ABCMdb

ABCA1 p.Ser1731Cys

None has been submitted yet.

Publications

PMID: 22923419 [PubMed] Reddy MV et al: "Exome sequencing identifies 2 rare variants for low high-density lipoprotein cholesterol in an extended family."

No. Sentence Comment

38 Genotype by sex interaction We included the extended family together with 10 additional families with previously identified mutations in ABCA16-8 in a gene-sex interaction analysis, comprising 200 individuals and 9 different mutations in ABCA1 (DelED1893, G616V, K776N, N1800H, Q2210H, R1851X, R2084X, R909X and S1731C). Login to comment
48 We compared mmmodooo els with and witho nteere aaaca tion termm wwwhiili eee kekeepepepe inggg ttht eee ABABBCCA11 ggenonotytytytypepepp s iniin botthhh thhheee nulllll aaanddd iiiintereerac assumemememedddd a dodod iimiminana tntnt geneteteticicicic inhhhherererititititananana cee, lclcllasassisisiifyfyfyfyinining cacacaarrrrieiei rsrs offff aaaa mmmutaatititionon aass 111 and a multipplicatiive iiinteraction term,,, m llultiiipllpllyiyinggg thehhh gggenotypypype score byy sex ((me 0)0) WW lal dod ded e iinte ctiio te ii hhiichh dd st ll Cell culture Human skin fibroblasts were obtained from 3.0-mm punch biopsies of the forearm of a healthy control subject and the affected proband homozygous for the ABCA1 S1731C variant. Login to comment
63 Rare missense variant in ABCA1 The ABCA1 (S1731C) variant is not present in dbSNP13214 or The 1000 Genomes Project14 data and is located in exon 38. Login to comment
64 This previously reported rare variant is changing a conserved amino acid from serine to cysteine and is known to result in decreased cholesterol efflux.7,24-26 In order to further determine the effect of the S1731C variant on cholesterol efflux, we used human fibroblasts from the affected proband homozygous for the S1731C variant, and compared these cells to a normal control. Login to comment
72 As the lipid levels of the ABCA1 S1731C variant carriers suggested a possible gene-gender effect (Tables 3-4), we further investigated whether exposure to -estradiol steroid hormone endogenously expressed in females, possibly corrects the cholesterol efflux defect in fibroblasts from the S1731C male ABCA1 carrier during the 22OH/9CRA ABCA1 stimulation phase of 17 hours (Figure 2B). Login to comment
73 Interestingly, after adjusting for basal cholesterol diffusion, we observed that upon treatment with elevated doses of estradiol (>20 nM), efflux in the S1731C proband significantly increased (P=7.2x10-6 , r=0.78 using a non-parametric Spearman trend test), while that in the wildtype control remained constant (P=0.2, r=0.25) (Figure 2B). Login to comment
74 Taken together, these results support a genotype-sex interaction effect, as hormonal regulation with 17 -estradiol partially restored the low efflux observed in the S1731C male proband but had no significant effect on the efflux of a wild-type control. Login to comment
81 By stratifying individuals by their HDL percentiles, we can see that all the affected family members with HDL-C<5th percentile carry a risk allele for either one or both of the variants (3 P234L, 11 S1731C, and 8 P234L/S1731C), except in one separate branch of the extended family in which the low HDL-C traits appears to be inherited from the affected spouse`s side (Figure 1). Login to comment
105 Genotype by sex interaction The effect of the ABCA1 S1731C variant on low HDL-C levels appears more profound in the males than in females in the extended family (Table 4). Login to comment
107 Although the frequency of the S1731C variant may be individually too rare for testing genetic interactions (as large sample sizes are necessary), rare variants with large phenotypic effects are collectively common in low HDL-C families.26 We hypothesized that the apparent sex effect may not be restricted to the S1731C allele, but rather it may generally extend to ABCA1 alleles with major phenotypic effects. Login to comment
111 The S1731C variant was present in 3 of these additional low HDL-C pedigrees7 and together with the exome sequenced family the association signal for the main effect of S1731C on low HDL-C status resulted in a p-value of 0.008. Login to comment
113 Althou the frequency of the S1731C vari ividually too rare for testing genetic interactions (as large sample sizes are neces t s esi ed that the apparent se effect ma not be restricted to the S1731C allele b in fefefefemamamalelelel sss iniii ttthehhh extended family (Tablllleee 4)4 . Login to comment
123 Mutations disrupting the normal function of ABCA1 result in little or no circulating HDL.34 Previous studies have shown that cell lines with the identified ABCA1 variant S1731C exhibit low levels of protein expression,25 and that cells transfected with the S1731C allele express abundant ABCA1 mRNA but fail to generate significant amounts of ABCA1 protein.25 rtion ooooffff ththththeeee HDHDHDHDL-L-L-L-CCCC nd heritability in an extended family We also observed a sex effect for ABCA1 a m s n ants of which one is less severe in females. Traditional linkage analysis was una nd herittitabababilititity ininn an extended family. Login to comment
124 We aalsl o observed a sexexx effect for ABCA1 allel carriers exxhihihibiiitititingnng sssigigigigninin fififificcantnn lly lllowoowerr HHDLDLDL-CCCC lelel vvvelslls ttthahahannn fefefemmmalelelees.ss FuFuFuFurtrtheheheherm unnnnafafafa fefefeectctcttedededd ffamamammililili yyy mememem mbmbmbbererrrssss hahh dddd thththheeee LPLPLPLLLL vavavavariririr anananntttt orororr bbbotototthhhh vvavaririririannanntstststs yyy.... OOOOururur stutututudydydydy s how utilizationononon oooffff exexexomomomomeee seseseseququuquenenene cicicicingnngng wwwwasass ccccrirr ticacacacalll totototo rrevevvveaeeaealll thththeee cocococomplex combin aaantntss ofof wwhihiichhch oonene iiiss lelessss ssevevereree inini fffememalalleses.. TrTTradadditititioionanall lililinknkkagagee ananalalysysisis wwasas uunana Furthermore, the cholesterol efflux of S1731C has been shown to be reduced to 12.3-68.0% of the wildtype.7,25,26 Here, we observed a ~40% cholesterol efflux reduction in the proband homozygous for the S1731C variant as compared to a normal control, in line with the earlier findings.7,25,26 In our previous paper,7 we showed that three heterozygous subjects with the S1731C variant have cholesterol efflux values of 63%, 66%, and 68% of the wildtype. Login to comment
126 Although the phenotype data suggest that the S1731C variant does not have a gene dose effect, this conclusion warrants additional functional studies in future, as there are only 4 homozygotes in the family two of which are also heterozygous for the LPL variant, and furthermore the variant has a large range (12.3-68.0% of the wildtype) in its effect on the cholesterol efflux.7,25,26 The main function of LPL is to hydrolyze triglycerides in order to deliver fatty acids to the tissue. Login to comment
129 Regarding the identified P207L variant, individuals with this mutation have reduced HDL particles compared with the control subjects.35 Previous studies have also shown that missense mutations in exon 5 of the LPL gene where the P207L variant resides are the most common cause of LPL deficiency.36,37 Importantly, Ma et al. reported that upon site-directed in vitro mutagenesis this variant produces a catalytically inactive lipoprotein lipase protein which is the cause of the lipoprotein lipase deficiency in the patients.29 Taking together these previous data, along with our PolyPhen15 and SIFT16 predictions, it is highly likely that both identified variants S1731C and P207L affect protein function. Login to comment
131 SSSeS quqq ence variation tedd to bb iiatedd ii hth thhe iiskk fof CCHDHD TGTG dd HDHDLL CC 33 AAn ffffiiciie The two identified variants, S1731C and P207L have been reported previously in French Canadian dyslipidemic individuals but not in normal controls.7,24-29 The S1731C ABCA1 variant was present in three French Canadian dyslipidemic families with low HDL-C levels7 but not in 528 chromosomes from French Canadian subjects with normal HDL-C levels.24 It was also absent in 108 French Canadian subjects with high HDL-C.26 The P207L LPL variant was previously observed in 37 unrelated French Canadian patients with lipoprotein lipase deficiency with 54 mutant alleles present in that study sample.29 In the same study, the variant was also genotyped in 34 unrelated patients with LPL deficiency from ancestries other than French Canadian. Login to comment
137 These interesting sex-specific mechanisms of ABCA1 may involve hormonal regulation of ABCA1, a hypothesis supported by our efflux experiment (Figure 2B), demonstrating that exposure of fibroblasts of a male proband with the ABCA1 S1731C variant to es other than Frenchchchch the risiii kkkk alllllllel lllle. Login to comment
41 Genotype by Sex Interaction We included the extended family together with 10 additional families with previously identified mutations in ABCA16 -8 in a gene-sex interaction analysis, comprising 200 individuals and 9 different mutations in ABCA1 (DelED1893, G616V, K776N, N1800H, Q2210H, R1851X, R2084X, R909X, and S1731C). Login to comment
53 Because the affection status is adjusted for sex, the inclusion of the main effect of sex in the model was no longer necessary. The binary HDL-C affection was tested because the variance of HDL-C levels in these ascertained families is reduced and thus limited for effective quantitative analysis.1 Cell Culture Human skin fibroblasts were obtained from 3.0-mm punch biopsies of the forearm of a healthy control subject and the affected proband homozygous for the ABCA1 S1731C variant. The fibroblasts were cultured in Dulbecco`s modified Eagle`s medium (DMEM) supplemented with 0.1% nonessential amino acids, penicillin (100 U/mL), streptomycin (100 bc;g/mL), and 10% fetal bovine serum. Login to comment
79 Because the lipid levels of the ABCA1 S1731C variant carriers suggested a possible gene-sex effect (Tables 3 and 4), we further investigated whether exposure to 17b2;-estradiol steroid hormone endogenously expressed in females, possibly Table 3.ߓ The Lipid Levels and Other Clinical Characteristics of the 3 Individuals That Were Exome Sequenced IND ID ABCA1 LPL TC TG HDL-C HDL % BMI LDL-C AGE SEX Ind5 C/C C/T 4.61 1.3 0.67 <5 22.02 3.36 66 Male Ind14 G/C C/T 4.6 6.1 0.62 <5 25.81 NA 55 Male Ind19 G/C C/T 2.43 2.4 0.62 <5 27.22 0.7 21 Male LPL indicates lipoprotein lipase; TG, triglyceride; HDL-C, high-density lipoprotein cholesterol; BMI, body mass index; LDL, low-density lipoprotein; and ABCA1, ATP-binding cassette, subfamily A (ABC1), member 1 and TC, total cholesterol. Login to comment
83 ߓߓCirc Cardiovasc GenetߓߓOctober 2012 corrects the cholesterol efflux defect in fibroblasts from the S1731C maleABCA1 carrier during the 22OH/9CRAABCA1 stimulation phase of 17 hours (Figure 2B). Login to comment
84 Interestingly, after adjusting for basal cholesterol diffusion, we observed that upon treatment with elevated doses of estradiol (>20 nM), efflux in the S1731C proband significantly increased (P=7.2&#d7;10-6 , r=0.78 using a nonparametric Spearman trend test), whereas that in the wild-type control remained constant (P=0.2, r=0.25) (Figure 2B). Login to comment
85 Taken together, these results support a genotype-sex interaction effect, as hormonal regulation with 17b2;-estradiol partially restored the low efflux observed in the S1731C male proband but had no significant effect on the efflux of a wild-type control. Login to comment
91 By stratifying individuals by their HDL percentiles, we can see that all the affected family members with HDL-C less than the fifth percentile carry a risk allele for either 1 or both of the variants (3 P234L, 11 S1731C, and 8 P234L/ S1731C), except in 1 separate branch of the extended family in which the low HDL-C traits appears to be inherited from the affected spouse`s side (Figure 1). Login to comment
114 Genotype by Sex Interaction The effect of the ABCA1 S1731C variant on low HDL-C levels appears more profound in the males than in females in the extended family (Table 4). Login to comment
116 Although the frequency of the S1731C variant may be individually too rare for testing genetic interactions (as large sample sizes are necessary), rare variants with large phenotypic effects are collectively common in low HDL-C families.26 We hypothesized that the apparent sex effect may not be restricted to the S1731C allele, but rather it may generally extend to ABCA1 at Semmelweis University (Egyetem) on December 3, 2015 http://circgenetics.ahajournals.org/ Downloaded from Reddy et alߓߓ Identification of Rare Variants for HDLߓߓ alleles with major phenotypic effects. Login to comment
120 The S1731C variant was present in 3 of these additional low HDL-C pedigrees,7 and together with the exome sequenced family, the association signal for the main effect of S1731C on low HDL-C status resulted in a P value of 0.008. Login to comment
130 Mutations disrupting the normal function of ABCA1 result in little or no circulating HDL.33 Previous studies have shown that cell lines with the identified ABCA1 variant S1731C exhibit low levels of protein expression,25 and that cells transfected with the S1731C allele express abundant ABCA1 mRNA but fail to generate significant amounts of ABCA1 protein.25 Furthermore, the cholesterol efflux of S1731C has been shown to be reduced to 12.3% to 68.0% of the wild-type.7,25,26 Here, we observed a ࣈ40% cholesterol efflux reduction in the proband homozygous for the S1731C variant as compared with a normal control, in line with the earlier findings.7,25,26 In our previous article,7 we showed that 3 heterozygous subjects with the S1731C variant have cholesterol efflux values of 63%, 66%, and 68% of the wild type. Login to comment
136 22OH indicates 22(R)-hydroxycholesterol; 9CRA, 9-cis-retinoic acid; and ApoA-I, apolipoprotein A-I. B, Elevated concentrations of 17b2;-estradiol improve cholesterol efflux in the male proband with the ABCA1 S1731C variant. Login to comment
141 Upon exposure to increasing estradiol concentrations (>20 nM), cholesterol efflux in the S1731C proband significantly increases. Login to comment
145 22OH indicates 22(R)-hydroxycholesterol; 9CRA, 9-cis-retinoic acid; and ApoA-I, apolipoprotein A-I. ***P=7.2&#d7;10-6 (r=0.78) using a nonparametric Spearman trend test for the dose effect on efflux in the S1731C proband; and nsP=0.2 (r=0.25) using a nonparametric Spearman trend test for the dose effect on efflux in the wild-type control. Login to comment
147 Although the phenotype data suggest that the S1731C variant does not have a gene dose effect, this conclusion warrants additional functional studies in future, because there are only 4 homozygotes in the family 2 of which are also heterozygous for the LPL variant, and furthermore the variant has a large range (12.3%-68.0% of the wild-type) in its effect on the cholesterol efflux.7,25,26 The main function of LPL is to hydrolyze TGs to deliver fatty acids to the tissue. Login to comment
150 Regarding the identified P207L variant, individuals with this mutation have reduced HDL particles compared with the control subjects.34 Previous studies have also shown that missense mutations in exon 5 of the LPL gene where the P207L variant resides are the most common cause of LPL deficiency.35,36 Importantly, Ma et al reported that upon site-directed in vitro mutagenesis this variant produces a catalytically inactive LPL protein, which is the cause of the LPL deficiency in the patients.29 Taken together, these previous data, along with our PolyPhen15 and SIFT16 predictions, show that it is highly likely that both identified variants S1731C and P207L affect protein function. Login to comment
151 The 2 identified variants, S1731C and P207L, have been reported previously in French-Canadian dyslipidemic individuals but not in normal controls.7,24 -29 The S1731C ABCA1 variant was present in 3 French-Canadian dyslipidemic families with low HDL-C levels,7 but not in 528 chromosomes from French-Canadian subjects with normal HDL-C levels.24 It was also absent in 108 French-Canadian subjects with high HDL-C.26 The P207L LPL variant was previously observed in 37 unrelated French-Canadian patients with LPL deficiency with 54 mutant alleles present in that study sample.29 In the same study, the variant was also genotyped in 34 unrelated patients with LPL deficiency from ancestries other than French-Canadian. Login to comment
158 Figure 3 shows the age-sex specific population HDL-C percentiles by ABCA1 genotypes and sex in 200 French-Canadian family members from 11 French-Canadian families with different ABCA1 mutations (DelED1893, G616V, K776N, N1800H, Q2210H, R1851X, R2084X, R909X, and S1731C). Login to comment
165 at Semmelweis University (Egyetem) on December 3, 2015 http://circgenetics.ahajournals.org/ Downloaded from Reddy et alߓߓ Identification of Rare Variants for HDLߓߓ demonstrating that exposure of fibroblasts of a male proband with the ABCA1 S1731C variant to increasing concentrations of 17b2;-estradiol led to a significantly increased efflux in the male proband with the ABCA1 variant. Login to comment

PMID: 17923263 [PubMed] Kitjaroentham A et al: "R219K polymorphism of ATP binding cassette transporter A1 related with low HDL in overweight/obese Thai males."

No. Sentence Comment

110 Recently, a reported bioinformatics approach to predict and experimentally test the functional consequence of ABCA1 genetic variation found that the HEK293 cell transfected with S1731C cSNP allele expressed low-level ABCA1 protein and reduced cholesterol efflux. Login to comment
109 Recently, a reported bioinformatics approach to predict and experimentally test the functional consequence of ABCA1 genetic variation found that the HEK293 cell transfected with S1731C cSNP allele expressed low-level ABCA1 protein and reduced cholesterol efflux. Login to comment

PMID: 17303779 [PubMed] Kiss RS et al: "Genetic etiology of isolated low HDL syndrome: incidence and heterogeneity of efflux defects."

No. Sentence Comment

47 In ABCA1, a total of 19 nonsynonymous coding sequence variants; some of these we reported previously.22 Of these, 9 sequence variants were common polymorphisms (ie, reported in the literature as common or of similar prevalence in control subjects): P85L, P85A, R219K, V399A, V771M, V825I, I883M, E1172D, R1587K.14,32-35 Another 5 sequence variants, identified here, were previously reported to be disease causing: W590L (reported as W590S)14; C1477F (reported as C1477R)13; S1731C (only found in French-Canadian populations)36; N1800H32; and 1851X.37 Five sequence variants were novel: K199F, H551D, R965C, E1386Q, and D1706N. Login to comment
49 Eight subjects with sequence variants in ABCA1 had defective cholesterol efflux (measured in repeated assays cholesterol-loaded monocyte-derived macrophage [MDMs]), and these ABCA1 sequence variants were tested in an in vitro expression system for cholesterol efflux activity.38 ABCA1 proteins containing the sequence variants W590L, C1477F, D1706N, S1731C, or N1800H were all found to have significantly impaired cholesterol efflux, whereas the H551D and E1386Q variants had very minor, if any, effects on cholesterol transport (Figure 1A). Login to comment
71 0 2 4 6 8 10 m ock W T E1386Q C 1477F D 1706N S1731C N 1800H W 590L H 551D Q 2215X antibodybound (cpmx103 /mgcellprotein) 0 1 2 3 4 5 m ock W T E1386Q C 1477F D 1706N S1731C N 1800H W 590L H 551D Q 2215X apoA-Imediatedefflux(%)A B apoA-Imediatedefflux (%oftotalradioactivity) antibodybound (cpmx103/mgcellprotein) Figure 1. Login to comment
88 of Subjects Functional Mutations (All Heterozygous) Percentage of Total Population ApoA-I 2 33X, ⌬K182 2 ABCA1 7 H551D, W590L, C1477F, D1706N, S1731C, N1800H, 1851X 6 LCAT 4 W61X, G104S, N131D, S208T 3 PLTP 1 R459Q 1 Unknown 88 Total no. Login to comment
42 In ABCA1, a total of 19 nonsynonymous coding sequence variants; some of these we reported previously.22 Of these, 9 sequence variants were common polymorphisms (ie, reported in the literature as common or of similar prevalence in control subjects): P85L, P85A, R219K, V399A, V771M, V825I, I883M, E1172D, R1587K.14,32-35 Another 5 sequence variants, identified here, were previously reported to be disease causing: W590L (reported as W590S)14; C1477F (reported as C1477R)13; S1731C (only found in French-Canadian populations)36; N1800H32; and 1851X.37 Five sequence variants were novel: K199F, H551D, R965C, E1386Q, and D1706N. Login to comment
44 Eight subjects with sequence variants in ABCA1 had defective cholesterol efflux (measured in repeated assays cholesterol-loaded monocyte-derived macrophage [MDMs]), and these ABCA1 sequence variants were tested in an in vitro expression system for cholesterol efflux activity.38 ABCA1 proteins containing the sequence variants W590L, C1477F, D1706N, S1731C, or N1800H were all found to have significantly impaired cholesterol efflux, whereas the H551D and E1386Q variants had very minor, if any, effects on cholesterol transport (Figure 1A). Login to comment
83 of Subjects Functional Mutations (All Heterozygous) Percentage of Total Population ApoA-I 2 33X, èc;K182 2 ABCA1 7 H551D, W590L, C1477F, D1706N, S1731C, N1800H, 1851X 6 LCAT 4 W61X, G104S, N131D, S208T 3 PLTP 1 R459Q 1 Unknown 88 Total no. Login to comment

PMID: 16343503 [PubMed] Alrasadi K et al: "Functional mutations of the ABCA1 gene in subjects of French-Canadian descent with HDL deficiency."

No. Sentence Comment

6 Three probands had the S1731C mutation, while two others had the R1851X and K776N documented mutations, respectively. Login to comment
86 Table 2 Mutations of the ABCA1 gene in French-Canadian probands with HDL deficiency and defective cellular lipid efflux Probandsa Gene region Nucleotide change Amino acid change Predicted effect by Polyphenb Reference ABE Exon 48 C6370T R2084X Truncated protein [8,9] MGA Exon 14 del 2017-2019 del L693 Probably damaging [8,9] ALA Exon 41 del 5618-5623 del ED1893,4 Probably damaging [8,9] RLA Exon 18 C2665T R909X Truncated protein [8,9] RDU Exon 41 C5864T R1851X Truncated protein [4] SBO Exon 40 A5711C N1800H Possibly damaging [27] Exon 49 G6943C Q2210H Probably damaging - RPH Exon 14 G2160T G616V Probably damaging - GOB Exon 41 del 5833 fs F1840L, L1869X Truncated protein - LNO Exon 38 C5505G S1731C Possibly damaging [4] VDU Exon 38 C5505G S1731C Possibly damaging [4] RRI Exon 38 C5505G S1731C Possibly damaging [4] PCH Exon 16 G2641C K776N Possibly damaging [5] GCH - - - - - LBO - - - - - a Probands refer to subjects ID # 301 in the pedigrees. b Polyphen computer software (http://www.bork.embl-heidelberg.de/polphen/). Login to comment
117 The patient`s family declined participationinthestudy.Inthreeotherprobands,LNO,VDU and RRI, Table 1, the previously reported S1731C mutation [4] was found. Login to comment
123 (Continued ) S1731C mutation while phospholipid efflux was relatively preserved. Login to comment
149 Three probands, LNO, VDU and RRI were carriers of the previously reported S1731C mutation, an ABCA1 gene defect that has been found in French Canadians only [4]. Login to comment
151 While the cellular cholesterol efflux was markedly reduced in the three cell lines with the S1731C mutation (63, 66 and 68% of controls), phospholipid efflux was only modestly reduced (84, 74 and 83% of controls). Login to comment
178 As our patients are of French-Canadian descent, the possibility of a founder effect is also highlighted by the finding that 3/12 probands were sharing the same ABCA1 mutation (S1731C), a typical French-Canadian mutation [4]. Login to comment

PMID: 16704350 [PubMed] Brunham LR et al: "Variations on a gene: rare and common variants in ABCA1 and their impact on HDL cholesterol levels and atherosclerosis."

No. Sentence Comment

605 Many of these variants have been studied in relationship to their association with HDL cholesterol levels and atherosclerosis (11, 15, 22, 27, 28, 38, TABLE 4 Nonsynonymous single-nucleotide polymorphisms (SNPs) in ABCA1 SNP id Nucleotidea Amino acidb Observed heterozygosity rs2230806 G969A R219K 0.488 rs9282541 C1001T R230C 0.029 rs9282543 T1509C V399A 0.020 rs4131108 A1556C M415L - rs13306068 A1949G I546V - rs2066718 G2624A V771M 0.074 rs2472458 G2804A D831N - rs4149313 A2962G I883M - rs2482437 C3326T E1005K - rs13306072 G3473A V1054I - rs13306073 G3599A V1096I - rs1997618 T4977C I1555T - rs2230808 A5073G K1587R 0.480 rs1883024 T5256C L1648P - - C5505G S1731C - a Nucleotide position is with respect to NM 005502. b Amino acid position is with respect to NP 005493. Login to comment

PMID: 16429166 [PubMed] Brunham LR et al: "Accurate prediction of the functional significance of single nucleotide polymorphisms and mutations in the ABCA1 gene."

No. Sentence Comment

38 All ABCA1 alleles expressed protein (R. Singaraja, H. Visscher, E. R. James, G. Chimini, and M. R. Hayden, unpublished data), with the exception of the S1731C cell line, for which we observed low levels of protein expression from two independently generated cell lines. Login to comment
39 To confirm that the S1731C allele was being expressed, we performed RT-PCR for ABCA1 on reverse-transcribed RNA from untransfected 293 cells and cells transfected with the wild-type or S1731C ABCA1 alleles. Login to comment
40 We found that cells transfected with the S1731C allele expressed abundant ABCA1 mRNA, at levels comparable to that of wild-type ABCA1 (Figure S1). Login to comment
41 The S1731C allele therefore expresses normal ABCA1 mRNA but fails to generate significant amounts of ABCA1 protein. Login to comment
48 This SNP has been reported to be associated with decreased HDL cholesterol and increased severity of atherosclerosis in Table 1. subPSEC Scores and Probability of Functional Impairment (Pdeleterious) for ABCA1 Mutations and SNPs Mutations SNPs Variant SubPSEC Pdeleterious Variant subPSEC Pdeleterious P85L À4.62 0.83 R219K À0.57 0.08 H160F À2.79 0.45 V399A À2.26 0.32 R230C À4.27 0.78 V771M À2.86 0.46 A255T À1.81 0.23 T774P À1.99 0.27 E284K À2.34 0.34 K776N À3.53 0.63 Y482C À4.21 0.77 V825I À1.06 0.13 R587W À6.04 0.95 I883M À1.38 0.17 W590S À5.19 0.9 E1172D À1.96 0.26 W590L À4.48 0.82 R1587K À0.58 0.08 Q597R À7.15 0.98 S1731C À4.21 0.77 T929I À4.29 0.78 N935H À8.54 1 N935S À7.53 0.99 A937V À6.6 0.97 A1046D À7.52 0.99 M1091T À3.56 0.64 D1099Y À6.09 0.96 D1289N À2.48 0.37 L1379F À3.81 0.69 C1477R À5.44 0.92 S1506L À5.17 0.9 N1611D À5.69 0.94 R1680W À6.02 0.95 V1704D À3.21 0.55 N1800H À4.23 0.77 R1901S À5.06 0.89 F2009S À2.73 0.43 R2081W À8.08 0.99 P2150L À2.88 0.47 Q2196H À2.74 0.43 DOI: 10.1371/journal.pgen.0010083.t001 PLoS Genetics | www.plosgenetics.org December 2005 | Volume 1 | Issue 6 | e83 0740 Accurate Prediction of ABCA1 Variants Synopsis A major goal of human genetics research is to understand how genetic variation leads to differences in the function of genes. Login to comment
58 The ABCA1 cSNP, S1731C, has a subPSEC score of less than À3, predictive of a deleterious effect on ABCA1 function. Login to comment
59 Cells transfected with the S1731C allele displayed a significant reduction in cholesterol efflux, relative to wild-type ABCA1 (p , 0.01), indicating that this SNP significantly impairs ABCA1 function, as predicted by PANTHER. Login to comment
60 These data indicate that S1731C may be a useful SNP to use as a functional marker in association studies. Login to comment
75 Cholesterol Efflux Values for 293 Cells Transfected with ABCA1 Variants and subPSEC and PolyPhen Predictions of the Functional Impact of these Variants Variant Variant Type subPSEC Cholesterol Efflux PolyPhen R2081W Mutation À8.08 21.1 6 21%* Probably damaging N935S Mutation À7.53 29.3 6 13%* Benign A1046D Mutation À7.52 16.8 6 7%* Possibly damaging Q597R Mutation À7.15 17.7 6 14%* Probably damaging R587W Mutation À6.04 31.7 6 33%* Probably damaging C1477R Mutation À5.44 20.5 6 10%* Probably damaging W590S Mutation À5.19 47.1 6 13%* Probably damaging S1506L Mutation À5.17 17.8 6 15%* Probably damaging T929I Mutation À4.29 69.9 6 11%* Possibly damaging N1800H Mutation À4.23 31.3 6 16%* Possibly damaging S1731C SNP À4.21 12.3 6 10%* Possibly damaging M1091T Mutation À3.56 6.9 6 20%* Probably damaging P2150L Mutation À2.88 88.4 6 21% Probably damaging V771M SNP À2.86 145.4 6 33% Benign D1289N Mutation À2.48 137.7 6 86% Benign I883M SNP À1.38 69.1 6 16%* Benign R219K SNP À0.57 103.7 6 21.05 Benign Wild-type - 0.0 100% - *p , 0.01 compared to wild-type ABCA1. Login to comment
110 DOI: 10.1371/journal.pgen.0010083.g003 Table 3. subPSEC Scores for ABCA1 Variants Described in a Cohort of Individuals with Low HDL Cholesterol from the General Population Variant subPSEC Score Macrophage Efflux PolyPhen D1706N À6.57 0.38a Possibly damaging C1477F À5.55 0.34a Probably damaging W590S À5.19 - Probably damaging H551D À4.99 0.32a Probably damaging P85L À4.62 0.8 Probably damaging W590L À4.48 0.31a Probably damaging N1800H À4.23 0.27a Possibly damaging R965C À4.22 0.59 Probably damaging S1731C À4.21 0.28a Possibly damaging A1670T À4.2 - Possibly damaging K401Q À4.2 - Benign T459P À4.11 0.28a Possibly damaging R638Q À4.08 - Possibly damaging L1026P À3.86 0.25a Benign T2073A À3.84 0.28a Possibly damaging E815G À3.53 - Probably damaging R1615Q À3.45 - Possibly damaging S1181F À3.44 - Possibly damaging R306H À3.31 - Benign E1386Q À2.44 0.51 Benign S1376G À2.19 - Benign R1341T À2.09 - Possibly damaging D2243E À1.6 - Benign P248A À0.18 - Benign a Efflux value is 2 SDs or more below control levels of 0.52 6 0.07. Login to comment
120 One ABCA1 cSNP, S1731C, had a subPSEC score less than À3. Login to comment
122 Individuals carrying both the 2144X mutation and S1731C had significantly lower HDL cholesterol than individuals with only the 2144X mutation, although the number of patients in each group was small [10]. Login to comment
123 Cells transfected with the S1731C allele expressed ABCA1 mRNA at levels comparable to wild-type ABCA1; however, this cell line expressed low levels of ABCA1 protein and was markedly deficient in cholesterol efflux. Login to comment
126 The identification of S1731C as a functionally significant variant indicates that it may be a useful DNA marker to be used in association studies. Login to comment
238 Expression of the S1731C Allele in Polyclonal Stable Cell Lines ABCA1 protein (A) and mRNA (B) expression levels were determined in an untransfected control cell line, and cells transfected with wild-type ABCA1 or the S1731C variant. Login to comment
239 The cell line transfected with the S1731C allele expressed low levels of protein (A), but normal levels of mRNA (B), indicating that this variant impairs ABCA1 function by inhibiting the generation of a stable protein. Login to comment

PMID: 12763760 [PubMed] Singaraja RR et al: "Efflux and atherosclerosis: the clinical and biochemical impact of variations in the ABCA1 gene."

No. Sentence Comment

136 Single Nucleotide Polymorphisms in the ABCA1 Gene Nucleotide Amino Acid Exon -1095A/G Promoter ⅐ ⅐ ⅐ -477C/T Promoter ⅐ ⅐ ⅐ -419A/C Promoter ⅐ ⅐ ⅐ -320G/C Promoter ⅐ ⅐ ⅐ -191G/C Promoter ⅐ ⅐ ⅐ C69T 5ЈUTR 1 C117G 5ЈUTR 1 InsG319 5ЈUTR 2 G378C 5ЈUTR 2 G1051A R219K 7 T1591C V399A 11 G2706A V771M 16 A2715C T774P 16 G2723C K776N 16 G2826A V825I 17 A3044G I883M 18 G3911C E1172D 24 G5255A R1587K 35 C5587G S1731C 38 markers, namely, increased arterial wall thickness and ABCA1-mediated cholesterol efflux, was performed.73 The study group consisted of 30 individuals heterozygous for 4 different missense mutations in the ABCA1 gene, C1477R, M1091T, P2150L, and T929I. Login to comment
148 In TABLE 4. Conservation of Amino Acids Polymorphic in Humans cSNP H. sapiens M. musculus G. gallus D. melanogaster C. elegans R219K R R K ⅐ ⅐ ⅐ L V399A V V V A I V771M V V V L Y T774P T S S S G K776N K K K K R V825I V V A M L I883M I V P R A E1172D E E E ⅐ ⅐ ⅐ ⅐ ⅐ ⅐ R1587K R K K E V S1731C S S S T H Five of 10 (50%) amino acids at which cSNPs occur are conserved with G. gallus, indicating a relatively less crucial functional role of these residues compared with those at which mutations occur (Figure 2). Login to comment
128 Single Nucleotide Polymorphisms in the ABCA1 Gene Nucleotide Amino Acid Exon afa;1095A/G Promoter ዼ ዼ ዼ afa;477C/T Promoter ዼ ዼ ዼ afa;419A/C Promoter ዼ ዼ ዼ afa;320G/C Promoter ዼ ዼ ዼ afa;191G/C Promoter ዼ ዼ ዼ C69T 5b18;UTR 1 C117G 5b18;UTR 1 InsG319 5b18;UTR 2 G378C 5b18;UTR 2 G1051A R219K 7 T1591C V399A 11 G2706A V771M 16 A2715C T774P 16 G2723C K776N 16 G2826A V825I 17 A3044G I883M 18 G3911C E1172D 24 G5255A R1587K 35 C5587G S1731C 38 Singaraja et al Clinical and Biochemical Impact of ABCA1 Variants markers, namely, increased arterial wall thickness and ABCA1-mediated cholesterol efflux, was performed.73 The study group consisted of 30 individuals heterozygous for 4 different missense mutations in the ABCA1 gene, C1477R, M1091T, P2150L, and T929I. Login to comment
140 In TABLE 4. Conservation of Amino Acids Polymorphic in Humans cSNP H. sapiens M. musculus G. gallus D. melanogaster C. elegans R219K R R K ዼ ዼ ዼ L V399A V V V A I V771M V V V L Y T774P T S S S G K776N K K K K R V825I V V A M L I883M I V P R A E1172D E E E ዼ ዼ ዼ ዼ ዼ ዼ R1587K R K K E V S1731C S S S T H Five of 10 (50%) amino acids at which cSNPs occur are conserved with G. gallus, indicating a relatively less crucial functional role of these residues compared with those at which mutations occur (Figure 2). Login to comment

PMID: 12840658 [PubMed] Miller M et al: "Genetics of HDL regulation in humans."

No. Sentence Comment

67 TD 3` deletion (intron 38) truncated truncation [61] 5587 C/G 38 S1731C extracellular [68] TD 5793 A/C 40 N1800H extracellular loop, sm [65] FHA 5946 C/T 41 R1851X truncation [75..] FHA 6068 del 42 del 1893-1894(E,D) cytoplasmic [63] TD 6152 (14bp Ins) (42-43) truncated truncation [67] 6316 A/G 44 K1974R cytoplasmic [67] 6421 T/C 45 F2009S cytoplasmic [9] TD 6636 C/T 47 R2081W cytoplasmic [64] FHA 6825 C/T 49 R2144X cytoplasmic [63] TD 6825 del C 49 2145X truncation [62] FHA 6844 C/T 49 P2150L cytoplasmic [62] 6898 C/T 49 P2168L cytoplasmic [67] TD CTC6952-4TT 49 2203X truncation [62] TD 6968 (4bp Ins) 49 2215X, truncated PDZ binding (cyto) [65] *Location in accordance with Santamaria-Fojo et al. (Proc Natl Acad Sci U S A 2000; 97:7987-7992). Login to comment

PMID: 11238261 [PubMed] Clee SM et al: "Common genetic variation in ABCA1 is associated with altered lipoprotein levels and a modified risk for coronary artery disease."

No. Sentence Comment

48 Methods for Restriction Fragment Length Polymorphism Screening of ABCA1 cSNPs Variant pmol of Each Oligo Forward Oligo (5Ј33Ј)* Reverse Oligo (5Ј33Ј)* Annealing Temperature, °C Enzyme Product, bp Wild-type Allele Variant Allele % Agarose Gel for Resolution G1051A 20 GTATTTTTGCAAGGCTACCAGTTACATTTGACAA 60 EcoN I 177 1.5 (R219K) GATTGGCTTCAGGATGTCCATGTTGGAA 107, 70 T1591C 27.5 GCTGCTGTGATGGGGTATCT 57 Hph I 117, 103, 48, 33 1.5 (V399A) ACCTCACTCACACCTGGGAA 220, 48, 33 G2706A 27.5 CAAGTGAGTGCTTGGGATTG 57 BsaA I 98, 252 2 (V771M) TGCTTTTATTCAGGGACTCCA 350 A2715C 27.5 GTGATCCCAGCGTGGTGTTTGTCTT 55 Hph I 56, 69, 95 2 (T774P) GAAAGGCCAGAGGTACTCACAGCGAAGATCTTGAGGG 56, 161 G2723C 12 TCGTTTTATTCAGGGACTCCA 55 Bgl II 269, 80 2 (K776N) CAAGTGAGTGCTTGGGATTG 349 G2868A 27.5 CCCATGCACTGCAGAGATTC 57 Bsa I 149, 237 2 (V825I) GCAAATTCAAATTTCTCCAGG 386 A3044G 27.5 GAGAAGAGCCACCCTGGTTCCAACCAGAAGAGGAT 55 EcoR V 94, 35 2.5 (I883M) AAGGCAGGAGACATCGCTT 129 G3911C 27.5 GAGCAGTTCTGATGCTGGCCTGGGCAGCGACCACGA 55 BssS I 104, 37 2 (E1172D) TCTGCACCTCTCCTCCTCTG 141 G5155A 27.5 CAGCTTGGGAAGATTTATGACAGGACTGGACACGA 55 BssS I 114, 31 2 (R1587K) ATGCCCCTGCCAACTTAC 145 C5587G 20 GTGCAATTACGTTGTCCCTGCCACACT 60 Mnl I 82, 35 3 (S1731C) CCATACAGCAAAAGTAGAAGGGCTAGCACA 117 *Bold indicates mismatch in oligo to create restriction site. Login to comment
85 Frequencies of ABCA1 cSNPs Nucleotide Change Amino Acid Change Exon REGRESS Carrier Frequency Allele Frequency n* Nonsynonymous G1051A R219K 7 46.3 0.254 1588 T1591C V399A 11 1.6 0.008 1098 G2706A V771M 16 5.8 0.029 1270 A2715C T774P 16 0.6 0.003 1250 G2723C K776N 16 0.5 0.003 1106 G2868A V825I 17 15.7 0.081 1364 A3044G I883M 18 23.8 0.136 840 G3911C E1172D 24 5.3 0.026 1288 G5155A R1587K 35 44.3 0.259 1566 C5587G† S1731C 38 0 0 558 Synonymous From sequencing G869A None 6 62.5 0.38 32 C1331T None 9 31.3 0.19 32 G1343A None 9 25 0.133 32 T3554G None 22 12.5 0.059 32 G4676A None 30 6.3 0.06 32 C6842T None 49 6.3 0.033 32 *Number of alleles screened. Login to comment
136 However, all but 2 carriers of V771M were also carriers of R219K. Login to comment
138 No carriers of S1731C were detected in the REGRESS population. Login to comment
141 In unaffected family members, although carriers of S1731C (nϭ6) had slightly lower HDL-C compared with noncarriers (nϭ14, 1.03Ϯ0.22 versus 1.09Ϯ0.23 mmol/L), the difference was not statistically significant. Login to comment
43 Methods for Restriction Fragment Length Polymorphism Screening of ABCA1 cSNPs Variant pmol of Each Oligo Forward Oligo (5b18;33b18;)* Reverse Oligo (5b18;33b18;)* Annealing Temperature, &#b0;C Enzyme Product, bp Wild-type Allele Variant Allele % Agarose Gel for Resolution G1051A 20 GTATTTTTGCAAGGCTACCAGTTACATTTGACAA 60 EcoN I 177 1.5 (R219K) GATTGGCTTCAGGATGTCCATGTTGGAA 107, 70 T1591C 27.5 GCTGCTGTGATGGGGTATCT 57 Hph I 117, 103, 48, 33 1.5 (V399A) ACCTCACTCACACCTGGGAA 220, 48, 33 G2706A 27.5 CAAGTGAGTGCTTGGGATTG 57 BsaA I 98, 252 2 (V771M) TGCTTTTATTCAGGGACTCCA 350 A2715C 27.5 GTGATCCCAGCGTGGTGTTTGTCTT 55 Hph I 56, 69, 95 2 (T774P) GAAAGGCCAGAGGTACTCACAGCGAAGATCTTGAGGG 56, 161 G2723C 12 TCGTTTTATTCAGGGACTCCA 55 Bgl II 269, 80 2 (K776N) CAAGTGAGTGCTTGGGATTG 349 G2868A 27.5 CCCATGCACTGCAGAGATTC 57 Bsa I 149, 237 2 (V825I) GCAAATTCAAATTTCTCCAGG 386 A3044G 27.5 GAGAAGAGCCACCCTGGTTCCAACCAGAAGAGGAT 55 EcoR V 94, 35 2.5 (I883M) AAGGCAGGAGACATCGCTT 129 G3911C 27.5 GAGCAGTTCTGATGCTGGCCTGGGCAGCGACCACGA 55 BssS I 104, 37 2 (E1172D) TCTGCACCTCTCCTCCTCTG 141 G5155A 27.5 CAGCTTGGGAAGATTTATGACAGGACTGGACACGA 55 BssS I 114, 31 2 (R1587K) ATGCCCCTGCCAACTTAC 145 C5587G 20 GTGCAATTACGTTGTCCCTGCCACACT 60 Mnl I 82, 35 3 (S1731C) CCATACAGCAAAAGTAGAAGGGCTAGCACA 117 *Bold indicates mismatch in oligo to create restriction site. Login to comment
80 Frequencies of ABCA1 cSNPs Nucleotide Change Amino Acid Change Exon REGRESS Carrier Frequency Allele Frequency n* Nonsynonymous G1051A R219K 7 46.3 0.254 1588 T1591C V399A 11 1.6 0.008 1098 G2706A V771M 16 5.8 0.029 1270 A2715C T774P 16 0.6 0.003 1250 G2723C K776N 16 0.5 0.003 1106 G2868A V825I 17 15.7 0.081 1364 A3044G I883M 18 23.8 0.136 840 G3911C E1172D 24 5.3 0.026 1288 G5155A R1587K 35 44.3 0.259 1566 C5587Gߤ S1731C 38 0 0 558 Synonymous From sequencing G869A None 6 62.5 0.38 32 C1331T None 9 31.3 0.19 32 G1343A None 9 25 0.133 32 T3554G None 22 12.5 0.059 32 G4676A None 30 6.3 0.06 32 C6842T None 49 6.3 0.033 32 *Number of alleles screened. Login to comment
133 No carriers of S1731C were detected in the REGRESS population. Login to comment