ABCMdb

ABCG2 p.Cys608Ala

None has been submitted yet.

Publications

PMID: 16086592 [PubMed] Bhatia A et al: "Oligomerization of the human ABC transporter ABCG2: evaluation of the native protein and chimeric dimers."

No. Sentence Comment

67 ABCG2∆EC-C, which contains all three endogenous extracellular cysteines replaced with alanine (C592A, C603A, C608A), was constructed by site-directed mutagenesis of the parent plasmid pTM1-ABCG2 (R482G). Login to comment

PMID: 16107343 [PubMed] Henriksen U et al: "Identification of intra- and intermolecular disulfide bridges in the multidrug resistance transporter ABCG2."

No. Sentence Comment

3 Upon mutation of Cys-592 or Cys-608 to alanine (C592A and C608A), ABCG2 migrated as a dimer in SDS-PAGE under non-reducing conditions; however, mutation of Cys603 to Ala (C603A) caused the transporter to migrate as a single monomeric band. Login to comment
5 Because the transporter migrated as a dimer in SDS-PAGE, when only Cys-603 was present (C592A-C608A), the data suggest that Cys-603 forms a symmetrical intermolecular disulfide bridge in the ABCG2 homodimer that is not essential for protein expression and function. Login to comment
6 In contrast to C603A, both C592A and C608A displayed impaired membrane targeting and function. Login to comment
7 Moreover, when only Cys-592 or Cys-608 were present (C592A/C603A and C603A/ C608A), the transporter displayed impaired plasma membrane expression and function. Login to comment
8 The combined mutation (C592A/C608A) partially restored plasma membrane expression; however, although transport of mitoxantrone was almost normal, we observed impairment of BODIPY-prazosin transport. Login to comment
104 The resulting constructs (C592A, C603A, and C608A) were stably expressed in HEK293 cells using the bicistronic vector pCIN4 (28), and total cell lysates were analyzed by Western blotting in the presence of increasing concentrations of DTT (Fig. 3). Login to comment
108 In C592A and C608A, the disulfide-linked dimer was still present, although only scarcely in Cys-608 (Fig. 3, A and C). Login to comment
109 We observed also, however, a significant amount of monomer in the unreduced samples of C592A and C608A as compared with wt (Fig. 3, A and C). Login to comment
114 In comparison, C592A and C608A exhibited less apparent plasma membrane staining and substantially more intracellular staining than in wt and C603A (Fig. 3, A and C). Login to comment
120 C608A (A), C603A (B),C592A(C),andwt(D)areshown.Immunostainings of the corresponding cells are shown directly below. Login to comment
122 The samples were analyzed by confocal microscopy using a Zeiss LSM510. Cysteine-linked Dimerization of ABCG2 36928 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 280•NUMBER 44•NOVEMBER , to mitoxantrone was directly comparable with wt, whereas C592A and C608A showed significant decrease in resistance of ϳ50 and 70%, respectively (Fig. 4B). Login to comment
125 The analysis showed that, although C603A tended to have a higher total expression, there were no significant changes in the expression of C592A and C608A. Login to comment
126 It is, however, important to correlate this with the immunostainings; i.e. both C592A and C608A displayed less apparent plasma membrane staining and increased intracellular staining, possibly accounting for the reduced activity (Fig. 4B). Login to comment
128 The impaired targeting of C592A and C608A led us to hypothesize that these two residues could form a structurally important intramolecular disulfide bridge. Login to comment
129 To further explore this hypothesis, we mutated two cysteines at a time, resulting in C592A/C603A, C592A/C608A, and C603A/C608A, each of which contained one remaining extracellular cysteine. Login to comment
131 In C592A/C608A, which contained only Cys-603, we observed, in agreement with our hypothesis, efficient dimerization (Fig. 5D). Login to comment
132 The expression of C592A/C608A was also high and, in fact, increased as compared with the wt (Fig. 6C). Login to comment
133 In contrast, protein expression was very low in the construct containing only Cys-592 (C603A/ C608A) (Figs. 5C and 6C) and slightly lower than wt for C592A/C603A, in which only Cys-608 is present (Figs. 5A and 6C). Login to comment
134 Notably, we also detected dimer formation in C603A/C608A and C592A/C603A. Login to comment
136 A, comparison of cell survival between non-transfected HEK293 cells (E) and HEK293 cells transfected with ABCG2-wt (●), C592A (‚), C603A (ƒ), and C608A (Ⅺ). Login to comment
144 ABCG2-C592A/C608A containing only Cys-603 dimerizes efficiently and is highly expressed. Login to comment
145 Shown are C592A/C603A (A), wt (B), C603A/C608A (C), and C592A/ C608A (D). Login to comment
152 Staining of the transfected HEK293 cells showed that, although C592A/C608A (Fig. 5D) mostly resembled the membrane-localized expression pattern of wt (Fig. 5B), C592A/C603A displayed largely intracellular staining (Fig. 5A), and C603A/C608A was hardly visible (Fig. 5C). Login to comment
157 For both C603A/C608A and C592A/C603A, we observed a marked decrease in resistance to mitoxantrone and a concomitant decrease in expression (Fig. 6, B and C). Login to comment
158 For C592A/C608A, we observed, nonetheless, an increase in expression (Fig. 6C). Login to comment
160 We also substituted all three extracellular cysteines in ABCG2 simultaneously (C592A/C603A/C608A). Login to comment
162 Specifically, we were almost unable to detect any expressed protein in the immunostainings (Fig. 7B) To further explore the function of the hypothesized disulfide bridges, we performed efflux experiments on the mutants containing either both Cys-592 and Cys-608 (C603A), predicted to form an intramolecular disulfide bridge, or Cys-603 only (C592A/C608A), predicted to form an intermolecular disulfide bridge (Fig. 9). Login to comment
164 C603A displayed efflux similar to wt, whereas efflux in C592A-C608A was slightly decreased (Fig. 9). Login to comment
165 The pattern was, however, different when analyzing another substrate for ABCG2, BODIPY-prazosin; i.e. we observed BODIPY-prazosin efflux similar to the wt in C603A, whereas in C592A-C608A we could not detect any evidence for BODIPY-prazosin efflux (Fig. 9). Login to comment
168 Without prior TCEP reduction, we observed no labeling consistent with no cysteines on the extracellular face of the transporter available for biotinylation (Fig. 10); however, upon TCEP treatment, we found clear biotin labeling of both C603A and C592A/C608A. Login to comment
172 A, comparison of cell survival between empty HEK293 (E) and ABCG2-wt (●), C592A/C603A (‚), C592A/C608A (ƒ), and C603A/C608A (Ⅺ). Login to comment
202 The transmitted light image of the C592A/C603A/C608A (3cys) sample is also shown. Login to comment
206 Empty HEK293 (●), ABCG2-wt (Œ), and ABCG2-C592A/C603A/C608A (3cys) (f) are shown. Login to comment
217 However, simultaneous mutation of both cysteines (C592A/C608A) restored plasma membrane targeting, and the expression even tended to be higher than that observed for the wt (Fig. 5). Login to comment
221 Cys-592 and Cys-608 might nonetheless form intermolecular disulfide bridges when they are "alone" as indicated from the results with the double mutations; i.e. both in C603A/C608A (where Cys-592 is alone) and in C592A/C603A (where Cys-608 is alone), we observed some disulfide bridge-linked dimers despite the fact that Cys603 is mutated. Login to comment
223 Efflux of BODIPY-prazosin and mitoxantrone is not affected by removal of the intermolecular disulfide bridge (C603A), whereas removal of the intramolecular disulfide bridge affects BODIPY-prazosin efflux (C592A/C608A). Login to comment
231 Cells stably expressing wt, C603A, or C592A/C608A ABCG2 were exposed to a cysteine-reactive biotinylation agent after incubation with (ϩ) or without (-) the reducing agent TCEP. Login to comment
236 In this context, it is also interesting to pay attention to the finding that, in the single mutants (C592A and C608A), we observed a significant amount of monomer in the unreduced samples (Fig. 3, A and C). Login to comment
241 Mutating all three extracellular cysteines in ABCG2 (C592A/C603A/ C608A) at the same time had detrimental effects on the transporter. Login to comment
243 This supports the conclusion that, although we can disrupt the putative intermolecular symmetrical disulfide bridge involving Cys-603 (C603A mutant) and although we can remove the putative intramolecular disulfide bridge between Cys-592 and Cys-608 (C592A/C608A mutant) without any major impact on expression of the transporter, it is not possible to remove both of them simultaneously. Login to comment
246 In C592A/C608A, we see no efflux of the substrate BODIPY-prazosin, although efflux of mitoxantrone is preserved. Login to comment

PMID: 18249138 [PubMed] Hazai E et al: "Homology modeling of breast cancer resistance protein (ABCG2)."

No. Sentence Comment

245 However, in our model, R482 cannot form interaction with rhodamine, but L484 is in interacting distance Table 3 Mutations on BCRP and their effect on its function Mutation Effect/results Reference V12M Did not effect Hemato and MTX transport Tamura et al. (2006) G51C Did not effect Hemato and MTX transport Tamura et al. (2006) K86M Inactivates transporter (dominant negative effect on ATPase activity); alters subcellular distribution Henriksen et al. (2005a) K86M Transporter inactive, but still able to bind ATP Ozvegy et al. (2002) Q126stop Defective porphyrin transport Tamura et al. (2006) Q141K Did not effect Hemato and MTX transport Tamura et al. (2006) T153M Did not effect Hemato and MTX transport Tamura et al. (2006) Q166E Did not effect Hemato and MTX transport Tamura et al. (2006) I206L Did not effect Hemato and MTX transport Tamura et al. (2006) F208S Defective porphyrin transport Tamura et al. (2006) S248P Defective porphyrin transport Tamura et al. (2006) E334stop Defective porphyrin transport Tamura et al. (2006) F431L Effects MTX transport Tamura et al. (2006) S441N Defective porphyrin transport Tamura et al. (2006) E446-mutants No drug resistance Miwa et al. (2003) R482G, R482T Effects MTX transport Tamura et al. (2006) R482T Substrate drug transport and inhibitor efficiency is not mediated by changes in drug-binding Pozza et al. (2006) R482G, R482T Substitution influence the substrate specificity of the transporter Ozvegy et al. (2002) R482G, R482T Altered substrate specificity Honjo et al. (2001) R482G Methotrexate not transported Chen et al. (2003b) Mitomo et al. (2003) R482G Resistance to hydrophilic antifolates in vitro, G482-ABCG2 mutation confers high-level resistance to various hydrophilic antifolates Shafran et al., (2005) R482G Three distinct drug, binding sites Clark et al. (2006) R482G Altered substrate specificity, granulocyte maturation uneffected Ujhelly et al. (2003) R482 mutants Higher resistance to mitoxantrone and doxorubicin than wt Miwa et al. (2003) R482X Affects substrate transport and ATP hydrolysis but not substrate binding Ejendal et al. (2006) F489L Impaired porphyrin transport Tamura et al. (2006) G553L; G553E Impaired trafficing, expression, and N-linked glycosylation Polgar et al. (2006) L554P Dominant negative effect on drug sensitivity Kage et al. (2002) N557D Resistance to MTX, but decreased transport of SN-38; N557E no change in transport compared to wt Miwa et al. (2003) F571I Did not effect Hemato and MTX transport Tamura et al. (2006) N590Y Did not effect Hemato and MTX transport Tamura et al. (2006) C592A Impaired function and expression Henriksen et al. (2005b) C592A/C608A Restored plasma mb expression; MTX transport normal, BODIPY-prazosin impaired Henriksen et al. (2005b) C603A Disulfide bridge; no functional or membrane targeting change Henriksen et al. (2005b) C608A Impaired function and expression Henriksen et al. (2005b) D620N Did not effect Hemato and MTX transport Tamura et al. (2006) H630X No change in transport Miwa et al. (2003) Cand N-terminal truncated Impaired trafficing Takada et al. (2005) with the ligand. Login to comment

PMID: 18430864 [PubMed] Liu Y et al: "Effect of cysteine mutagenesis on the function and disulfide bond formation of human ABCG2."

No. Sentence Comment

111 Mutation of one or two of these residues (I2-CL, C284A, and C374A) did not signifi- TABLE 1 Primers used for construction of cysless mutants Mutations Primer Sequence RESa C43A TTTCATAACATTGCCTATCGAGTAAAACTGAAG BsrDI C55A GCTTTCTACCTGCACGAAAACCAGTTGAG BsgI C119A GCCAATTTCAAAGCGAATTCAGGTTACGTGG EcoRI C284A GAATCAGCTGGATATCACGCTGAGGCCTATAATAAC EcoRV C374A ACACCACCTCCTTCGCTCATCAACTCAGATG None C438A CTGACGACCAACCAAGCTTTCAGCAGTGTTTC HindIII C491A TATATTTACCGCTATAGTATACTTCATGTTAGG AccI C544A CTTCTCATGACGATCGCTTTTGTGTTTATGATG PvuI C592A GGACAAAACTTCGCCCCGGGACTCAATGCAA SmaI C603A/C608A AGGAAACAATCCTGCTAACTATGCAACAGCTACTGGCGAAGAATATTT -NspI C635A CACGTGGCCTTGGCTGCAATGATTGTTATTTTC BsrDI a Restriction (RES) enzyme digestion sites engineered in the primer for the convenience of detection. Login to comment
112 The primer sequence for the C603A/C608A mutant does not contain the NspI site present in the wild-type sequence. Login to comment
131 To test this hypothesis, we engineered another construct that has all three cysteine residues in the third extracellular loop mutated to alanine (C592A, C603A, and C608A) to determine whether dimers linked by intermolecular disulfide bonds exist with this mutant. Login to comment

PMID: 18644784 [PubMed] Ozvegy-Laczka C et al: "Interaction with the 5D3 monoclonal antibody is regulated by intramolecular rearrangements but not by covalent dimer formation of the human ABCG2 multidrug transporter."

No. Sentence Comment

8 However, disruption of the intramolecular S-S bridge (in C592A, C608A, or C592A/C608A mutants) in this loop abolished 5D3 binding, whereas the function of the protein was preserved. Login to comment
55 To obtain a cell line showing higher ABCG2-C592A/C608A expression, HEK- C592A/C608A cells were sorted based on rhodamine123 extrusion capacity in a FACSAria flow cytometer. Login to comment
56 The sorted HEK- C592A/C608A cell line was used throughout this study. Login to comment
168 Fig. 4A shows that all Cys-to-Ala mutants (except for C603A/ C608A that was expressed in very low amount and exclusively in an underglycosylated form) could be detected by Western blotting, using the ABCG2-specific BXP-21 antibody. Login to comment
169 The mutants C592A and C603A showed expression levels comparable to that of the wild-type ABCG2, whereas the amount of double mutant C592A/C608A or the triple Ala mutant proteins was about 50% of that seen for the wild-type ABCG2. Login to comment
173 Hoechst 33342 and pheophorbide A were transported by all of the mutants (except for C603A/C608A); however, the mitoxantrone transport capacity of the mutants, lacking the intramolecular or both disulfide bonds, was significantly weaker than that of the R482G or C603A variants. Login to comment
176 When cells expressing the different Cys-to-Ala mutants were labeled with the 5D3 antibody, we found that only the C603A variant had a clearly detectable 5D3 labeling and the C592A/ C608A mutant showed some weak 5D3 binding capacity (Fig. 5A, upper panel). Login to comment
177 Similar to that seen in the case of the wild-type ABCG2, PFA fixation (Fig. 5A, lower panel) or Ko143 treatment (not shown) of the cells expressing the C603A mutant and the double mutant C592A/C608A resulted in an increased 5D3 binding. Login to comment
180 Fig. 5B shows that all mutants could be detected by the BXP-21 antibody, recognizing an intracellular epitope of ABCG2, and all of them were present in the plasma membrane (except for the hardly expressed C603A/C608A double mutant, which was found, for the most part, intracellularly). Login to comment
181 However, 5D3 labeling analyzed by confocal microscopy gave the same result as the flow cytometry measurements, that is, only the cells expressing the wild-type ABCG2, C603A, and the C592A/ C608A variants (the latter one seen only at increased detector voltage) could bind the 5D3 antibody. Login to comment
184 We found that, in contrast to a 30-40% inhibition found in the case of the wild-type ABCG2, 5D3 did not influence the Hoechst 33342 transport activity of the C592A/C608A and C592A/C603A/C608A mutants (data not shown). Login to comment
185 All of these data strongly suggest that the ABCG2 mutant proteins lacking the cysteines required for intramolecular S-S bridge forma- TABLE 1 Effects of protein cross-linkers on 5D3 binding, transport activity, and covalent dimer formation of ABCG2 Cross-linker Side chains cross-linked Spacer arm length Increased 5D3 binding Inhibition of transport function Cross-linked ABCG2 on Western blot Å BM͓PEO͔3 SH2-H2 14.7 Yes Yes Yes BMPH CH3-SH2 8.1 Yes Yes No EDC COOH-NH2 0 Yes No No Sulfo-EGS NH2-NH2 16.1 No No Yes Sulfo-MBS NH2-SH2 9.9 Yes No Yes PMPI SH2-OH 8.7 Yes No Yes Interaction of ABCG2 with the 5D3 Monoclonal Antibody 26064 tion are expressed in comparable amounts, reach the cell surface, and work as active transporters in a manner similar to the wild-type ABCG2, but these variants (except for the C592A/ C608A mutant showing weak 5D3 binding) are unable to bind the 5D3 antibody. Login to comment
186 Effect of DTT on 5D3 Labeling of the Cys-to-Ala Mutants-To test whether decreased 5D3 binding in ABCG2-expressing cells treated with DTT was due to the reduction of the extracellular cysteines, we also examined the effect of DTT on 5D3 labeling of the mutants C603A and C592A/C608A in native or PFA-fixed cells. Login to comment
187 Fig. 6, A and B, shows that DTT is still effective in the reduction of 5D3 binding in the case of the C603A mutant but has practically no effect on 5D3 labeling of the C592A/C608A mutant. Login to comment
199 Interaction of ABCG2 with the 5D3 Monoclonal Antibody SEPTEMBER 19, 200•VOLUME 283•NUMBER 38 JOURNAL OF BIOLOGICAL CHEMISTRY 26065 in 5D3 binding that reached its minimum (almost the fluorescence of the background) at 10-50 mM DTT in ABCG2 and C603A-expressing cells, whereas DTT had no effect on labeling of the C592A/C608A double mutant (Fig. 6C). Login to comment
234 To find out which disulfide bridge is important for epitope formation, we analyzed different Cys-to-Ala mutants lacking the intermolecular (C603A), the intramolecular (C592A, C608A, C592A/C608A), or both kinds of (C592A/C603A, C603A/C608A, or C592A/ C603A/C608A) S-S bonds. Login to comment
245 Fluorescence was acquired using the same equipment settings, except the slide representing 5D3 labeling of C592A/C608A was taken at an increased detector voltage. Login to comment
249 The single mutants, lacking the intramolecular S-S bond, i.e. C592A, C608A, as well as the C592A/C603A/C608A variant, had clearly detectable expression levels, were present in the plasma membrane, and were functional for active transport with somewhat altered substrate specificities (Figs. 4 and 5). Login to comment
255 In our experiments we were able to express C592A and C608A mutants in comparable levels to the wild-type ABCG2. Login to comment
265 Interaction of ABCG2 with the 5D3 Monoclonal Antibody 26068 ing; they detected no 5D3 labeling by confocal microscopy for C592A, C608A, and the C592A/C608A double mutant. Login to comment
267 However, in our hands the C592A/ C608A double mutant showed a weak 5D3 binding both in flow cytometry and confocal microscopy, and the 5D3 shift upon PFA or Ko143 treatment could also be observed (Fig. 5). Login to comment
268 DTT had no effect on the 5D3 labeling of the C592A/C608A variant (Fig. 6), and the excess amount of 5D3 did not inhibit the function of this mutant. Login to comment

PMID: 20812902 [PubMed] Ni Z et al: "Structure and function of the human breast cancer resistance protein (BCRP/ABCG2)."

No. Sentence Comment

297 Ala substitution of Cys592 and Cys608 has been shown to impair plasma membrane targeting and function of BCRP; however, the double mutation (C592A/C608A) partially restored plasma membrane expression [82]. Login to comment

PMID: 25036722 [PubMed] Szafraniec MJ et al: "Determinants of the activity and substrate recognition of breast cancer resistance protein (ABCG2)."

No. Sentence Comment

209 Position Type of mutation Effect on the transporter References NBD Lys 86 Met (i) No stimulation of the ATPase activity by prazosin; (ii) no influence on the transport of mitoxantrone Henriksen et al. (2005b) Glu 126 stop, Phe 208 Ser, Ser 248 Phe, Glu 334 stop Inability to transport hematoporphyrin Tamura et al. (2006) Glu 211 Gln Complete abolishment of the ATPase activity and methotrexate transport Hou et al. (2009) Pro 392 Ala Significant reduction in the efflux activity of mitoxantrone, BODIPY-prazosin and Hoechst 33342 Ni et al. (2011) TM1 Gly 406 Ala Gly 410 Ala No influence on the activity of the transporter Polgar et al. (2004) Gly 406 Leu Gly 410 Leu (i) Loss of the ability to transport rhodamine123; (ii) impaired transport of mitoxantrone, Pheide and BODIPY-prazosin Polgar et al. (2004) Extracellular loop 1 Phe 431 Leu (i) Loss of the ability to transport methotrexate; (ii) 10% level of hematoporphyrin transport compared to the WT protein Tamura et al. (2006) Ser 441 Asn Inability to transport hematoporphyrin Tamura et al. (2006) Ser 441 Asn Loss of the ability to transport methotrexate Tamura et al. (2006) TM2 Lys 452 Ala His 457 Ala Increase in transport of mitoxantrone, BODIPY-prazosin and Hoechst 33342 Cai et al. (2010) Lys 453 Ala Arg 465 Ala Decrease in transport of mitoxantrone, BODIPY-prazosin, Hoechst 33342, doxorubicin, SN-38 and rhodamine 123 Cai et al. (2010) TM3 Arg 482 Gly Arg 482 Thr (i) No change in the inhibitory activity of lapatinib; (ii) about two times greater inhibition by ritonavir, saquinavir and nalfinavir than in the WT variant; (iii) gaining the ability to transport rhodamine123 and doxorubicin; (iv) no influence on the transport of mitoxantrone; (v) loss of the ability to transport methotrexate Dai et al. (2008), Gupta et al. (2004), Honjo et al. (2001), Mitomo et al. (2003) Arg 482 Thr (i) Lower IC 50 of cyclosporine A for mutant than for WT variant; (ii) lower elacridar inhibition potency Xia et al. (2007) Arg 482 Lys Complete loss of transport activity Ejendal et al. (2006) Phe 489 Leu Impaired transport of porphyrins, no transport of methotrexate Tamura et al. (2006) Extracellular loop 3 Asn 590 Tyr Over twice reduced transport of mitoxantrone, topotecan, daunorubicin and rhodamine 123 Vethanayagam et al. (2005) Cys 592 Ala/Cys 608 Ala (i) Transport of mitoxantrone almost unchanged; (ii) transport of BODIPY-prazosin significantly impaired Henriksen et al. (2005a) Extracellular loop 3 Cys 603 Ser Cys 592 Ser/Cys 608 Ser Cys 592 Ser/Cys 603 Ser/Cys 608 Ser Diminished susceptibility to the inhibitory activity of fumitremorgin C Shigeta et al. (2010) Cys-less Arg 482 Gly-BCRP Complete loss of the ability to efflux mitoxantrone Liu et al. (2008b) The positions of the amino acid residues refer to the topological model of BCRP proposed by Wang et al. (2009). Login to comment
226 The substitution of Cys603 by Ala caused the transporter to migrate electrophoretically as a monomer, which is not the case when substituting Cys592 or Cys608 by Ala. Login to comment
227 A double mutant protein Cys592 Ala/Cys608 Ala was rendered unable to transport BODIPY-prazosin, while the transport of mitoxantrone remained almost unchanged. Login to comment