ABCMdb

ABCC7 p.Lys95Ala

None has been submitted yet.

Publications

PMID: 15634668 [PubMed] Linsdell P et al: "Location of a common inhibitor binding site in the cytoplasmic vestibule of the cystic fibrosis transmembrane conductance regulator chloride channel pore."

No. Sentence Comment

91 These results, using a number of different amino acid substitutions of Lys-95, strongly suggest that side chain charge at this position is important in controlling the apparent affinity of glibenclamide block; the apparent Kd at -100 mV was not affected in the charge-conservative K95R but was significantly increased in charge-neutralizing mutants (K95A, K95C, K95Q) and most strongly increased in the charge-reversing K95E mutant. Login to comment

PMID: 16977321 [PubMed] Carlson EJ et al: "p97 functions as an auxiliary factor to facilitate TM domain extraction during CFTR ER-associated degradation."

No. Sentence Comment

133 The TM1-2 E92A/K95A mutations had a striking effect, decreasing the initial degradation rate by B2.5-fold (0.2870.03/min) in the presence of p97 (Figure 6E and F), and further decreasing the degradation rate by an additional 2.3-fold following p97 depletion (0.1270.01/min). Login to comment
160 (B) Carbonate extraction of wild-type and E92A/K95A polypeptides. Login to comment
179 This also held true in the absence of p97 where the degradation rate of isolated NBD1 and NBD1-R domains was significantly faster than TMD1 and TM12(E92A/K95A). Login to comment
205 deg. rate -p97 (%/min) %increasewithp97 CFTR TMD1 TM1-2wt NBD-R NBD140 80 120 0 160 TM1-2 (E92A/K95A ) Figure 8 P97 effect is inversely related to the rate of degradation. Login to comment
221 Thus, p97 may play a key role in stimulating TM1-2 E92A/K95A degradation by providing a second step for substrate partitioning, thereby generating a locally unfolded domain that preferentially engages the AAA-ATPase ring of the 19S RC. Login to comment
237 Before pelleting, TM1-2 E92A/K95A was released from ribosomes by addition of 1 mM puromycin. Login to comment

PMID: 9417117 [PubMed] Lu Y et al: "Co- and posttranslational translocation mechanisms direct cystic fibrosis transmembrane conductance regulator N terminus transmembrane assembly."

No. Sentence Comment

8 Mutating charged residues Glu92 and Lys95 to alanine improved TM1 signal sequence activity as well as the ability of TM1 to independently direct CFTR N terminus topology. Login to comment
41 MATERIALS AND METHODS cDNA Construction-E92A and K95A mutations were engineered into CFTR by site-directed mutagenesis using a single stranded (M-13) (plasmid pBQ 4.7) template and oligonucleotides TATATTTAGGCGCCGTCAC- CAAAGCAGT and GAAGTCACCGCTGCAGTACAGCCT as described (33). Login to comment
42 AvaI/XbaI fragments containing the engineered mutations were then ligated into an AvaI/XbaI-digested pSPCFTR vector (34), generating plasmids pSPCFTR(E92A) and pSPCFTR(K95A). Login to comment
43 Plasmid pSPCFTR(E92A/ K95A) was generated by PCR amplification of pSPCFTR(E92A) (sense primer (SP6 promoter) ATTTAGGTGACACTATAG, and antisense primer TACTGCAGCGGTGACGGCGCCTAA), digestion of the PCR fragment with AvaI/PstI (PstI encoded in antisense oligonucleotides) and ligation of the fragment into an AvaI/PstI digested pSPCFTRK95A vector. Plasmids pSPCFTR(G85E) and pSPCFTR(G91R) are described elsewhere (33). Login to comment
53 Similarly, plasmids TM1-2.P containing E92A/K95A mutations together with (a) E115K/E116K, (b) E116K/G126D, or (c) E115K/E116K/G126D were generated by PCR overlap extension using the following strategies: (a) primer 3 (pSPCFTR(E92A/ K95A) template); (b) primer 2 and (5Ј template pSPCFTR(E92A/K95A) and 3Ј template pSPCFTR(G126D); (c) primer 3 (5Ј template pSPCFTR(E92A/ K95A) 3Ј template pSPCFTR(G126D)). Login to comment
88 We therefore examined translocation efficiency of polypeptides generated from plasmids TM1.P(E92A), TM1.P(K95A) and TM1.P(E92A/K95A). Login to comment
89 As shown in Fig. 1A, lanes 10-18, the E92A and E92A/K95A mutations both improved TM1 signal sequence activity (43% and 79% of P translocated, respectively), whereas the K95A mutation by itself had little effect (10% of P translocated). Login to comment
95 Plasmids TM1.P, TM1.P(G85E), TM1.P(G91R), TM1.P(E92A), TM1.P(K95A), and TM1.P- (E92A/K95A) were expressed in rabbit reticulocyte lysate supplemented with canine pancreas microsomal membranes (A) or in microinjected Xenopus oocytes (B) as described under "Materials and Methods." Login to comment
103 located); (ii) G85E and G91R mutations essentially abolished TM1 signal sequence activity (Ͻ5% of chains translocated); and (iii) E92A and E92A/K95A mutations improved TM1 signal sequence activity (36% and 70% of chains translocated, respectively). Login to comment
158 This conclusion was further supported by the observation that improving TM1 signal sequence activity using the mutant E92A/ K95A completely restored N terminus translocation in TM2 mutants (Fig. 5). Login to comment
161 Furthermore, even an efficient TM1 signal sequence (E92A/K95A) restored translocation efficiency to only 69% of WT levels. Login to comment
234 Consistent with this view, we observed that full-length CFTR encoding E92A or the double mutation, E92A/ K95A, exhibited markedly reduced chloride channel activity when expressed in Xenopus oocytes.3 In addition, scanning cysteine accessibility studies have revealed that Lys95 resides on a hydrophilic surface of TM1 and likely faces the CFTR chloride channel pore, whereas Glu92 appears to face 40° away from the pore surface, suggesting that it contributes to ionic interactions within the plane of the bilayer (67). Login to comment
54 Similarly, plasmids TM12.P containing E92A/K95A mutations together with (a) E115K/E116K, (b) E116K/G126D, or (c) E115K/E116K/G126D were generated by PCR overlap extension using the following strategies: (a) primer 3 (pSPCFTR(E92A/ K95A) template); (b) primer 2 and (59 template pSPCFTR(E92A/K95A) and 39 template pSPCFTR(G126D); (c) primer 3 (59 template pSPCFTR(E92A/ K95A) 39 template pSPCFTR(G126D)). Login to comment
90 As shown in Fig. 1A, lanes 10-18, the E92A and E92A/K95A mutations both improved TM1 signal sequence activity (43% and 79% of P translocated, respectively), whereas the K95A mutation by itself had little effect (10% of P translocated). Login to comment
96 Plasmids TM1.P, TM1.P(G85E), TM1.P(G91R), TM1.P(E92A), TM1.P(K95A), and TM1.P- (E92A/K95A) were expressed in rabbit reticulocyte lysate supplemented with canine pancreas microsomal membranes (A) or in microinjected Xenopus oocytes (B) as described under "Materials and Methods." Login to comment
104 located); (ii) G85E and G91R mutations essentially abolished TM1 signal sequence activity (,5% of chains translocated); and (iii) E92A and E92A/K95A mutations improved TM1 signal sequence activity (36% and 70% of chains translocated, respectively). Login to comment

PMID: 23248597 [PubMed] Kim SJ et al: "Mechanisms of CFTR Folding at the Endoplasmic Reticulum."

No. Sentence Comment

110 For example, replacement of ionizable residues in TM1 (E92A and K95A) converts TM1 to a strong signal anchor sequence, thus favoring cotranslational topogenesis, but disrupts CFTR function (Lu et al., 1998; Patrick et al., 2011). Login to comment