ABCB11 p.Glu297Lys
[switch to full view]Comments [show]
None has been submitted yet.
    
                    
                        PMID: 19101985
                    
                    
                        [PubMed]
                    
                    Byrne JA et al: "Missense mutations and single nucleotide polymorphisms in ABCB11 impair bile salt export pump processing and function or disrupt pre-messenger RNA splicing."
                
                
                    No.
                    Sentence
                    Comment
                
                    
                        67
                        
                            ABCB11 Missense Mutations and SNPs Functionally Analyzed in This Study Exon Nucleotide Change Predicted Protein Effect Location in Protein Associated Phenotype Prevalence or Frequency* Any Defect(s) Identified Reference 4 c.149TϾC L50S NH2 term PFIC 1 family (het) Immature protein 31 5 c.270TϾC F90F EC1 SNP 2.7%-7.7% 43, 45 6 c.403GϾA E135K EC1 BRIC 1 family (het) Reduced levels of mature protein † 6 c.409GϾA E137K EC1 BRIC / ICP 1 family (het) Immature protein ‡ 7 c.500CϾT A167V TM2 PFIC 1 family (hom) Mild exon skipping beta 7 c.557AϾG E186G IC1 BRIC 2 families (both het) Moderate exon skipping; greatly reduced levels of mature protein 8, 37 7 c.580TϾC S194P IC1 SNP-PSC 1.1% 43 7 c.593TϾC L198P IC1 BRIC / ICP / DC 1 family (het) Greatly reduced levels of mature protein # 8 c.713GϾT G238V EC2 PFIC 1 family (hom) 29 8 c.725CϾT T242I TM4 PFIC 1 family (het) 31 8 c.779GϾA G260D TM4 SNP-PBC 0.8% 43 9 c.850GϾC V284L IC2 PFIC 1 family (het) No protein 28 9 c.851TϾC V284A IC2 SNP 0.5% Increased levels of mature protein 43, 45† 9 c.889GϾA E297K IC2 Prolonged NNH 1 family (het) Moderate differential splicing; immature protein ‡ 9 c. 890AϾG E297G IC2 PFIC, BRIC PFIC, 45 families (14 hom, 31 het) BRIC, 4 families (2 hom, 2 het) Greatly reduced levels of mature protein 7, 8, 12, 29-32, 35 10 c.936GϾT Q312H IC2 PFIC 1 family (het) ‡ 10 c.937CϾA R313S IC2 PFIC 1 family (het) 31 10 c.957AϾG G319G TM5 SNP 1.5 - 7.5% Mild exon skipping 42, 43, 45 10 c.980GϾA G327E TM5 PFIC 1 family (het) 31 10 c.1007GϾC C336S TM5 PFIC 1 family (het) 29 11 c.1168GϾC A390P NBF PFIC, BRIC 2 families (both het) Immature protein 31; # 12 c.1129GϾA G410D NBF PFIC 1 family (het) 31 12 c.1238TϾG L413W NBF PFIC 1 family (het) Greatly reduced levels of mature protein 31 12 c.1244GϾA R415Q NBF SNP-ICP 1.3% 42 12 c.1295GϾC R432T NBF BRIC 1 family (het) Reduced levels of mature protein 12 13 c.1331CϾT A444V NBF SNP, ICP, CC, DC, BRIC 43-60% Increased levels of mature protein 8, 28, 37, 39-45 13 c.1381AϾG K461E WA PFIC 1 family (hom) Immature protein 7 13 c.1388CϾT T463I WA PFIC 1 family (het) Mild exon skipping 31 13 c.1396CϾA Q466K Adj WA PFIC 1 family (het) 31 13 c.1409GϾA R470Q Adj WA PFIC 2 families (1 het, 1 consanguineous) Immature protein 31 14 c.1442TϾA V481E NBF1 PFIC 1 family (het) 31 14 c.1445AϾG D482G NBF1 PFIC 22 families (16 het, 6 hom) Severe differential splicing; immature protein 7, 30-32 14 c.1468AϾG N490D NBF1 PFIC 1 family (het) Greatly reduced levels of mature protein; reduction in bile salt transport 31 14 c.1493TϾC I498T NBF1 PFIC / BRIC 1 family (het) 38 14 c.1530CϾA T510T NBF1 SNP-PBC 0.7% 43 14 c.1535TϾC I512T NBF1 PFIC 1 family (het) 31 14 c.1544AϾC N515T NBF1 PFIC 1 family (het) 31, 32 14 c.1440GϾA R517H NBF1 PFIC 1 family (het) No protein 31, 32 14 c.1605CϾT A535A NBF1 SNP 0.3% Slightly reduced levels mature protein 39, 45 14 c.1621AϾC I541L NBF1 PFIC 3 families (1 het, 2 consanguineous) No protein 31-33 15 c.1643TϾA F548Y Adj ABCm PFIC 1 family (het) 31, 32 15 c.1685GϾA G562D ABCm PFIC 1 family (het) 31 15 c.1708GϾA A570T Adj ABCm/WB PFIC, BRIC PFIC, 1 family Greatly reduced levels of mature protein; reduction in bile salt transport 8, 31   Table 1.
                                
                                X
                                    ABCB11 p.Glu297Lys 19101985:67:1153
                                        status: NEW93 Differential splice products were seen for six predicted ABCB11 missense mutations, leading to very low levels of wild-type splicing (indicated in parentheses): E297K (c.889GϾA; 50%; Fig. 2B), D482G (c.1445AϾG; 5%; Fig. 2C), R832C (c.2494CϾT; 50%; Fig. 2E), and S1144R (c.3432CϾA; 3%), R1153H (c.3458GϾA; 3%), and S1154P (c.3460TϾC; 3%; Fig. 2F).
X
                                    ABCB11 p.Glu297Lys 19101985:93:161
                                        status: NEW104 However, for the nucleotide change that results in E297K (c.889GϾA), the score for the cryptic donor splice site rises to 0.99, with the normal donor splice site being maintained at 0.62.
X
                                    ABCB11 p.Glu297Lys 19101985:104:51
                                        status: NEW105 Indeed, it can be seen that the normal and the cryptic splice sites are equally used by the E297K-containing exon 9 (Fig. 2B).
X
                                    ABCB11 p.Glu297Lys 19101985:105:92
                                        status: NEW106 Additional analysis of the exon 9 variant sequences to identify changes to ESE or ESS motifs was performed using RESCUE-ESE and ESE FINDER 2.0 or the FAS-ESS programme, respectively.47-49,52,53 An SC35 site was identified, which was maintained irrespective of which nucleotide form was analyzed, but the presence of sequence coding for either E297K or E297G resulted in the introduction of an ESS hexamer.
X
                                    ABCB11 p.Glu297Lys 19101985:106:343
                                        status: NEW111 Positive-acting and negative-act- Exon 14 D482G Aberrant product Exon 14Minigene Cryptic acceptor splice Exon 14 CTACCACCATTGCAGAAAATATTCGCTATG ATACCATCATCCCAGAAAATATTCGCTATG ATCTCTTTTCACCCAATTTCTACAGGGCAATGCTGGGGCAAGAT Exon 21Exon 20 R832C Aberrant product AAGGCTACGTAAATTTGGTTTCAGGGCAATGCTGGGGCAAGAT AAGGCTATGTAAATTTGGTTTCAGGGCAATGCTGGGGCAAGAT Exon 21 R832C Exon 21 Cryptic acceptor splice Exon 9 E297K Aberrant product CTGCTTTTGGTGGTGAGAAAAGAGAGGTTGAAAGgttggtta Normal donor splice siteCryptic donor splice site CTGCTTTTGGTGGTAAGAAAAGAGAGGTTGAAAGgttggttaE297K Exon 9 CTGCTTTTGGTGCTGTTCCTCCTCCCACTGACCTGCGATT MinigeneExon 9 Intron 9 Intron 9 S1144R, R1153H, S1154P Aberrant product Exon 26 ATACCATCATCCCAGGAACCAGTGTTGTTTGCCT Exon 26Minigene AATTGTTTCCCAGGAACCAGTGTTGTTTGCCTCAG Cryptic acceptor splice D Fig. 3.
X
                                    ABCB11 p.Glu297Lys 19101985:111:399
                                        status: NEW112 (A-D) Illustration of variant splice forms associated with ABCB11 mutations (A) E297K, (B) D482G, (C) R832C, and (D) S1144R, R1153H, and S1154P.
X
                                    ABCB11 p.Glu297Lys 19101985:112:80
                                        status: NEW122 Additionally, the differential splicing associated with E297K (c.889GϾA) was abolished on the addition of SC35, but on quantitative analysis was slightly enhanced with hnRNPA2 (2.5-fold) and hnRNPH (eightfold).
X
                                    ABCB11 p.Glu297Lys 19101985:122:56
                                        status: NEW154 The following mutations showed an enrichment of mature BSEP: R1153H (c.3458GϾA; Fig. 6B), R1128C (c.3382CϾT), R1128H (c.3383GϾA), R1231Q (c.3692GϾA), R1050C (c.3148CϾT; Fig. 6C) and R1268Q (c.3892GϾA), A570T (c.1708GϾA), and E297K (c.889GϾA; Fig. 6D).
X
                                    ABCB11 p.Glu297Lys 19101985:154:267
                                        status: NEW188 By contrast, the aberrant splice product associated with E297K (c.889GϾA) was completely abolished on addition of the splicing factor SC35, whereas higher levels of hnRNPA2 and hnRNPH had a negative effect on the normal splicing of E297K (Fig. 4A).
X
                                    ABCB11 p.Glu297Lys 19101985:188:57
                                        status: NEWX
                                    ABCB11 p.Glu297Lys 19101985:188:238
                                        status: NEW189 Therefore, the actual levels of positive and negative splicing factors in patients could potentially affect the levels of aberrant splicing associated with E297K in affected hepatocytes.
X
                                    ABCB11 p.Glu297Lys 19101985:189:156
                                        status: NEW191 Differences may be further exacerbated by the fact that the maturation of E297K protein can be modulated by conditions that facilitate protein folding by chaperones and thus increase protein release from the ER (Fig. 6D).
X
                                    ABCB11 p.Glu297Lys 19101985:191:74
                                        status: NEW194 If a patient`s allele contained the variant G as well as the nucleotide change resulting in E297K, for example, a double-negative effect on ABCB11 pre-mRNA splicing would be more severe.
X
                                    ABCB11 p.Glu297Lys 19101985:194:92
                                        status: NEW219 These include the PFIC-associated mutations E297G (c.890AϾG; Fig. 6A), R1128C (c.3382CϾT) and R1231Q (c.3692GϾA; Fig. 6C), and R1268Q (c.3892GϾA; Fig. 6.d), the BRIC-associated mutations R1128H (c.3383GϾA) and R1050C (c.3148CϾT; Fig. 6C), and E297K (c.889GϾA; Fig. 6D), as well as A570T (c.1708GϾA), which can be associated with either form of disease.
X
                                    ABCB11 p.Glu297Lys 19101985:219:279
                                        status: NEW
                    No.
                    Sentence
                    Comment
                
                    
                        185
                        
                            PFIC BRIC/NFC ICP Other liver diseases Genetic variants without disease association Missense mutations M1V C336S D549V L1055P E135K E137K T87R V43I S701P G19R W342G G556R C1083Y E137K L198P M123T S56L L712L L50S A382G G562D A1110E E186G E297G S194P Q121K A865D M62K R387H A570T S1114R L198P R415Q L198P R128H A865G C68Y A390P L581F G1116E E297G V444A G260D I206V S874P C107R G410D A588V G1116F G374S D482G E297K V284A I939M I112T L413W S593R G1116R A390P N591S V444A G295C R958Q W114R I420T I627T S1120N R432T T655I T510T G295R F959C Y157C D440E E636G R1128C V444A T655I G295S F959V A167T G455E R698C S1144R I498T D676Y R299K T965S A167V K461E S699P R1153C A570T P710P R303K F971L I182K T463I E709K R1153H T586I L827I L339V F971Y M183T Q466K G758R S1154P G648V G855R H423R L1006F M183V R470Q G766R N1173D T655I E1186K V444A N1009H G188W Y472C Y818F T1210P T923P V444D K1145N M217R V481E R832C N1211D A926P V444G I1183T R223C D482G R832H V1212F R948C A459V S226L R487H T859R R1231Q G1004D I468I G238V R487P A865V R1231W R1050C R487L T242I N490D Q869P L1242I G1116R Q546K A257G I498T G877R D1243G R1128H Q558H V284L G499E S901R R1268Q L1197G E592Q E297G I512T R948C A1283V R1231Q V597M R303G N515T N979D G1292V R616G R303K R517H G982R G1298R T619A Q312H F540L G1004D M677L R313S I541L T1029K M677V G327E I541T G1032R R696Q W330R F548Y A1044P R698H Nonsense mutations (premature stop-codons) S25X Y472X Y772X R1090X E96X W493X Q791X V1147X W330X R520X R928X Q1215X Y354X I528X Y1041X R1235X R415X R575X R1057X E1302X R470X Q702X Q1058X    Table 1 (Continued) PFIC BRIC/NFC ICP Other liver diseases Genetic variants without disease association Splice site mutations 76 + 3G > T 908 + 1delG 2178 + 1G > T 3057-2A > G Q159Q 77-1G > C 908 + 1G > T 2179-2A > G 3213 + 1delG Q361Q 99-1G > T 908 + 1G > A 2343 + 1G > T 3213 + 4A > G 150 + 3A > C 1435-13 -8del 2343 + 2T > C 3213 + 5G > A 390-1G > A 2012-8T > G 2611-2A > T 611 + 1G > A 2178 + 1G > A R1001R Deletions/insertions/frame shifts Q101Dfs8X L380Wfs18X G648Vfs5X Q1058Hfs38X F959Hfs1X T127Hfs6X A382 A388del K700Sfs12X I1061Vfs34X F959Gfs48X N199Ifs14X P456Pfs24X T919del L1165del L232Cfs9X H484Rfs5X K930Efs92X A1192Efs50X R303Sfs17X I528Sfs21X K930Efs79X T1256Tfs40X V368Rfs27X I610Qfs45X K969 K972del Synonymous variants without disease association R33R F90F L232L I416I G557G I876I A1028A K1145K D36D I134I Y269Y G418G V597V G937G K1070K R52R S136S Q312Q F427F A804A Y981Y T1086T D58D V195V G319G E395E A535A G817G G1004G A1110A The overview shows ࣈ 290 known variants of BSEP on the protein level, except splice site mutations, which are shown on cDNA level.
                                
                                X
                                    ABCB11 p.Glu297Lys 22795478:185:406
                                        status: NEW
                    No.
                    Sentence
                    Comment
                
                    
                        137
                        
                            BSEP/Bsep NTCP ASBT Exon skipping E186G G1116R G319G R1128C T463I R1128H A926P E1186K A1028Aa R1231W A1110E Aberrant splicing E297K R1153H R832C S1154P S1144R No splice product T586I R1231Q Reduced plasma membrane expression E135K A570T I223T E297Gb N591Sb V444A R1050C Intracellular retention Y818F G982R Reduced or absent bile salt transport A570T R432T A64T K314E V98Ic M264V I206V Q558H I223T C144Y P290S E297Gb N591Sb S267F L243P G374S E1186K I279T T262M a A1028A induces significant exon skipping in vitro but probably not in vivo (unpublished data; Dro &#a8;ge, Ha &#a8;ussinger, Kubitz).
                                
                                X
                                    ABCB11 p.Glu297Lys 25027376:137:126
                                        status: NEW