ABCC1 p.Gly1161Pro

[switch to full view]
Comments [show]
Publications
PMID: 16861249 [PubMed] Ren XQ et al: "A functional role of intracellular loops of human multidrug resistance protein 1."
No. Sentence Comment
44 The strategies employed for site-directed mutagenesis of E507L/G511P and E1157L/G1161P in MRP1 cDNA were previously described (10).
X
ABCC1 p.Gly1161Pro 16861249:44:80
status: NEW
Login to comment

46 We also used a pair of forward and reverse primers to generate E1157L/ G1161P mutations.
X
ABCC1 p.Gly1161Pro 16861249:46:71
status: NEW
Login to comment

47 The primers were: Forward: 50 TTGC- TGCCGGTCAGCGTCATTCGA30 , and reverse: 50 GGTC- AAGTTGAAATGGGAATA30 (The underlining indicates mismatched bases encoding the E1157L and G1161P mutations, respectively).
X
ABCC1 p.Gly1161Pro 16861249:47:171
status: NEW
Login to comment

110 ATP-dependent LTC4 transport by reconstituted E507L G511P/WT MRP1 or WT/E1157L G1161P MRP1 was considerably decreased and GSH-dependent photolabeling of azido AG-A of these MRP1 mutants was abrogated.
X
ABCC1 p.Gly1161Pro 16861249:110:79
status: NEW
Login to comment

PMID: 17494643 [PubMed] Letourneau IJ et al: "Mutational analysis of a highly conserved proline residue in MRP1, MRP2, and MRP3 reveals a partially conserved function."
No. Sentence Comment
221 Thus, the Glu1157Leu/ Gly1161Pro mutant displayed both decreased vanadate-induced 8N3ADP trapping as well as decreased 8N3ATP photolabeling at both NBDs (Ren et al., 2006).
X
ABCC1 p.Gly1161Pro 17494643:221:22
status: NEW
Login to comment

223 Unfortunately, the Glu1157Leu/Gly1161Pro mutant was not tested with other substrates, so it is not known whether the decreased transport activity of this mutant was substrate-selective.
X
ABCC1 p.Gly1161Pro 17494643:223:30
status: NEW
Login to comment

PMID: 19015228 [PubMed] Conseil G et al: "Multiple roles of charged amino acids in cytoplasmic loop 7 for expression and function of the multidrug and organic anion transporter MRP1 (ABCC1)."
No. Sentence Comment
265 They found that the double-mutant E1157L/G1161P no longer transported LTC4 and could not be labeled with the photoaffinity ligand azidoAgosterol A.
X
ABCC1 p.Gly1161Pro 19015228:265:41
status: NEW
Login to comment

267 Thus, for reasons that are presently unclear, the interactions of the double E1157L/G1161P mutant with nucleotide differ substantially from those of the CL7 mutants we have described here and elsewhere (Conseil et al., 2006).
X
ABCC1 p.Gly1161Pro 19015228:267:84
status: NEW
Login to comment

PMID: 21143116 [PubMed] He SM et al: "Structural and functional properties of human multidrug resistance protein 1 (MRP1/ABCC1)."
No. Sentence Comment
807 The double-mutant Glu1157Leu/Gly1161Pro showed no activity for LTC4 and was not labeled by the photoaffinity ligand azidoAgosterol A [365].
X
ABCC1 p.Gly1161Pro 21143116:807:31
status: NEW
Login to comment