ABCC7 p.Arg516Lys
[switch to full view]Comments [show]
None has been submitted yet.
PMID: 15765539
[PubMed]
Amaral MD et al: "Processing of CFTR: traversing the cellular maze--how much CFTR needs to go through to avoid cystic fibrosis?"
No.
Sentence
Comment
50
Although the simultaneous substitution of all four arginines by lysine (K) residues (4RK: R29K þ R516K þ R555K þ R766K) causes F508del-CFTR to function about one-third as efficiently as wt-CFTR, individual R/K substitutions at some of these positions, i.e., R29K30 and R555K,31 were also described as restoring F508del-CFTR function.
X
ABCC7 p.Arg516Lys 15765539:50:102
status: NEW
PMID: 17098864
[PubMed]
Roxo-Rosa M et al: "Revertant mutants G550E and 4RK rescue cystic fibrosis mutants in the first nucleotide-binding domain of CFTR by different mechanisms."
No.
Sentence
Comment
0
Revertant mutants G550E and 4RK rescue cystic fibrosis mutants in the first nucleotide-binding domain of CFTR by different mechanisms Mo´ nica Roxo-Rosa*† , Zhe Xu‡ , Andre´ Schmidt*† , Ma´rio Neto*, Zhiwei Cai‡ , Cla´udio M. Soares§ , David N. Sheppard‡ , and Margarida D. Amaral*†¶ *Department of Chemistry and Biochemistry, Faculty of Sciences, University of Lisbon, Campo Grande, 1749-016 Lisbon, Portugal; †Centre of Human Genetics, National Institute of Health Dr. Ricardo Jorge, Avenida Padre Cruz, 1649-016 Lisbon, Portugal; ‡Department of Physiology, School of Medical Sciences, University of Bristol, Bristol BS8 1TD, United Kingdom; and §Institute of Chemistry and Biological Technology, New University of Lisbon, 2781-901 Oeiras, Portugal Communicated by Michael J. Welsh, University of Iowa College of Medicine, Iowa City, IA, September 22, 2006 (received for review June 9, 2006) The revertant mutations G550E and 4RK [the simultaneous mutation of four arginine-framed tripeptides (AFTs): R29K, R516K, R555K, and R766K] rescue the cell surface expression and function of F508del-cystic fibrosis (CF) transmembrane conductance regulator (-CFTR), the most common CF mutation.
X
ABCC7 p.Arg516Lys 17098864:0:1100
status: NEW22 Moreover, Chang et al. (25) rescued the trafficking and function of F508del-CFTR with the simultaneous mutation of the four arginine-framed tripeptides (AFTs) (R29QR31, R516YR518, R553AR555, and R764RR766) present in CFTR termed 4RK (R29K, R516K, R555K, and R766K).
X
ABCC7 p.Arg516Lys 17098864:22:240
status: NEW
No.
Sentence
Comment
186
Replacement of critical Arg with Lys residues in the MSD1 (R29K) and NBD1 (R516K and R555K) failed to revert the processing defect of M1(RK) and M1-N1(3RK) (Supplemental Figure S5), whereas it partially rescued the ⌬F508 CFTR ER retention (Owsianik et al., 2003; Roxo-Rosa et al., 2006).
X
ABCC7 p.Arg516Lys 19176754:186:75
status: NEW
PMID: 21182301
[PubMed]
Loo TW et al: "The W232R suppressor mutation promotes maturation of a truncation mutant lacking both nucleotide-binding domains and restores interdomain assembly and activity of P-glycoprotein processing mutants."
No.
Sentence
Comment
121
Suppressor mutations can rescueΔF508-CFTRbya variety ofmechanisms.Examplesinclude removal of the ER retention signals (arginine-framed trafficking motif mutations; R29K, R516K, R555K, and R766K) (61, 62), introduction of a combination of CFTR suppressor mutations (F949/Q637R or F29S/F494N/Q637R) that increase solubility of NBD1(63),orintroductionofsuppressormutationssuchasV510D (TMD1) (64) and R1070W(TMD2) (65) that restore NBD1-TMD2 interactions.
X
ABCC7 p.Arg516Lys 21182301:121:176
status: NEW
PMID: 18215773
[PubMed]
Pissarra LS et al: "Solubilizing mutations used to crystallize one CFTR domain attenuate the trafficking and channel defects caused by the major cystic fibrosis mutation."
No.
Sentence
Comment
155
Comparison with Other Revertants Using the same cellular system employed to investigate the solubilizing mutations, we recently examined the mechanism of action of two other F508del-CFTR revertants, G550E and 4RK, the simultaneous mutation of four arginine-framed tripeptides (AFTs), R29K, R516K, R555K, and R766K (Roxo-Rosa et al., 2006).
X
ABCC7 p.Arg516Lys 18215773:155:290
status: NEW
PMID: 10445036
[PubMed]
Chang XB et al: "Removal of multiple arginine-framed trafficking signals overcomes misprocessing of delta F508 CFTR present in most patients with cystic fibrosis."
No.
Sentence
Comment
40
This band remains prominent in 3 of the 4 R→K variants (R516K, R555K, and R766K; lanes 9, 10, and 11 respectively) but not in R29K (lane 8) or in 4RK (lane 12).
X
ABCC7 p.Arg516Lys 10445036:40:63
status: NEW81 There was no detectable in- is enabled by the release from ER retention when thecrease in efflux rate from cells expressing ⌬F508 CFTR AFTs are inactivated.alone or with the R516K, R555K, or R766K mutation.
X
ABCC7 p.Arg516Lys 10445036:81:181
status: NEW127 The following oligonu-peptides contributing to an individual PKA-activated cleotides were used to introduce R29K, R516K, R555K, and R766K chloride channel has not been firmly established (Mar- into wild-type CFTR cDNA.
X
ABCC7 p.Arg516Lys 10445036:127:114
status: NEW129 Hence, it is not CAGCGCCTGGAATTGTCAG and CTGACAATTCCAGGCGCTGTTT yet possible to know whether the AFTs may be "tucked- GTATCCTTTCCTCAAAATTG; R516K, CCTATGATGAATATAAATAC in" on maturation as a consequence of intramolecular AGAAGCCTCATC and GATGACGCTTCTGTATTTATATTCATCAT AGG; R555K, GGAGGTCAACGAGCAAAAATTTCTTTAGCAAGAGinteractions between domains of a single channel- and CTCTTGCTAAAGAAATTTTTGCTCGTTGACCTCC; and R766K,forming CFTR polypeptide or are due to intermolecular CTTCAGGCACGAAGGAAGCAGTCTCTCCTGAACC and GGTTCAGassociations between two or more pore-forming CFTR GACAGACTGCTTCCTTCGTGCTGAAG.
X
ABCC7 p.Arg516Lys 10445036:129:140
status: NEW41 This band remains prominent in 3 of the 4 RK variants (R516K, R555K, and R766K; lanes 9, 10, and 11 respectively) but not in R29K (lane 8) or in 4RK (lane 12).
X
ABCC7 p.Arg516Lys 10445036:41:62
status: NEW84 alone or with the R516K, R555K, or R766K mutation.
X
ABCC7 p.Arg516Lys 10445036:84:18
status: NEW130 The following oligonu- peptides contributing to an individual PKA-activated cleotides were used to introduce R29K, R516K, R555K, and R766K chloride channel has not been firmly established (Mar- into wild-type CFTR cDNA.
X
ABCC7 p.Arg516Lys 10445036:130:115
status: NEW132 Hence, it is not CAGCGCCTGGAATTGTCAG and CTGACAATTCCAGGCGCTGTTT yet possible to know whether the AFTs may be "tucked- GTATCCTTTCCTCAAAATTG; R516K, CCTATGATGAATATAAATAC in" on maturation as a consequence of intramolecular AGAAGCCTCATC and GATGACGCTTCTGTATTTATATTCATCAT AGG; R555K, GGAGGTCAACGAGCAAAAATTTCTTTAGCAAGAG interactions between domains of a single channel- and CTCTTGCTAAAGAAATTTTTGCTCGTTGACCTCC; and R766K, forming CFTR polypeptide or are due to intermolecular CTTCAGGCACGAAGGAAGCAGTCTCTCCTGAACC and GGTTCAG associations between two or more pore-forming CFTR GACAGACTGCTTCCTTCGTGCTGAAG.
X
ABCC7 p.Arg516Lys 10445036:132:140
status: NEW
PMID: 14596935
[PubMed]
Owsianik G et al: "Rescue of functional DeltaF508-CFTR channels by co-expression with truncated CFTR constructs in COS-1 cells."
No.
Sentence
Comment
33
The base pair substitutions (underlined) were introduced using following oligonucleotides: for R29K mutation: 5P-GAAAGGATACAAACAGC- GCCTGGA (sense) and 5P-TCCAGGCGCTGTTTGTATCCTTTC (antisense); for R516K mutation: 5P-CTATGATGAATATAAATA- CAGAAGCGTC (sense) and 5P-GACGCTTCTGTATTTATATTC- ATCATAG (antisense); for R555K mutation: 5P-GGTCAACGAG- CAAAAATTTCTTTAGC (sense) and 5P-GCTAAAGAAATTTT- TGCTCGTTGACC (antisense).
X
ABCC7 p.Arg516Lys 14596935:33:197
status: NEW93 Co-expression of vF508-CFTR with mutated constructs, possessing R516K and R555K mutations either alone or in combination, led to an about two-fold decrease of vF508-CFTR-dependent current when compared to cells that co-expressed vF508-CFTR and WF2 (Table 1).
X
ABCC7 p.Arg516Lys 14596935:93:64
status: NEW133 Arginine-to- lysine mutation in NBD1`s RXRs of truncated CFTR constructs (R516K and R555K mutations) strongly impairs their vF508-CFTR rescue properties.
X
ABCC7 p.Arg516Lys 14596935:133:74
status: NEW
PMID: 23890012
[PubMed]
Farinha CM et al: "Revertants, low temperature, and correctors reveal the mechanism of F508del-CFTR rescue by VX-809 and suggest multiple agents for full correction."
No.
Sentence
Comment
214
Although 4RK can also be claimed to impact on F508del-CFTR folding (namely, through its two NBD1 changes: R516K and especially R555K), this is somewhat disproven by the additive effects of 4RK with G550E (Figure 4), the latter truly correcting F508del-NBD1 folding, as assessed by channel gating (Farinha and Amaral, 2005; Rosser et al., 2008; Roxo-Rosa et al., 2006).
X
ABCC7 p.Arg516Lys 23890012:214:106
status: NEW231 EXPERIMENTAL PROCEDURES Cells and Culture Conditions BHK cell lines expressing F508del-4RK (R29K/R516K/R555K/R716K)-, F508del-G550E-, F508del-R1070W-, F508del-V510D-, F508del-R555K-, F508del-V510D/G550E-, F508del-G550E/R1070W-, DAA (D567A)-, 4RK- DAA-, DD/AA (D565A, D567A)-, 4RK-DD/AA-, and R560T-CFTR were produced and cultured as previously described (Roxo-Rosa et al., 2006).
X
ABCC7 p.Arg516Lys 23890012:231:97
status: NEW