ABCC7 p.Asp924Glu
[switch to full view]Comments [show]
None has been submitted yet.
PMID: 19019984
[PubMed]
Pitonzo D et al: "Sequence-specific retention and regulated integration of a nascent membrane protein by the endoplasmic reticulum Sec61 translocon."
No.
Sentence
Comment
46
Mutants encoding D924E, D924R, and A923D/D924V as well as glycosylation mutants were generated by standard techniques using PCR overlap extension as described previously (Carveth et al., 2002) using the following sense (and corresponding antisense) oligonucleotides: GGGGCTAGCACTCATAGTAGAAATA- ACAG(N894A), CATTCTAGAGCGAACAGCTATGCAGTGATTAT(N900A), and GACAAAGGGGCTAGCACTCATTCTAGAGCGAAC(N894A/N900A).
X
ABCC7 p.Asp924Glu 19019984:46:17
status: NEW222 When Asp924 was converted to glutamate, D924E, nascent chains truncated at residue 977 also continued to cross-link Sec61␣ after puromycin treatment, albeit to a lesser extent than wild type (Figure 9, A and B).
X
ABCC7 p.Asp924Glu 19019984:222:5
status: NEWX
ABCC7 p.Asp924Glu 19019984:222:40
status: NEW