ABCC7 p.Leu101Cys

[switch to full view]
Comments [show]
Publications
PMID: 16236827 [PubMed] Weber GJ et al: "Mercury and zinc differentially inhibit shark and human CFTR orthologues: involvement of shark cysteine 102."
No. Sentence Comment
76 For each mutant, both fragments carrying the desired mutation were amplified in the first PCR step using flanking and mutation-carrying primers (mutation-carrying primer: L101C-sense AGTACAGCCTCTCTGC- CTGGGAAGAA; L101C-antisense TTCTTCCCAGGCAGAGAG- GCTGTACT; V302C-sense GCCTATTGCAGATACTTCAATAGC; V302C-antisense AAGTATCTGCAATAGGCTGCCTTCCG; flanking primer: SacII TGTAAAACGACGGCCAGTGAG; BstZ17 I GTATACTGCTCTTGCTAAAGA).
X
ABCC7 p.Leu101Cys 16236827:76:171
status: NEW
X
ABCC7 p.Leu101Cys 16236827:76:213
status: NEW
Login to comment

200 Because the h-sMSD1 chimera fully reproduced the mercury sensitivity of sCFTR, we next mutated single residues in hCFTR (L101C and V302C) to the corresponding cysteines (C102 and C303) present in MSD1 of sCFTR.
X
ABCC7 p.Leu101Cys 16236827:200:121
status: NEW
Login to comment