced transport of two antiviral agents, azidothymidine and adefovir, compared with the reference following transient Figure 7. Login to comment
153 The decreased transport of TFV by the G487E variant is in accordance with previous reports using alternate substrates.29,35 Using Xenopus laevis oocytes, it was shown that G487E influenced the transport of 6-mercaptopurine and adefovir.35 As predicted, this effect could be due to the impact of the G487E nsSNP on the conformation of the loop near the membrane, which affects transporter function. Login to comment
154 It is also consistent with the radical chemical change at this position, as quantified by the relatively higher Grantham value for G487E (D ¼ 98).36 The V1071I variant is buried and lies outside the range of known functional sites. Login to comment

PMID: 18364470 [PubMed] Abla N et al: "The human multidrug resistance protein 4 (MRP4, ABCC4): functional analysis of a highly polymorphic gene."

No. Sentence Comment

9 However, two variants (G187W and G487E) showed a significantly reduced function compared to reference with both substrates, as evidenced by higher intracellular accumulation of AZT and PMEA compared to the reference MRP4 (43 and 69% increase in accumulation for G187W compared with the reference MRP4, with AZT and PMEA, respectively). Login to comment
110 Initially, ABCC4 haplotypes were inferred from all variable sites with a frequency higher than TABLE 1 Primers used for constructing the variants and the nonfunctional mutant by site-directed mutagenesis Variant Sequencea (5Ј-3Ј) P78A F: GAATGACGCACAGAAGGCTTCTTTAACAAGAGC R: GCTCTTGTTAAAGAAGCCTTCTGTGCGTCATTC G187W F: GTAACATGGCCATGTGGAAGACAACCACAG R: CTGTGGTTGTCTTCCACATGGCCATGTTAC K293E F: GTACGCCTGGGAAGAGTCATTTTCAAATC R: GATTTGAAAATGACTCTTCCCAGGCGTAC K304N F: CCAATTTGAGAAATAAGGAGATTTCCAAG R: CTTGGAAATCTCCTTATTTCTCAAATTGG P403L F: GCGCAACCGTCAGCTGCTGTCAGATGGTAAAAAG R: CTTTTTACCATCTGACAGCAGCTGACGGTTGCGC G487E F: CCCTGGGTGTTCTCGGAAACTCTGAGGAG R: CTCCTCAGAGTTTCCGAGAACACCCAGGG K498E F: GTAATATTTTATTTGGGAAGGAATACGAAAAGG R: CCTTTTCGTATTCCTTCCCAAATAAAATATTAC M744V F: GGGCAAACAAACAAAGTGTGCTAAATGTCACTG R: CAGTGACATTTAGCACACTTTGTTTGTTTGCCC C956S F: CGTCTGGATGCCATCTCTGCCATGTTTGTCATC R: GATGACAAACATGGCAGAGATGGCATCCAGACG V1071I F: CACAAGAAAAGATTGGCATTGTGGGAAG R: CTTCCCACAATGCCAATCTTTTCTTGTG G538D F: GGAACCACGCTGAGTGGAGACCAGAAAGCACGGGTAAACC R: GGTTTACCCGTGCTTTCTGGTCTCCACTCAGCGTGGTTCC F, forward; R, reverse. Login to comment
126 Ten nonsynonymous variants were chosen for this study based on a frequency of Ն5% in the populations studied (G187W, K304N, and M744V), high evolutionary conservation (all variants with the exception of M744V), or a high Grantham value (G187W Ͼ C956S Ͼ P403L ϭ G487E Ͼ K304N). Login to comment
144 However, the function of two variants (G187W and G487E) was significantly reduced compared to the reference, and this was observed both with AZT and PMEA (p Ͻ 0.001 and p Ͻ 0.005, Student`s t test with Bonferroni`s correction for 10 comparisons) (Fig. 4B). Login to comment
145 The P78A and P403L TABLE 2 Selected genetic variants in ABCC4a Exon Nucleotide Position Golden Path Positionb Variant Flagb Nucleotide Change Amino Acid or Intronic Position Amino Acid Change Grantham Score Allele Frequencyc AA (n ϭ 160) CA (n ϭ 160) AS (n ϭ 120) ME (n ϭ 100) 1 -49 chr13:94751618 rs3751333 C Ͼ T 5Ј-UTR - - 0.013 0.019 0.102 0.03 1 52 chr13:94751518 rs11568681 C Ͼ A 18 Leu to Ile 5 0.006 0.044 0.034 0.01 1 IVS1ϩ10 chr13:94751486 rs11568682 C Ͼ T Intronic - - 0.006 0.019 0 0 2 IVS2ϩ7 chr13:94697891 rs11568700 C Ͼ T Intronic - - 0.031 0 0 0 3 IVS3-5 chr13:94697355 rs4148437 T Ͼ C Intronic - - 0.087 0.331 0.183 0.25 3d 232 chr13:94697304 rs11568689 C Ͼ G 78 Pro to Ala 27 0 0 0.008 0 4 IVS4-10 chr13:94685099 rs11568638 C Ͼ T Intronic - - 0.025 0 0 0 4 IVS4ϩ10 chr13:94684855 rs11568637 A Ͼ G Intronic - - 0.031 0 0.117 0 5 551 chr13:94661017 rs11568657 T Ͼ C 184 Met to Thr 81 0.013 0 0 0 5 559 chr13:94661009 rs11568658 G Ͼ T 187 Gly to Trp 184 0 0.025 0.108 0.130 6 669 chr13:94659805 rs899494 C Ͼ T 223 Syn 0.219 0.200 0.125 0.090 6 717 chr13:94659757 rs11568674 T Ͼ C 239 Syn 0 0 0.008 0 7 877 chr13:94658089 rs11568684 A Ͼ G 293 Lys to Glu 56 0.006 0 0 0 8 912 chr13:94657036 rs2274407 G Ͼ T 304 Lys to Asn 94 0.181 0.087 0.225 0.160 8 951 chr13:94656997 rs2274406 G Ͼ A 317 Syn 0.619 0.406 0.458 0.390 8 969 chr13:94656979 rs2274405 G Ͼ A 323 Syn 0.312 0.406 0.458 0.320 8 1035 chr13:94656913 rs11568703 G Ͼ A 345 Syn 0 0.013 0 0 8 1067 chr13:94656881 rs11568701 C Ͼ T 356 Thr to Met 81 0 0 0 0.010 8 IVS8ϩ8 chr13:94656779 rs11568702 T Ͼ A Intronic - 0 0.013 0 0 9 1208 chr13:94645146 rs11568705 C Ͼ T 403 Pro to Leu 98 0.006 0 0 0 11 1458 chr13:94637043 rs11568670 G Ͼ A 486 Syn 0 0.006 0 0 11 1460 chr13:94637041 rs11568668 G Ͼ A 487 Gly to Glu 98 0 0 0.008 0 11 1492 chr13:94637009 rs11568669 A Ͼ G 498 Lys to Glu 56 0.025 0 0 0 11 1497 chr13:94637004 rs1557070 C Ͼ T 499 Syn 0.238 0 0 0 14 1737 chr13:94620874 rs11568664 T Ͼ C 579 Syn 0.006 0 0 0 15 IVS15-7 chr13:94616629 rs11568696 A Ͼ G Intronic - 0.031 0 0 0 15 1875 chr13:94616572 rs11568699 A Ͼ G 625 Ile to Met 10 0.006 0 0 0 15 2000 chr13:94616447 rs11568697 C Ͼ T 667 Pro to Leu 98 0 0.006 0 0 15 2001 chr13:94616446 rs11568698 C Ͼ T 667 Syn 0.013 0 0 0 16 2100 chr13:94614708 rs11568666 C Ͼ T 700 Syn 0 0.013 0 0 18 2230 chr13:94613455 rs9282570 A Ͼ G 744 Met to Val 21 0.050 0 0 0 18 2269 chr13:94613416 rs3765534 G Ͼ A 757 Glu to Lys 56 0.025 0.013 0.033 0.030 19 2364 chr13:94611535 rs11568709 C Ͼ T 788 Syn 0.006 0 0 0 20 2459 chr13:94566253 rs11568659 G Ͼ T 820 Arg to Ile 97 0.006 0 0 0 21 2560 chr13:94533521 rs11568694 G Ͼ T 854 Val to Phe 50 0.006 0 0 0 21 2577 chr13:94533504 rs11568691 C Ͼ T 859 Syn 0 0.006 0 0 22 2698 chr13:94525795 rs11568673 G Ͼ T 900 Val to Leu 32 0 0.006 0 0.010 22 2712 chr13:94525781 rs1678339 G Ͼ A 904 Syn 0.156 0.031 0.217 0.020 23 2844 chr13:94524542 rs1189466 C Ͼ T 948 Syn 0.075 0.031 0.208 0.020 23 2847 chr13:94524539 rs11568708 C Ͼ T 949 Syn 0.019 0 0 0 23 2867 chr13:94524519 rs11568707 G Ͼ C 956 Cys to Ser 112 0.006 0 0 0 26 3211 chr13:94513114 rs11568653 G Ͼ A 1071 Val to Ile 29 0.006 0 0 0 26 3255 chr13:94513070 rs11568652 C Ͼ A 1085 Syn 0.013 0 0 0.010 26 3310 chr13:94513015 rs11568655 T Ͼ C 1104 Syn 0.100 0 0 0.010 26 3348 chr13:94512977 rs1751034 A Ͼ G 1116 Syn 0.231 0.169 0.242 0.200 27 3425 chr13:94503381 rs11568644 C Ͼ T 1142 Thr to Met 81 0 0.006 0 0 28 3609 chr13:94494541 rs11568695 G Ͼ A 1203 Syn 0.206 0 0 0.010 29 3659 chr13:94494013 rs11568639 G Ͼ A 1220 Arg to Gln 43 0.006 0 0 0 29 3723 chr13:94493949 rs11568640 C Ͼ T 1241 Syn 0.006 0 0 0 30 3774 chr13:94484956 rs11568704 G Ͼ A 1258 Syn 0.037 0 0 0 31 IVS31-3 chr13:94471940 rs9524765 C Ͼ T Intronic - 0.225 0 0 0.02 31 3941 chr13:94471867 rs11568688 A Ͼ G 1314 Gln to Arg 43 0.006 0 0 0 31 4016 chr13:94471792 rs3742106 T Ͼ G 3Ј-UTR - 0.287 0.388 0.467 0.470 Dashes indicate not relevant. Login to comment
154 To characterize the functional difference observed with some of the variants, we measured the intracellular accumulation of AZT and PMEA as a function of the extracellular concentration for the reference and the variants that showed a reduced function with one or both substrates (P78A, G187W, and G487E), as well as the C956S variant, which was more functional with respect to PMEA transport (Fig. 5). Login to comment
156 The transport velocity curves (Fig. 5) suggest that the differences reported with some of the variants (G187W and G487E) are real and concentration-independent, and this effect seems more pronounced with AZT. Login to comment
179 To check that the functional differences were not due to differences in localization of the variants at the cell membrane, immunocytochemistry studies were carried out with the less functional variants (G187W, G487E, and P78A), the nonfunctional mutant (G538D) and the more functional variant (C956S). Login to comment
195 The values represent the mean Ϯ S.D. of n ϭ 3 (AZT) or n ϭ 4 (PMEA) determinations (f, reference; ࡗ, P78A; Œ, G187W; ‚, G487E; and E, C956S). Login to comment
240 C, P78A; D, G187W; E, P403L; F, G487E; G, C956S; H, G538D. Login to comment
244 It is supported by the fact that the G487E and C956S variants also have high Grantham values (D ϭ 98 and 102, respectively) and altered functions. Login to comment
246 The ϳ50% reduction in function observed with the G187W variant could be clinically relevant, whereas the small differences observed with the other variants (G487E, P78A, P403L, and C956S) are less likely to be significant. Login to comment

PMID: 18300232 [PubMed] Janke D et al: "6-mercaptopurine and 9-(2-phosphonyl-methoxyethyl) adenine (PMEA) transport altered by two missense mutations in the drug transporter gene ABCC4."

No. Sentence Comment

164 A summary of all MRP4 protein mutations examined, their distribution within the protein, their frequencies and their functional prediction scores (SIFT/PolyPhen/Grantham) are listed in Supplementary Table S1 and Supplementary Figure S3. A total of six of them (G187W, G487E, Y556C, R820I, V854F, and T1142 M) are located either within transmembrane regions or near the ATP-binding domain of MRP4 and were predicted to have a functional effect by the computer-based algorithms (Supplementary Table S2). Login to comment
171 The G487E and R820I mutations resulted in a nonsignificant decrease of both, [14 C] 6-MP and [3 H] PMEA efflux (Supplementary Fig. S5). Login to comment
188 Comparison ofTransport to Cell Surface Expression Y556C caused a two to three times higher [3 H] PMEA efflux, and V776I, G487E, and R820I caused a 25-30% decrease in [14 C] 6-MP efflux compared to wild-type when transport activity was normalized using the MRP4 expression levels (Fig. 5). Login to comment
189 The G487E and R820I mutations had a similar effect on [3 H] PMEA efflux, whereas the V776I did not (Fig. 5). Login to comment
251 In contrast, variants of MRP4 having an influence on functional activity (G487E, Y556C, V776I, and R820I) were present at allelic frequencies o1%. Login to comment
257 When SIFT and PolyPhen were used to evaluate the MRP4 nonsynonymous SNPs, both predicted the same variants as deleterious (G187W, G487E, Y556C, R820I, V854F, and TABLE 1. Login to comment
258 Conservation of the MRP4 Polymorphic AminoAcids Among Di¡erent ABCC Orthologs and HomologsÃ Protein Speciesa G187W K304N G487E Y556C E757K V776I R820I V854F I866V T1142M MRP4 Human G K G Y E V R V I T Mouse G K G Y E V R I V T Rat G K G Y G V R I L S MRP1 Human K Q D Y K ^ N C F S Mouse K Q D Y F A ^ V F S Rat K Q D Y ^ G N V V S MRP2 Human K K G Y S G R L V S Mouse R K G Y S G R L V S Rat K K G Y S G R L I S MRP3 Human R Q C F L G R L V S Rat R Q C F S G R I V S MRP5 Human ^ ^ A Y D L R V S T Mouse ^ ^ A Y D L R V S T Rat ^ ^ A Y D L R V S T MRP6 Human K G T Y G H S V V S Mouse K G T Y H G N G V T Rat K G T Y G N G V V T ÃAligned using ClustalW (www.ebi.ac.uk/clustalw). Login to comment