ABCMdb

ABCG2 p.Glu211Gln

None has been submitted yet.

Publications

PMID: 19691360 [PubMed] Hou YX et al: "Effects of putative catalytic base mutation E211Q on ABCG2-mediated methotrexate transport."

No. Sentence Comment

2 Substitution of the putative catalytic residue E211 with a nonacidic amino acid glutamine (E211Q) completely abolished its ATPase activity and ATP-dependent methotrexate transport, suggesting that ATP hydrolysis is required for the ATP-dependent solute transport. Login to comment
4 To address this question, we have made an YFP/ABCG2 fusion protein and expressed this 99 kDa fusion protein alone or along with the 70 kDa E211Q-mutated ABCG2 in BHK cells. Login to comment
6 Interestingly, membrane vesicles prepared from BHK cells expressing both YFP/ABCG2 and E211Q-mutated ABCG2 (with a ratio of 1:1) form homodimers and heterodimer and exert 55% of wt ABCG2 ATPase activity that can be further enhanced by anticancer drugs, suggesting that the wt NBD in the heterodimer of YFP/ABCG2 and E211Q may be able to hydrolyze ATP. Login to comment
7 Furthermore, themembrane vesicles containing both YFP/ABCG2 and E211Q exert ~79% of wt ABCG2-mediated methotrexate transport activity, implying that the heterodimer harboring YFP/ABCG2 and E211Q may be able to transport the anticancer drug methotrexate across the biological membranes. Login to comment
23 Interestingly, E211Q mutation (in homodimer) completely abolished its ATPase activity and ATP-dependent anticancer drug transport, whereas coexpression of this mutant † This work was supported by a grant from the National Cancer Institute (CA89078 to X.C.). Login to comment
39 The putative catalytic residue E211 was mutated to Q in pNUT/ABCG2, named as pNUT/ABCG2/E211Q. Login to comment
40 In order to distinguish the wt ABCG2 from the E211Q-mutated protein, the full-length yellow fluorescent protein (YFP) cDNA (238 amino acids) with the SGLRSRAAANT (11 amino acids) linker (45), amplified by PCR from the plasmid DNA containing YFP cDNA (46), was inserted into the N-terminus of pNUT/ABCG2, named as pNUT/YFP/ABCG2. Login to comment
77 In order to test whether substitution of the ABCG2 putative catalytic base E211 with a glutamine residue (E211Q) is able to transport MTX across biological membranes, membrane vesicles have been prepared from the BHK cells expressing either wt or E211Q-mutated ABCG2. Login to comment
78 The results in Figure 1A indicate that the amount of wt ABCG2 is similar to that of E211Q, whereas there is no detectable amount of ABCG2 in membrane vesicles prepared from the parental or cystic fibrosis transmembrane-conductance regulator (CFTR or ABCC7) cDNA-transfected BHK cells. Login to comment
80 Although the amount of E211Q-mutated ABCG2 is similar to that of wt ABCG2, E211Q mutated ABCG2, similar to CFTR and BHK membrane vesicles, was unable to transport MTX across the biological membranes (Figure 1B), suggesting that substitution of the putative catalytic base of ABCG2 with a nonacidic glutamine residue may completely abolish its ATPase activity. Login to comment
84 The Heterodimer of YFP/ABCG2 and E211Q May Be Able To Transport MTX across the Biological Membranes. Login to comment
85 Since E211Q-mutated ABCG2 completely abrogated its ATP-dependent MTX transport activity (Figure 1B), we had asked a question of whether the heterodimer of wt and E211Q-mutated ABCG2 was able to transport MTX across the biological membranes or not. Login to comment
86 However, because the wt ABCG2 and the E211Q-mutated ABCG2 run to the same position in SDS-PAGE (as shown in Figure 1A), there was no way to distinguish these two proteins if they were coexpressed in BHK cells. Login to comment
89 (A) Expression of wt and E211Q-mutated ABCG2 in BHK cells. Login to comment
92 (B) E211Q-mutated ABCG2 isunabletotransport MTX intothe membranevesicles.The dATP(4 mM) dependent MTX transport by ABCG2, E211Q, BHK, or CFTR membrane vesicles was performed in triplicate according to the method described in Experimental Procedures. Login to comment
100 The complex-glycosylated YFP/ABCG2 has an apparent molecular mass of ~99 ( 3 kDa (Figure 2B, n = 16), which is significantly larger than its unmodified wt or E211Q-mutated ABCG2, with an apparent molecular mass of ~70 ( 2 kDa (Figure 2B, n = 24). Login to comment
101 Due to the mobility difference between YFP/ABCG2 and E211Q-mutated ABCG2, these two proteins coexpressed in BHK cells can be separated very well (Figure 2B). Login to comment
102 Furthermore, the ratio between the complex-glycosylated YFP/ABCG2 and E211Q, probed with the same ABCG2-specific mAb BXP-21, can be accurately determined. Login to comment
103 Thus, YFP/ABCG2 was coexpressed with E211Q (with plasmid DNA ratios of 2:8, 4:6, 5:5, 6:4, or 8:2) in BHK cells. Login to comment
105 Colonies derived from the transfections with ratios of 4:6, 5:5, or 6:4 yielded similar amounts of YFP/ABCG2 and E211Q. Login to comment
106 Membrane vesicles were prepared from the colonies with similar amounts of YFP/ABCG2 and E211Q and analyzed by Western blots. Login to comment
107 Membrane vesicles containing the same amounts of YFP/ ABCG2 and E211Q (with a ratio of 1:1 as shown in Figure 2B) were used to do further analysis. Login to comment
108 FIGURE 2: Heterodimer of YFP/ABCG2 and E211Q-mutated ABCG2 may be able to transport MTX across the biological membranes. Login to comment
112 Membrane vesicles (1 μg) containing wt ABCG2, YFP/ABCG2, E211Q or YFP/ABCG2 + E211Q were subjected to SDS-PAGE (7%) and probed with ABCG2 mAb BXP-21. Login to comment
114 (C) Coexpression of YFP/ABCG2 and E211Q in BHK cells forms homodimers and heterodimer. Login to comment
115 Membrane vesicles containing wt ABCG2 (0.5 μg), YFP/ABCG2 (0.5 μg), E211Q (0.5 μg), or YFP/ABCG2 + E211Q (1 μg) were subjected to SDS-PAGE (4-10% gradient gel) in the absence of reducing agent DTT and probed with ABCG2 mAb BXP-21. Login to comment
118 Mm, Hmd, and Htd on the right indicate the monomers of ABCG2, E211Q, or YFP/ABCG2, the homodimers of ABCG2, E211Q, or YFP/ABCG2, and the heterodimer of YFP/ABCG2 and E211Q. Login to comment
119 (D) E211Q-mutated ABCG2 is unable to hydrolyze ATP. Login to comment
120 The ATPase assay (in triplicate) was performed according to the method described in Experimental Procedures by using 2 μg of the same membrane vesicles shown in panels B and C (1.8862 μg of wt ABCG2 + 0.1138 μg of BHK; 1.5145 μg of YFP/ABCG2 + 0.4855 μg of BHK; 2 μg of E211Q; and 0.7918 μg of YFP/ABCG2 + E211Q + 1.2082 μg of BHK) and 4 mM ATP at 37 °C for 30 min. After subtraction of the amount of inorganic phosphate generated in the presence of 2 μg of BHK membrane vesicles, the velocity of the ATPase activity was calculated and compared to that of ABCG2 (n = 5). Login to comment
121 (E) The heterodimer of YFP/ABCG2 and E211Q may be able to transport MTX across the biological membranes. Login to comment
122 The MTX uptake assays were carried out, according to the method described in Experimental Procedures, in a 30 μL solution (in triplicate) containing 3 μg of membrane vesicles (2.829 μg of ABCG2 + 0.171 μg of BHK; 2.272 μg of YFP/ABCG2 + 0.728 μg of BHK; 3 μg of E211Q; and 1.188 μg of YFP/ABCG2 + E211Q + 1.812 μg of BHK), 2 mM MTX, 10 mM DTT, and 4 mM dATP at 37 °C for 7.5 min. After subtraction of the amount of radioactivity bound to the nitrocellulose membrane in the presence of 4 mM AMP from the same sample in the presence of 4 mM dATP, the velocity of the dATP-dependent MTX transport was calculated (n = 4). Login to comment
123 When the membrane vesicles were separated in SDS-PAGE in the absence of reducing agent DTT, wt ABCG2 or E211Q monomer (70 ( 2 kDa) and homodimer (149 ( 0 kDa) and YFP/ ABCG2 monomer (99 ( 3 kDa) and homodimer (220 ( 1 kDa) and heterodimer of YFP/ABCG2 and E211Q (188 ( 0 kDa) were clearly detected (Figure 2C). Login to comment
124 Interestingly, in the 4-10% gradient gel (Figure 2C), the ratio of E211Q and YFP/ABCG2 is approximately 1:1.1 ( 0.2, implying that similar amounts of E211Q and YFP/ABCG2 form either homodimer or heterodimer. Login to comment
125 The ratios between the homodimers and heterodimer further confirm this conclusion, i.e., homodimer of YFP/ABCG2 (30.0 ( 3.2%, n = 25), homodimer of E211Q (28.2 ( 3.8%, n = 25), and the heterodimer of YFP/ABCG2 and E211Q (41.8 ( 3.6%, n = 25). Login to comment
126 Thus, regardless of whether the intermolecular disulfide bond is formed in vivo or in vitro, the heterodimer of YFP/ABCG2 and E211Q does exist in the plasma membranes of the BHK cells cotransfected with YFP/ABCG2 and E211Q-mutated ABCG2. Login to comment
130 The ratio between YFP/ABCG2 and E211Q is ~1.0375 ( 0.0303 (n = 4), indicating that the amount of YFP/ ABCG2 protein in the membrane vesicles containing both YFP/ ABCG2 and E211Q is not significantly different from that of E211Q-mutated ABCG2. Login to comment
131 The ratios between different samples and wt ABCG2 are as follows: 2.3821 ( 0.3762 (YFP/ABCG2 þ E211Q, including both YFP/ABCG2 and E211Q bands, versus wt ABCG2, n = 4); 0.9431 ( 0.1758 (E211Q versus wt ABCG2, n = 4); 1.2454 ( 0.1878 (YFP/ABCG2 versus wt ABCG2, n = 4). Login to comment
132 The results in Figure 2D indicate that wt ABCG2 is able to hydrolyze ATP, with a velocity of ~ 40 nmol mg-1 min-1 , whereas YFP/ABCG2, after adjusted with BHK membrane vesicles to have the same amount of ABCG2 protein, is moder- atelymoreactive thanthat of wt ABCG2.However,E211Q alone is unable to hydrolyze ATP, indicating that substitution of the putative catalytic residue E211 with a glutamine residue completely abolished its ATPase activity. Login to comment
133 Coexpression of YFP/ ABCG2 with E211Q yielded ~55% of wt ABCG2 ATPase activity (Figure 2D), making it difficult to make any conclusion from this result. Login to comment
134 However, in considering the results published by Henriksen et al., i.e., coexpression of wt ABCG2 with K86M-mutated ABCG2 exerted ~50% of wt ABCG2 ATPase activity (54), the above result might be interpreted as that one of the two ATPs bound to the heterodimer of YFP/ABCG2 and E211Q could be hydrolyzed. Login to comment
137 In contrast, E211Q alone is unable to transport MTX across the biological membranes (Figure2E). Login to comment
138 However,coexpression of YFP/ABCG2 with E211Q (with a ratio of 1:1), after adjusted with BHK membrane vesicles to have similar amount of ABCG2 in YFP/ ABCG2 þ E211Q as in wt ABCG2, yielded approximately 79% of wt ABCG2 transport activity (Figure 2E and Table 1), suggesting that the heterodimer of YFP/ABCG2 and E211Q may be able to transport MTX into the membrane vesicles. Login to comment
139 Heterodimer Formation of YFP/ABCG2 and E211Q Altered the Kinetic Parameters of Nucleotide-Dependent MTX Transport. If the heterodimer of YFP/ABCG2 and E211Q is able to transport MTX into the membrane vesicles, we expect that the kinetic parameters of nucleotide-dependent MTX transport may be changed. Login to comment
143 In contrast, the ATP- (Figure 3C) and dATP-dependent (Figure 3D) MTX transport by membrane vesicles containing both YFP/ABCG2 and E211Q exerted two (mixed) Michaelis-Menten curves: one yields lower Km and Vmax values and the other higher Km and Vmax values (due tooverlap between these two curves, the Km and Vmax values cannot be accurately determined). Login to comment
144 The results were interpreted as that the MTX transported into membrane vesicles at lower concentrations of nucleotides was catalyzed by the homodimer of YFP/ABCG2, whereas the one transported into membrane vesicles at higher concentrations of nucleotides was catalyzed by both the homodimer of YFP/ABCG2 and heterodimer of YFP/ABCG2 and E211Q. Login to comment
147 The results in Figure 4 indicated that the basal ATPase activity (~ 40 nmol mg-1 min-1 ) of membrane vesicles derived from the BHK cell is the same as the one derived from the BHK/E211Q cell, indicating that E211Q protein does not have ability to hydrolyze ATP. These results also indicated that EGTA, ouabain, and sodium azide did not completely inhibit all of the ATPases in BHK membrane vesicles. Login to comment
148 The basal ATPase activities of membrane vesicles containing wt ABCG2 (~80 nmol mg-1 min-1 without subtracting the ATPase activity contributed by BHK membrane proteins), YFP/ABCG2 (~105 nmol mg-1 min-1 ), or YFP/ABCG2 þ E211Q (~76 nmol mg-1 min-1 ) were significantly higher than that of BHK or E211Q membrane vesicles, indicating that wt ABCG2, YFP/ABCG2, or YFP/ABCG2 þ E211Q can hydrolyze ATP in the absence of their substrate. Login to comment
149 Furthermore, the basal ATPase activities of either BHK membrane proteins or E211Q cannot be enhanced by anticancer drugs, such as daunomycin (Figure 4A), methotrexate (Figure 4B), or tamoxifen (Figure 4C), whereas the ATPase activities wt ABCG2, YFP/ABCG2, or YFP/ABCG2 þ E211Q Table 1: Relative MTX Transport Activitya sample MTX transport (%) ABCG2 100.0 ( 0.0 YFP/ABCG2 101.2 ( 2.4 E211Q 3.7 ( 3.3 YFP/ABCG2 + E211Q 79.4 ( 11.2 a The data were derived from Figure 2E (n = 4). Login to comment
152 Substitution of the putative catalytic E211 residue with a noncharged amino acid glutamine (E211Q) completely abolished its ATPase activity (Figures 2 and 4), suggesting that the acidic amino acidE211 plays a veryimportant role in ATP hydrolysis. Login to comment
153 E211Q mutation also completely abolished the dATP-dependent MTX transport (Figures 1 and 2), indicating that ATP hydrolysis is required for facilitating the anticancer drug MTX across the biological membranes. These results are consistent with the corresponding mutations in ABCB1 (57), in ABCC1 (E1455 mutations in NBD2) (58, 59), and in bacterial ABC transporters MJ0796 (18) and HisP (27). Login to comment
155 Since ABCG2 forms homodimer in vivo, the E211Q mutation actually mutated both putative catalytic bases in the two NBDs of the homodimer of this protein. Login to comment
161 (C) ATP-dependent MTX transport by YFP/ABCG2 + E211Q. Login to comment
162 (D) dATP-dependent MTX transport by YFP/ABCG2 + E211Q. Login to comment
167 ular mass of 99 kDa) so that it can be clearly distinguished from the E211Q-mutated ABCG2 (with an apparent molecular mass of 70 kDa). Login to comment
172 Thus, if the YFP/ABCG2 fusion protein can form heterodimer with E211Q-mutated ABCG2, this heterodimer may be used to test whether the ATP bound in the NBD3 ATP3 ATP3 NBD-E211Q sandwich structure can be hydrolyzed or not. Login to comment
173 Indeed, when YFP/ABCG2 was coexpressed with E211Q-mutated ABCG2 in BHK cells, approximately 42% of them form heterodimer in the BHK plasma membranes (Figure 2C). Login to comment
174 Although E211Q mutation completely abolished its ATPase activity (Figures 2D and 4), coexpression of YFP/ABCG2 with E211Q-mutated ABCG2 exerted ~55% of wt ABCG2 ATPase activity (Figure 2D). Login to comment
176 This ATPase activity, regardless ofwhether itiscontributed by wtNBD fromhomodimer of YFP/ ABCG2 or heterodimer containing YFP/ABCG2 and E211Q-mutated ABCG2, can be further stimulated by anticancer drugs, such as daunomycin (Figure 4A), MTX (Figure 4B), or tamoxifen (Figure 4C), implying that one of the two ATPs bound in the NBD3ATP3ATP3NBD-E211Q sandwich structure could be hydrolyzed. Login to comment
177 Of course, this conclusion should be further confirmed by using covalently linked dimers (64), such as wt ABCG2-wt ABCG2, E211Q-E211Q, and wt ABCG2-E211Q (which is our ongoing project). Login to comment
178 The above conclusion implies that one of the two ATPs bound in the NBD3ATP3ATP3NBD-E211Q sandwich structure could be hydrolyzed by wt NBD. Login to comment
179 If that is the case, the heterodimer of YFP/ABCG2 and E211Q may be used to address the question of whether one ATP hydrolysis or two ATP hydrolyses in the NBD3ATP3ATP3NBD sandwich structure is/are required for the ATP-dependent solute transport by ABCG2. Login to comment
184 Furthermore, membrane vesicles prepared from BHK/CFTR (Figure 1) and BHK/E211Q (Figures 1 and 2), which were generated under the same selection procedures as YFP/ABCG2 þ E211Q, were unable to transport MTX across the biological membranes. These results suggest that the heterodimer containing YFP/ ABCG2 and E211Q-mutated ABCG2 is able to transport the bound MTX into the membrane vesicles, strikingly contrasting the conclusions derived from K86M- or D210N-mutated ABCG2 (11, 54, 64). Login to comment
186 Kinetic analyses of the membrane vesicles containing both YFP/ABCG2 and E211Q-mutated ABCG2 (Figure 3C,D) indicate that there might be two populations of membrane vesicles: one population has lower Km and Vmax values and the other higher Km and Vmax values. Login to comment
189 the conclusion made by McDevitt et al. (65), i.e., ATP binding to NBD of ABCG2 induces conformational changes that result in shifting the bound anticancer drug from the high- to low-affinity site, we interpreted these results as that ATP binding to the heterodimer of E211Q and YFP/ABCG2 might induce proper conformational changes that brought the bound MTX from the high- to low-affinity site. Login to comment
190 One ATP hydrolysis in the NBD3ATP3 ATP3NBD-E211Q sandwich structure, catalyzed by the wt NBD, may facilitate the release of both nucleotides bound in thissandwich structureandbringthe moleculeback toits original conformation so that the protein can start a new cycle of ATP-dependent solute transport. If this is the case, the higher Km value of a population, possibly the heterodimer of YFP/ABCG2 and E211Q, implies that higher concentration of nucleotide is required to form the NBD3ATP3ATP3NBD-E211Q sandwich structure. Login to comment
191 If K86M- or D210N-mutated ABCG2 had higher effects on ATP binding than E211Q, much higher concentration of ATP may be required to form the NBD3ATP3ATP3NBD- K86M or NBD3ATP3ATP3NBD-D210N sandwich structure. Login to comment

PMID: 20812902 [PubMed] Ni Z et al: "Structure and function of the human breast cancer resistance protein (BCRP/ABCG2)."

No. Sentence Comment

274 Hou et al. [124] demonstrated that Gln substitution of Glu211 had no effect on protein expression, but completely abolished ATP-dependent transport of methotrexate and ATPase activity. Login to comment

PMID: 21991363 [PubMed] Haider AJ et al: "Dimerization of ABCG2 analysed by bimolecular fluorescence complementation."

No. Sentence Comment

86 Primer Sequence 59-39 Restriction site Purpose EYFPG2F CCTGTATTTTCAGGAATTCTATGTCTTCCAG EcoRI Generation of ABCG2 tagged N-terminally with complete eYFP YFPG2R GCTTGGTACCGATCTAGAATCCAATTTAAGAATA XbaI Common reverse primer for tagging ABCG2 N-terminally with fragments of vYFP or with complete eYFP VYFPG2F CCTGTATTTTCAGGAATTCATGTCTTCCAG EcoRI Generation of ABCG2 tagged N-terminally with vYFP fragments G2YFPF CCTGTATTTTCAGGGATCCATGTCTTCCAG BamHI Generation of ABCG2 with C-terminal vYFP fragments G2YFPR GAGCTCGGATCCCTCGAGAGAATATTTTTTAAG XhoI Generation of ABCG2 with C-terminal vYFP fragments E211QF ATCTTGTTCTTGGATCAACCTACAACAGGCTTAGACTCAAG n/a Mutating E211Q C603AF ACAGGAAACAATCCGGCCAACTATGCAACATGTACT n/a Mutating C603A doi:10.1371/journal.pone.0025818.t001 USA, [23]). Login to comment
141 Mutation of the conserved Walker-B glutamate residues (in ABCG2 this corresponds to the mutation E211Q) has been shown in numerous in vitro and structural investigations of other ABC proteins to result in the tighter apposition of the 2 NBDs with concomitant, irreversible Figure 4. Login to comment
153 All three constructs (WT, E211Q and C603A) showed BiFC (Figure 6B-D respectively) producing a fluorescence signal far in excess of the background observed with a single transfection (Figure 6A). Login to comment
156 Although the percentage of cells showing BiFC was greater for the E211Q mutant - which might be expected to form a stronger dimer - this was not statistically significant by ANOVA. Login to comment

PMID: 24319544 [PubMed] Palaniyandi K et al: "Human Breast Cancer Stem Cells Have Significantly Higher Rate of Clathrin-Independent and Caveolin-Independent Endocytosis than the Differentiated Breast Cancer Cells."

No. Sentence Comment

278 Hou YX, Li CZ, Palaniyandi K, Magtibay PM, Homolya L, et al. Effects of putative catalytic base mutation E211Q on ABCG2-mediated methotrexate transport. Login to comment

PMID: 25036722 [PubMed] Szafraniec MJ et al: "Determinants of the activity and substrate recognition of breast cancer resistance protein (ABCG2)."

No. Sentence Comment

209 Position Type of mutation Effect on the transporter References NBD Lys 86 Met (i) No stimulation of the ATPase activity by prazosin; (ii) no influence on the transport of mitoxantrone Henriksen et al. (2005b) Glu 126 stop, Phe 208 Ser, Ser 248 Phe, Glu 334 stop Inability to transport hematoporphyrin Tamura et al. (2006) Glu 211 Gln Complete abolishment of the ATPase activity and methotrexate transport Hou et al. (2009) Pro 392 Ala Significant reduction in the efflux activity of mitoxantrone, BODIPY-prazosin and Hoechst 33342 Ni et al. (2011) TM1 Gly 406 Ala Gly 410 Ala No influence on the activity of the transporter Polgar et al. (2004) Gly 406 Leu Gly 410 Leu (i) Loss of the ability to transport rhodamine123; (ii) impaired transport of mitoxantrone, Pheide and BODIPY-prazosin Polgar et al. (2004) Extracellular loop 1 Phe 431 Leu (i) Loss of the ability to transport methotrexate; (ii) 10% level of hematoporphyrin transport compared to the WT protein Tamura et al. (2006) Ser 441 Asn Inability to transport hematoporphyrin Tamura et al. (2006) Ser 441 Asn Loss of the ability to transport methotrexate Tamura et al. (2006) TM2 Lys 452 Ala His 457 Ala Increase in transport of mitoxantrone, BODIPY-prazosin and Hoechst 33342 Cai et al. (2010) Lys 453 Ala Arg 465 Ala Decrease in transport of mitoxantrone, BODIPY-prazosin, Hoechst 33342, doxorubicin, SN-38 and rhodamine 123 Cai et al. (2010) TM3 Arg 482 Gly Arg 482 Thr (i) No change in the inhibitory activity of lapatinib; (ii) about two times greater inhibition by ritonavir, saquinavir and nalfinavir than in the WT variant; (iii) gaining the ability to transport rhodamine123 and doxorubicin; (iv) no influence on the transport of mitoxantrone; (v) loss of the ability to transport methotrexate Dai et al. (2008), Gupta et al. (2004), Honjo et al. (2001), Mitomo et al. (2003) Arg 482 Thr (i) Lower IC 50 of cyclosporine A for mutant than for WT variant; (ii) lower elacridar inhibition potency Xia et al. (2007) Arg 482 Lys Complete loss of transport activity Ejendal et al. (2006) Phe 489 Leu Impaired transport of porphyrins, no transport of methotrexate Tamura et al. (2006) Extracellular loop 3 Asn 590 Tyr Over twice reduced transport of mitoxantrone, topotecan, daunorubicin and rhodamine 123 Vethanayagam et al. (2005) Cys 592 Ala/Cys 608 Ala (i) Transport of mitoxantrone almost unchanged; (ii) transport of BODIPY-prazosin significantly impaired Henriksen et al. (2005a) Extracellular loop 3 Cys 603 Ser Cys 592 Ser/Cys 608 Ser Cys 592 Ser/Cys 603 Ser/Cys 608 Ser Diminished susceptibility to the inhibitory activity of fumitremorgin C Shigeta et al. (2010) Cys-less Arg 482 Gly-BCRP Complete loss of the ability to efflux mitoxantrone Liu et al. (2008b) The positions of the amino acid residues refer to the topological model of BCRP proposed by Wang et al. (2009). Login to comment

PMID: 26294421 [PubMed] Haider AJ et al: "Identification of residues in ABCG2 affecting protein trafficking and drug transport, using co-evolutionary analysis of ABCG sequences."

No. Sentence Comment

110 A further three control mutations were analysed, namely a substitution of lysine to alanine in the Walker-A motif (K86A), a substitution of glutamate to glutamine in the Walker-B motif (E211Q) and a substitution of asparagine to glutamine at the site of glycosylation (N596Q). Login to comment
155 These two mutants behaved in this assay in essentially the same way as the K86A and E211Q catalytically inactive mutants (result not shown). Login to comment