ABCMdb

ABCG2 p.Phe489Leu

None has been submitted yet.

Publications

PMID: 15475413 [PubMed] Kobayashi D et al: "Functional assessment of ABCG2 (BCRP) gene polymorphisms to protein expression in human placenta."

No. Sentence Comment

110 Of these, five SNPs resulted in the following amino acid substitutions: G34A (Val12Met), C376T (Gln126stop), C421A (Gln141Lys), G1322A (Ser441Asn), and T1465C (Phe489Leu). Login to comment
112 C376T, which is associated with an amino acid substitution from Gln to a stop codon at codon 126 (Gln126stop), was detected in only two placental samples (1.0%) as TABLE 1 Genetic polymorphism in the BCRP gene in Japanese placentas (n ϭ 100) Location Positiona Reference Alleleb Variant Allele Amino Acid Substitution Genotype Frequency of Variant Allele R/R R/V V/V 5Ј-Flanking region -20445 gtctCctcc gtctTctcc 98 2 0 0.010 -20296 agctAttaa agctGttaa 80 18 2 0.110 -19781 aaaaAttat aaaaGttat 99 1 0 -19572_-19569 ctcaCTCAcaaa ctca--caaa 60 33 7 0.235 Exon 2 34 cccaGtgtc cccaAtgtc Val12Met 70 24 6 0.180 Intron 2 203 ϩ 16 tttaAttta tttaGttta 70 24 6 0.180 Intron 3 263 ϩ 10 tataAgaga tataGgaga 85 14 1 0.080 263 ϩ 72 ttttGtgtg ttttTGtgtg 99 1 0 0.005 Exon 4 376 ggtaCaagt ggtaTaagt Gln126stop 98 2 0 0.010 Exon 5 421 cttaCagtt cttaAagtt Gln141Lys 42 45 13 0.355 Intron 5 532-16 ttatAatat ttatGatat 99 1 0 0.005 Exon 9 1098 aggaGatca aggaAatca Synonymous 98 2 0 0.010 Intron 10 1277 ϩ 95 atagTgtaa atagAgtaa 97 3 0 0.015 Exon 11 1322 agcaGtgtt agcaAtgtt Ser441Asn 99 1 0 0.005 Intron 11 1367 ϩ 20 ttctAggaa ttctGggaa 71 25 4 0.165 Exon 12 1465 tataTttac tataCttac Phe489Leu 99 1 0 0.005 Intron 12 1492 ϩ 49 ctatGggtg ctatCggtg 44 45 11 0.335 Exon 13 1515 atgcCttct atgc-ttct Phe506Ser 99 1 0 0.005 Phe507Leu Val508Leu Met509stop Intron 13 1648-42 tgaaAttac tgaaTttac 99 1 0 0.005 1648-21 gactCttag gactTttag 71 25 4 0.165 Intron 14 1738-46 tcttAaaat tcttGaaat 24 52 24 0.500 3Ј-UTR 2332 cttcAgtct cttcTAgtct 86 14 0 0.070 2364 tgccAttat tgccCttat 99 1 0 0.005 2512 agaaCttac agaaTttac 99 1 0 0.005 R, reference allele; V, variant allele. Login to comment

PMID: 15553238 [PubMed] Kondo C et al: "Functional analysis of SNPs variants of BCRP/ABCG2."

No. Sentence Comment

26 On analyzing the specimens from the 100 Japanese volunteers, 7 kinds of SNPs were identified for the BCRP gene: G34A (V12M), C376T (Q376Stop), C421A (Q141K), G1098A (E366E), G1322A (S441N), T1465C (F489L), and C1515- (AFFVM505-509ASSL Stop). Login to comment

PMID: 15618737 [PubMed] Itoda M et al: "Eight novel single nucleotide polymorphisms in ABCG2/BCRP in Japanese cancer patients administered irinotacan."

No. Sentence Comment

11 MPJ6äAG2017 and MPJ6äAG2020 resulted in amino acid alterations, F431L and F489L, respectively. Login to comment
98 Novel SNPs in the ABCG2 gene found in Japanese individuals SNP name AG2005 AG2007 AG2012 AG2015 AG2017 AG2019 AG2020 AG2023 Intron 2 Intron 3 Intron 6 Exon 9 Exon 11 Intron 11 Exon 12 Intron 13 Position (cDNA) IVS2－93a IVS3＋71ä72 insTb IVS6－204 1098 1291 IVS11－135 1465 IVS13＋65 Nucleotide TÀC -ÀT CÀT GÀA TÀC GÀA TÀC TÀG Amino acid E366E F431L F489L Frequency, z T:97.5 -:99.2 C:96.7 G:99.2 T:99.2 G:98.3 T:99.2 G:99.2 C:2.5 T:0.8 T:3.3 A:0.8 C:0.8 A:1.7 C:0.8 A:0.8 a Numbers following IVS (intervening sequence) represents number of the preceding exon. In the case of end of the intron, the SNP position is expressed by a minus sign and the bases upstream of the next exon. Login to comment
107 Of these SNPs, two SNPs, MPJ6äAG2017 and 020, that were each found in 1 subject, introduced nonsynonymous amino acid changes (F431L and F489L), respectively. Login to comment
121 (G) Homozygous wild-type and wild-typeW1465TÀC (F489L) (MPJ6äG2020). Login to comment

PMID: 15882131 [PubMed] Lepper ER et al: "Mechanisms of resistance to anticancer drugs: the role of the polymorphic ABC transporters ABCB1 and ABCG2."

No. Sentence Comment

157 Position in gene* Nucleotide‡ Region Wild-type allele Variant allele Amino acid Change -19572 to -19569 5`-Flanking region CTCA - CTCA deletion -19202 5` UTR G C -18845 5` UTR T C -18604 5` UTR A - Deletion -18482 -113 Exon 1 C T Non-coding -18398 -29 Exon 1 A G Non-coding 34 34 Exon 2 G A 12 Val to Met 71 71 Exon 2 C T 24 Ala to Val 114 114 Exon 2 T C 38 Synonymous 239 Intron 2 A G 7268 Intron 2 T C 7420 Intron 3 - T Insertion 8007 Intron 3 G A 8184 369 Exon 4 C T 123 Synonymous 8191 376 Exon 4 C T 126 Gln to Term 8825 421 Exon 5 C A 141 Gln to Lys 8862 458 Exon 5 C T 153 Thr to Met 8878 474 Exon 5 C T 158 Synonymous 8900 496 Exon 5 C G 166 Gln to Glu 18186 Intron 5 A G 18286 616 Exon 6 A C 206 Ile to Leu 18293 623 Exon 6 T C 208 Phe to Ser 21530 Intron 6 C T 21718 Intron 6 A G 21903 Intron 7 A G 24618 Intron 7 T A 26297 1098 Exon 9 G A 366 Synonymous 38389 1291 Exon 11 T C 431 Phe to Leu 38485 Intron 11 A G 40111 Intron 11 G A 40303 1425 Exon 12 A G 475 Synonymous 40322 1444 Exon 12 A G 482 Arg to Gly 40323 1445 Exon 12 G C 482 Arg to Thr 40343 1465 Exon 12 T C 489 Phe to Leu 40419 Intron 12 G T 42314 Intron 13 T G 44997 Intron 14 A G 45022 Intron 14 C T 45073 1768 Exon 15 A T 590 Asn to Tyr 47355 1858 Exon 16 G A 620 Asp to Asn 47734 2237 Exon 16 G T Non-coding 47890 2393 Exon 16 G T Non-coding 47891 2394 Exon 16 C A Non-coding ABC: ATP-binding cassette; UTR: Untranslated region. Login to comment

PMID: 16160819 [PubMed] Ishikawa T et al: "Pharmacogenomics of the human ABC transporter ABCG2: from functional evaluation to drug molecular design."

No. Sentence Comment

113 These contradictory expression and localization data for ABCG2 variants indicate that differences in transfection conditions (transient or stable expression), the copy number of cDNA incorporated in genomic DNA or other cellular determinants may variably Table 2 Frequencies of ABCG2 alleles in different ethnic groups Position Ethnic group Variant allele Allele Reference Amino acid cDNA N Hetero Homo Frequency (%) V12M c.34G>A Japanese 29 9 1 19.0 Imai et al. (2002) Japanese 10 - - 15.0 Zamber et al. (2003) Japanese 220 61 8 17.5 Kobayashi et al. (2005) Chinese 10 - - 20.0 Zamber et al. (2003) Southeast Asians 10 - - 45.0 Zamber et al. (2003) Pacific Islanders 7 - - 64.0 Zamber et al. (2003) Swedish 60 2 0 1.7 B¨ackstr¨om et al. (2003) Dutch 100 11 1 6.5 Bosch et al. (2005) Caucasian 86 - - 2.0 Zamber et al. (2003) Caucasian 150 27 2 10.3 Mizuarai et al. (2004) Caucasian 150 11 0 3.7 Kobayashi et al. (2005) Ashkenazi Jewish 10 - - 10.0 Zamber et al. (2003) Middle Eastern 20 - - 5.0 Zamber et al. (2003) Africans North of Sahara 7 - - 14.0 Zamber et al. (2003) African American 150 17 1 6.3 Kobayashi et al. (2005) Mexicans 10 - - 10.0 Zamber et al. (2003) Hispanic Livers 5 - - 40.0 Zamber et al. (2003) Mexican Indians 5 - - 90.0 Zamber et al. (2003) Q126Stop c.376C>T Japanese 124 3 0 1.2 Imai et al. (2002) Japanese 60 2 0 1.7 Itoda et al. (2003) Japanese 220 4 0 0.9 Kobayashi et al. (2005) Caucasian 150 0 0 0.0 Mizuarai et al. (2004) Caucasian 150 0 0 0.0 Kobayashi et al. (2005) African American 150 0 0 0.0 Kobayashi et al. (2005) Q141K c.421C>A Japanese 124 48 9 26.6 Imai et al. (2002) Japanese 10 - - 35.0 Zamber et al. (2003) Japanese 220 90 27 32.7 Kobayashi et al. (2005) Chinese 95 43 11 34.2 de Jong et al. (2004) Chinese 10 - - 35.0 Zamber et al. (2003) Southeast Asians 10 - - 15.0 Zamber et al. (2003) Pacific Islanders 7 - - 14.0 Zamber et al. (2003) Swedish 60 10 1 10.0 B¨ackstr¨om et al. (2003) Dutch 100 20 2 12.0 Bosch et al. (2005) Caucasian 85 - - 14.0 Zamber et al. (2003) Caucasian 172 33 3 11.3 de Jong et al. (2004) Caucasian 150 22 2 8.7 Mizuarai et al. (2004) Caucasian 150 25 4 11.0 Kobayashi et al. (2005) Ashkenazi Jewish 10 - - 5.0 Zamber et al. (2003) Middle Eastern 20 - - 13.0 Zamber et al. (2003) Africans North of Sahara 7 - - 0.0 Zamber et al. (2003) African, Sub-Saharan 938 14 1 0.9 de Jong et al. (2004) African American 24 - - 0.0 Zamber et al. (2003) African American 150 5 1 2.3 Kobayashi et al. (2005) African American 94 8 1 5.3 de Jong et al. (2004) Mexicans 10 - - 5.0 Zamber et al. (2003) Hispanic Livers 5 - - 10.0 Zamber et al. (2003) Mexican Indians 5 - - 10.0 Zamber et al. (2003) R160Q c.479G>A Dutch 100 1 0 0.5 Bosch et al. (2005) I206L c.616A>C Japanese 10 - - 0.0 Zamber et al. (2003) Chinese 10 - - 0.0 Zamber et al. (2003) Southeast Asians 10 - - 0.0 Zamber et al. (2003) Pacific Islanders 7 - - 0.0 Zamber et al. (2003) Caucasian 65 - - 0.0 Zamber et al. (2003) Table 2 Continued Position Ethnic group Variant allele Allele Reference Amino acid cDNA N Hetero Homo Frequency (%) Ashkenazi Jewish 10 - - 0.0 Zamber et al. (2003) Middle Eastern 20 - - 0.0 Zamber et al. (2003) Africans North of Sahara 7 - - 0.0 Zamber et al. (2003) African American 15 - - 0.0 Zamber et al. (2003) Mexicans 10 - - 0.0 Zamber et al. (2003) Hispanic Livers 5 - - 10.0 Zamber et al. (2003) Mexican Indians 5 - - 0.0 Zamber et al. (2003) F431L c.1291T>C Japanese 60 1 0 0.8 Itoda et al. (2003) S441N c.1322G>A Japanese 100 1 0 0.5 Kobayashi et al. (2005) F489L c.1465T>C Japanese 60 1 0 0.8 Itoda et al. (2003) Japanese 100 1 0 0.5 Kobayashi et al. (2005) R575Stop c.1723C>T Dutch 100 1 0 0.5 Bosch et al. (2005) N590Y c.1768A>T Caucasian 65 - - 1.0 Zamber et al. (2003) Caucasian 150 1 0 0.3 Mizuarai et al. (2004) African Americans 15 - - 0.0 Zamber et al. (2003) D620N c.1858G>A Dutch 100 1 0 0.5 Bosch et al. (2005) affect the cellular processing and sorting of these proteins. Login to comment

PMID: 16259577 [PubMed] Sakurai A et al: "Genetic polymorphisms of ATP-binding cassette transporters ABCB1 and ABCG2: therapeutic implications."

No. Sentence Comment

210 In different ethnic groups, seven naturally-occurring non-synonymous SNPs have been reported: V12M, Q126Stop, Q141K, I206L, F431L, S441N, F489L, N590Y and D620N. Login to comment
213 Some of the above sequence variations showed an allele frequency of ~ 1% in distinct populations, Q126stop and F489L in the Japanese and N590Y in the Caucasian population [129-131,134,135], whereas most of the mutations were only detected in single individuals (e.g., I206L, F431L, S441N, D620N). Login to comment
225 Location Position Allele Amino acid Allele frequency in Caucasian populations Allele frequency in Japanese populatins Allele frequency in African populations n % n % n % Exon 2 34 G A 12 Val 12 Met 546 94.4 5.6 259 82.4 17.6 181 93.7 6.3 Exon 4 376 C T 126 Gln 126 stop 300 100 0 404 98.9 1.1 150 100 0 Exon 5 421 C A 141 Gln 141 Lys 717 89.0 11.0 354 69.4 30.6 1213 98.6 1.4 Exon 5 479 G A 160 Arg 160 Gln 100 99.5 0.5 ND ND ND ND ND ND Exon 11 1291 T C 431 Phe 431 Leu ND ND ND 60 99.2 0.8 ND ND ND Exon 11 1322 G A 441 Ser 441 Asn ND ND ND 100 99.5 0.5 ND ND ND Exon 12 1465 T C 489 Phe 489 Leu ND ND ND 160 99.4 0.6 ND ND ND Exon 14 1723 C T 575 Arg 575 stop 100 99.5 0.5 ND ND ND ND ND ND Exon 15 1768 A T 590 Asn 590 Tyr 215 99.5 0.5 ND ND ND 15 100 0 Exon 16 1858 T A 620 Asp 620 Asp 100 99.5 0.5 ND ND ND ND ND ND Data are from [129-135,137]. Login to comment
250 COOH H2N N590Y V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L F489L D620N R482G R482T S441N F571I EXTRACELLULAR INTRACELLULAR R160Q R575stop ATP-binding site (transient or stable expression), the copy number of cDNA incorporated in genomic DNA or other cellular determinants may variably affect the cellular processing and sorting of these proteins. Login to comment

PMID: 16303243 [PubMed] Yanase K et al: "Functional SNPs of the breast cancer resistance protein-therapeutic effects and inhibitor development."

No. Sentence Comment

92 Therefore, we first Table 3 SNPs within the BCRP gene Variation Region Effect Domain A-1379G 50 -flanking (promoter) - D-654-651 50 -flanking (promoter) - G-286C 50 -flanking (promoter) - T-476C Exon 1 (50 - UTR) - D-235A Exon 1 (50 - UTR) - A-113G Exon 1 (50 - UTR) - A-29G Exon 1 (50 - UTR) - G34A Exon 2 V12M N-terminal T114C Exon 2 No change N-terminal G151T Exon 2 G51C N-terminal C369T Exon 4 No change NBD C376T Exon 4 Q126stop NBD C421A Exon 5 Q141K NBD C458T Exon 5 T153M NBD C474T Exon 5 No change NBD C496G Exon 5 Q166E NBD A564G Exon 6 No change NBD A616C Exon 6 I206L NBD T623C Exon 6 F208S NBD T742C Exon 7 S248P Linker G1000T Exon 9 E334stop Linker G1098A Exon 9 No change Linker T1291C Exon 11 F431L TMD A1425G Exon 12 No change TMD T1465C Exon 12 F489L TMD A1768T Exon 15 N590Y TMD G1858A Exon 16 D620N TMD G2237T Exon 16 (30 - UTR) - G2393T Exon 16 (30 - UTR) - Abbreviations: UTR, untranslated region; NBD, nucleotide-binding domain; TMD, transmembrane domain. Login to comment

PMID: 16337740 [PubMed] Cervenak J et al: "The role of the human ABCG2 multidrug transporter and its variants in cancer therapy and toxicology."

No. Sentence Comment

109 To date, altogether eight non-synonymous (V12M, Q141K, I206L, F431L, S441N, F489L, N590Y, D620N), five synonymous (silent) (c.114TOC, c.369COT, c.474COT, c.1098GOA, c.1425AOG) missense mutations, one nonsense (Q126X), and one frameshift (c.1515delC) mutations were identified in the coding region of ABCG2 in healthy individuals or in patients [43-46,49,63-65]. Login to comment
112 Some of the above sequence variations showed an allele frequency of about 1% in distinct populations (Q126X, F489L in the Japanese and N590Y in the Caucasian population [45-47,49,64]), while most of the mutations were only detected in single individuals (missense mutations: I206L, F431L, S441N, D620N, and a frameshift mutation: c.1515delC [44-46,49]). Login to comment
134 g.34GOA (exon 2) c.34GOA V12M Caucasian 150 27 2 10.3G3.5 [47] Caucasian 150 11 0 3.7G2.2 [46] Caucasian 86 n.a n.a 2.0Gn.a [49] Swedish 60 2 0 1.7G2.3 [43] Total Caucasian 360 40 2 6.1G1.8 Japanese 220 61 8 17.5G3.6 [46] Japanese 29 9 1 19.0G10.3 [64] Total Japanese 249 70 9 17.7G3.4 African-American 150 17 1 6.3G2.8 [46] g.8191COT (exon 4) c.376COT Q126X Caucasian 150 0 0 0.0 [46] Caucasian 150 0 0 0.0 [47] Total Caucasian 300 0 0 0.0 Japanese 220 4 0 0.9G0.9 [46] Japanese 124 3 0 1.2G1.4 [64] Japanese 60 2 0 1.7G2.3 [45] Total Japanese 404 9 0 1.1G0.7 African-American 150 0 0 0.0 [46] g.8825CO A (exon 5) c.421COA Q141K Caucasian 172 33 3 11.3G3.4 [63] Caucasian 150 25 4 11.0G3.6 [46] Caucasian 150 22 2 8.7G3.2 [47] Caucasian 85 n.a n.a 14.0Gn.a [49] Swedish 60 10 1 10.0G5.5 [43] Total Caucasian 532 90 10 10.3G1.9 Japanese 220 90 27 32.7G4.5 [46] Japanese 124 48 9 26.6G5.6 [64] Chinese 95 43 11 34.2G6.9 [63] Total Asian 439 181 47 31.3G3.1 African, Sub-Saharan 938 14 1 0.9G0.4 [63] African-American 150 5 1 2.3G1.7 [46] African-American 94 8 1 5.3G3.3 [63] Total Africanc 1182 27 3 1.4G0.5 g.40645AO T (exon 12) c.1465TOC F489L Japanese 100 1 0 0.5G1.0 [46] Japanese 60 1 0 0.8G1.7 [45] Total Japanese 160 2 0 0.6G0.9 g.45367AO T (exon 15) c.1768AOT N590Y Caucasian 150 1 0 0.3G0.7 [47] Caucasian 65 1 0 0.8G1.5 [49] Total Caucasian 215 2 0 0.5G0.7 Only those cDNA SNPs were listed that were detected in at least two independent studies. Login to comment

PMID: 16402910 [PubMed] Krishnamurthy P et al: "Role of ABCG2/BCRP in biology and medicine."

No. Sentence Comment

301 Three of these resulted in the amino acid substitutions F431L, F489L, and S441N. Login to comment

PMID: 16608919 [PubMed] Tamura A et al: "Functional validation of the genetic polymorphisms of human ATP-binding cassette (ABC) transporter ABCG2: identification of alleles that are defective in porphyrin transport."

No. Sentence Comment

2 In the present study, based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells. Login to comment
4 We herein provide evidence that the variants Q126stop, F208S, S248P, E334stop, and S441N are defective in porphyrin transport, whereas F489L exhibited impaired transport, approximately 10% of the activity observed for the wild type. Login to comment
6 Thus, among those genetic polymorphisms of ABCG2, at least the hitherto validated alleles of Q126stop, S441N, and F489L are suggested to be of clinical importance related to the potential risk of porphyria. Login to comment
36 We herein provide evidence that the variants Q126stop, F208S, S248P, E334stop, S441N, and F489L are defective or impaired in the transport of porphyrins, suggesting that those genetic polymorphisms in the ABCG2 gene may be related to the risk of certain diseases resulting from disruption of porphyrin homeostasis. Login to comment
82 GC indicates the percentage of guanine and cytosine contents in the PCR primer set. Tm shows the melting temperature (Tm) for each PCR primer set. Variant and Primers Primer Sequence (5Ј 3 3Ј) Primer Length GC Tm bases % °C V12M 33 39 55 Forward CGAAGTTTTTATCCCAATGTCACAAGGAAACAC Reverse GTGTTTCCTTGTGACATTGGGATAAAAACTTCG G51C 42 35 59 Forward ATCGAGTAAAACTGAAGAGTTGCTTTCTACCTTGTAGAAAAC Reverse GTTTTCGACAAGGTAGAAAGCAACTCTTCAGTTTTACTCGAT Q126stop 40 40 62 Forward GTAATTCAGGTTACGTGGTATAAGATGATGTTGTGATGGG Reverse CCCATCACAACATCATCTTATACCACGTAACCTGAATTAC Q141K 35 42 55 Forward CGGTGAGAGAAAACTTAAAGTTCTCAGCAGCTCTT Reverse AAGAGCTGCTGAGAACTTTAAGTTTTCTCTCACCG T153M 42 40 60 Forward CGGCTTGCAACAACTATGATGAATCATGAAAAAAACGAACGG Reverse CCGTTCGTTTTTTTCATGATTCATCATAGTTGTTGCAAGCCG Q166E 35 42 55 Forward GGATTAACAGGGTCATTGAAGAGTTAGGTCTGGAT Reverse ATCCAGACCTAACTCTTCAATGACCCTGTTAATCC I206L 36 44 59 Forward CTTATCACTGATCCTTCCCTCTTGTTCTTGGATGAG Reverse CTCATCCAAGAACAAGAGGGAAGGATCAGTGATAAG F208S 35 45 55 Forward TGATCCTTCCATCTTGTCCTTGGATGAGCCTACAA Reverse TTGTAGGCTCATCCAAGGACAAGATGGAAGGATCA S248P 35 40 55 Forward TTCATCAGCCTCGATATCCCATCTTCAAGTTGTTT Reverse AAACAACTTGAAGATGGGATATCGAGGCTGATGAA E334stop 35 31 55 Forward TCATAGAAAAATTAGCGTAGATTTATGTCAACTCC Reverse GGAGTTGACATAAATCTACGCTAATTTTTCTATGA F431L 28 60 62 Forward AGCTGGGGTTCTCCTCTTCCTGACGACC Reverse GGTCGTCAGGAAGAGGAGAACCCCAGCT S441N 34 47 59 Forward AACCAGTGTTTCAGCAATGTTTCAGCCGTGGAAC Reverse GTTCCACGGCTGAAACATTGCTGAAACACTGGTT F489L 46 34 62 Forward GAGGATGTTACCAAGTATTATACTTACCTGTATAGTGTACTTCATG Reverse CATGAAGTACACTATACAGGTAAGTATAATACTTGGTAACATCCTC F571I 36 47 61 Forward GTCATGGCTTCAGTACATCAGCATTCCACGATATGG Reverse CCATATCGTGGAATGCTGATGTACTGAAGCCATGAC N590Y 42 38 62 Forward CATAATGAATTTTTGGGACAATACTTCTGCCCAGGACTCAAT Reverse ATTGAGTCCTGGGCAGAAGTATTGTCCCAAAAATTCATTATG D620N 32 56 62 Forward GGTAAAGCAGGGCATCAATCTCTCACCCTGGG Reverse CCCAGGGTGAGAGATTGATGCCCTGCTTTACC veloped by using Western Lighting Chemiluminescent Reagent Plus (PerkinElmer Life and Analytical Sciences, Boston, MA) and detected by Lumino Imaging Analyzer FAS-1000 (Toyobo Engineering, Osaka, Japan). Login to comment
144 For this purpose, based on the currently available data on SNPs and acquired mutations, we generated variant forms (i.e., V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis. Login to comment
165 In contrast, the F489L variant, that did not transport methotrexate, exhibited impaired hematoporphyrin transport (Vmax ϭ 0.058 nmol/min/mg of protein and Km ϭ 8.6 ␮M for F489L versus Vmax ϭ 0.654 nmol/min/mg of protein and Km ϭ 17.8 ␮M for WT). Login to comment
177 as the variants F208S, S248P, S441N, F431L, and F489L were expressed in Flp-In 293 cells. Login to comment
181 Flp-In-293 cells expressing F489L were moderately sensitive to light (Fig. 6), which is consistent with the impaired activity of hematoporphyrin transport by this variant (Fig. 5). Login to comment
184 To gain more insight into the association of ABCG2 variants with cellular resistance to anticancer drugs, we incubated Flp-In-293 cells expressing ABCG2 WT, F431L, S441N, or F489L in the presence of SN-38, mitoxantrone, doxorubicin, or daunorubicin at different concentrations as described under Materials and Methods. Table 3 summarizes the drug resistance profile of those variants-expressing cells. Login to comment
185 Both Flp-In-293/ABCG2 (WT) and Flp-In-293/ABCG2 (F431L) cells were resistant toward SN-38 and mitoxantrone, whereas the resistance ratio of Flp-In-293/ABCG2 (S441N) and Flp-In-293/ABCG2 (F489L) cells were much lower, being close to that of Flp-In-293/Mock cells. Login to comment
186 None of the SNP variants of F431L, S441N, and F489L conferred Flp-In-293 cells resistance to doxorubicin or daunorubicin (Table 3), being different from the acquired mutants of R482G and R482T (Yoshikawa et al., 2004). Login to comment
203 Photosensitivity of Flp-In-293 cells expressing ABCG2 WT, F431L, S441N, or F489L. Login to comment
214 In the present study, based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells. Login to comment
216 The F489L variant showed impaired transport activity (Fig. 5). Login to comment
217 Flp-In-293 cells expressing the F208S, S248P, S441N, and F489L variants were sensitive to light when cells were treated with pheophorbide a. Thus, it is likely that humans with these alleles may be more susceptible to porphyrin-induced phototoxicity. Login to comment
219 The frequencies of the Q126stop, S441N, and F489L alleles are relatively low (less than 2%) compared with those of the V12M and Q141K alleles. Login to comment
221 Likewise, to date, the F489L allele was found only in the Japanese population (Itoda et al., TABLE 2 Porphyrin transport and non-synonymous polymorphisms of ABCG2 Transport of hematoporphyrin and MTX is indicated by either ϩ (positive) or - (negative). Login to comment
224 Potential Risk Amino Acid Transport Allele Frequency cDNA Position Located on Exon Allele Data Sourcea Hemato MTX Wild-Type Allele % V12M ϩϩ ϩϩ 2.0-90.0 34 2 G A 1, 2, 4, 5, 7, 8 ૽૽ Q126stop - - 0.0-1.7 376 4 C T 1, 3, 5, 7 Q141K ϩϩ ϩϩ 0.0-35.5 421 5 C A 1, 2, 4, 5, 6, 7, 8 T153M ϩϩ ϩϩ 3.3 458 5 C T 5 R160Q N.D. N.D. 0.5 479 5 G A 8 Q166E ϩϩ ϩϩ N.D. 496 5 C G NCBI dbSNP rs1061017 I206L ϩϩ ϩϩ 10.0 616 6 A C 2 ૽૽ F208S - - N.D. 623 6 T C NCBI dbSNP rs1061018 ૽૽ S248P - - N.D. 742 7 T C NCBI dbSNP rs3116448 ૽૽ E334stop - - N.D. 1000 9 G T NCBI dbSNP rs3201997 F431L ϩϩ - 0.8 1291 11 T C 3 ૽૽ S441N - - 0.5 1322 11 G A 7 ૽ F489L ϩ - 0.5-0.8 1465 12 T C 3, 7 F571L ϩϩ ϩϩ 0.5 1711 14 T A NCBI dbSNP rs9282571 (૽૽) R575stop N.D. N.D. 0.5 1723 14 C T 8 N590Y ϩϩ ϩϩ 0.0-1.0 1768 15 A T 2, 5 D620N ϩϩ ϩϩ 0.5 1858 16 G A 8 Hemato, hematoporphyrin; NCBI, National Center for Biotechnology Information; N.D., not determined; ૽, risk of porphyria; (૽), potential risk is assumed as the lack of transport activity being as a result of a truncated protein. Login to comment
227 TABLE 3 Drug resistance profiles of ABCG2 WT and variants The drug resistance profiles of ABCG2 WT and variants were obtained by incubating Flp-In-293/ABCG2 WT, F431L, S441N, or F489L cells in the presence of SN-38, mitoxantrone, doxorubicin, or daunorubicin at different concentrations (0-100 ␮M) as described under Materials and Methods. Login to comment
233 Anticancer Drug IC50 and Drug Resistance Ratio Mock WT F431L S441N F489L nM (-fold) SN-38 0.9 Ϯ 0.1 (1.0) 42.1 Ϯ 3.1 (46.8)* 11.5 Ϯ 0.9 (12.7)* 0.7 Ϯ 0.1 (0.8) 3.1 Ϯ 0.3 (3.4) Mitoxantrone 5.2 Ϯ 0.3 (1.0) 99.8 Ϯ 4.5 (19.2)* 20.3 Ϯ 1.9 (4.4)* 4.6 Ϯ 0.5 (0.9) 11.5 Ϯ 0.4 (2.2) Doxorubicin 32.0 Ϯ 0.6 (1.0) 48.1 Ϯ 2.0 (1.5) 39.0 Ϯ 3.5 (1.2) 20.3 Ϯ 1.9 (0.6) 44.6 Ϯ 3.9 (1.4) Daunorubicin 9.5 Ϯ 1.2 (1.0) 17.8 Ϯ 3.9 (1.8) 14.1 Ϯ 0.5 (1.5) 12.1 Ϯ 0.2 (1.3) 16.3 Ϯ 0.9 (1.7) *P Ͻ 0.01. Login to comment
240 Therefore, at least, the validated alleles such as Q126stop, S441N, and F489L with a loss of porphyrin transport activity are at potential risk of diseases. Login to comment
247 Although the F489L variant lacks the activity of methotrexate transport (Fig. 5), it maintains the activity of hematoporphyrin transport at the level of 10% compared with that of WT. Login to comment

PMID: 16702730 [PubMed] Maekawa K et al: "Genetic variation and haplotype structure of the ABC transporter gene ABCG2 in a Japanese population."

No. Sentence Comment

85 115Haplotype Structure in Human ABCG2 (from |1836 to |1175 bp upstream of the translational start site) of the basal promoter,30) and was suggested to inuence irinotecan pharmacokinetics.31) The frequencies of two well-known nonsynonymous SNPs, 34GÀA (Val12Met) and 421CÀA (Gln141Lys), were 0.192 and 0.319 in our study, which were comparable to those in Chinese (0.204 and 0.2220.350, respectively).20,27) However, the frequencies were much higher than those in Caucasians (0.020.065 and 0.080.15), African-Americans (00.09 and 00.05), and a Swedish population (0.02 and 0.1).18,19,21,23,27) Of other relatively rare nonsynonymous SNPs, 376CÀT (Gln126X), 1291TÀC (Phe431Leu), 1322GÀA (Ser441Asn), 1465TÀC (Phe489Leu), and 1515delC (Phe506SerfsX4) were already detected in a Japanese population by Itoda et al.17) andWor Kobayashi et al.,23) but not found in other ethnic groups. Login to comment
141 The thick lines represent the combinations with frequencies over 10z, and the thin lines represent the combinations with frequencies of 1.0 to 9.9z. 118 Keiko MAEKAWA et al. haplotype harboring nonsynonymous SNPs, 1465TÀC (Phe489Leu) (*2), 1291TÀC (Phe431Leu) (*3), 1322GÀA (Ser441Asn)W1515delC (Phe506SerfsX) (*4), and 1723CÀT (Arg575X) (*5), respectively. Login to comment
158 The functional eects of the other ve nonsynonymous SNPs (Ser13Leu, Arg160Gln, Gly354Arg, Phe431Leu, and Phe489Leu) have not yet been characterized. Login to comment

PMID: 16766035 [PubMed] Cascorbi I et al: "Role of pharmacogenetics of ATP-binding cassette transporters in the pharmacokinetics of drugs."

No. Sentence Comment

920 0.165 Exon 12 c. 1465 A>G F489L 0.005 IVS 12 c.1492 G>C ? Login to comment

PMID: 16877258 [PubMed] Wakabayashi K et al: "Human ABC transporter ABCG2 in xenobiotic protection and redox biology."

No. Sentence Comment

176 Based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in Sf9 insect cells. Login to comment
178 The F489L variant showed impaired transport activity. Login to comment
179 Flp-In-293 cells expressing the F208S, S248P, S441N, and F489L variants were sensitive to light when those cells were treated with pheophorbide a (Tamura et al., 2006). Login to comment

PMID: 17015488 [PubMed] Sarkadi B et al: "Human multidrug resistance ABCB and ABCG transporters: participation in a chemoimmunity defense system."

No. Sentence Comment

997 In healthy individuals or patients, altogether eight nonsynonymous (V12M, Q141K, I206L, F431L, S441N, F489L, N590Y, D620N), five synonymous (silent) (c. Login to comment

PMID: 17228519 [PubMed] Tamura A et al: "Genetic polymorphisms of human ABC transporter ABCG2: development of the standard method for functional validation of SNPs by using the Flp recombinase system."

No. Sentence Comment

48 Standard method for functional validation of ABCG2 SNPs Journal of Experimental Therapeutics and Oncology Vol. 6 2006 3 Plasma Membrane inside outside S S S homodimer A B CH2N COOH V12M Q141K F208S S248P F431L S441N F489L R482G R482T Acquired mutation Figure 1. Login to comment
67 PCR primers and conditions for site-directed mutagenesis to create variants of ABCG2 Variant Forward/Reverse Primer sequence (5` →→ 3`) Primer length % GC Tm (ºC) (F/R) primers (bases) V12M F CGAAGTTTTTATCCCAATGTCACAAGGAAACAC 33 39 55 R GTGTTTCCTTGTGACATTGGGATAAAAACTTCG Q141K F CGGTGAGAGAAAACTTAAAGTTCTCAGCAGCTCTT 35 42 55 R AAGAGCTGCTGAGAACTTTAAGTTTTCTCTCACCG F208S F TGATCCTTCCATCTTGTCCTTGGATGAGCCTACAA 35 45 55 R TTGTAGGCTCATCCAAGGACAAGATGGAAGGATCA S248P F TTCATCAGCCTCGATATCCCATCTTCAAGTTGTTT 35 40 55 R AAACAACTTGAAGATGGGATATCGAGGCTGATGAA F431L F AGCTGGGGTTCTCCTCTTCCTGACGACC 28 60 62 R GGTCGTCAGGAAGAGGAGAACCCCAGCT S441N F AACCAGTGTTTCAGCAATGTTTCAGCCGTGGAAC 34 47 59 R GTTCCACGGCTGAAACATTGCTGAAACACTGGTT F489L F GAGGATGTTACCAAGTATTATACTTACCTGTATAGTGTACTTCATG 46 34 62 R CATGAAGTACACTATACAGGTAAGTATAATACTTGGTAACATCCTC Sites of mutagenesis are indicated by underbars. Login to comment
104 Standard method for functional validation of ABCG2 SNPs Journal of Experimental Therapeutics and Oncology Vol. 6 2006 0 1 2 RelativemRNAlevel Mock WT V12M Q141K mRNA A ABCG2 GAPDH Mock WT F208S S248P F431L S441N F489L ABCG2 GAPDH 0 1 2 RelativemRNAlevel mRNA B GAPDH ABCG2 Mock WT F208S S248P F431L S441N F489L Protein 0 1 2 Relativeproteinlevel * * * C DProtein GAPDH ABCG2 0 1 2 Relativeproteinlevel * * Mock WT V12M Q141K Figure 3. mRNA and protein expression levels of ABCG2 WT and variants expressed in Flp-In-293 cells. Login to comment
114 Characterization of V12M, Q141K, F208S, S248P, F431L, S441N, and F489L variants expressed in Flp-In-293 cells The mRNA levels of ABCG2 and GAPDH were measured by quantitative PCR, and the ratios of ABCG2 variants vs. GAPDH were plotted. Login to comment
119 Figure 3 demonstrates mRNA and protein levels of ABCG2 WT and V12M, Q141K, F208S, S248P, F431L, S441N, and F489L variants expressed in Flp-In-293 cells. Login to comment
124 The other variants, i.e., V12M, Q141K, S248P, F431L, and F489L, were expressed in plasma membrane as was ABCG2 WT. Login to comment
132 Figure 4 summarizes the characteristics of those Tamura et al. 8 Journal of Experimental Therapeutics and Oncology Vol. 6 2006 Class Class Class Class WT V12M Q141K F431L S248P F489L F208S S441N R482G R482T Protein expression + + + + + + - - + + SN-38 resistance + + + + + / - - - - + + MX resistance + + + + / - - - - - + + Doxorubicin resistance - - - - - - - - + + Daunorubicin resistance - - - - - - - - + + Figure 4. Login to comment
139 On the other hand, S248P, F431L, and F489L appear to form the second class, where those variant proteins are expressed at normal levels but exhibit different profiles of drug resistance. Login to comment
143 Resistance profile (IC50 ) of ABCG2 Compounds IC50 (nM) Mock WT V12M Q141K F208S S248P F431L S441N F489L SN-38 1.0 ± 0.2 49.9 ± 6.0 51.1 ± 13.8 17.7 ± 0.9 0.7 ± 0.0 3.6 ± 0.4 12.1 ± 1.5 0.8 ± 0.0 3.9 ± 0.4 (49.9)* (51.1)* (17.7)* (0.7) (3.6) (12.1)* (0.8) (3.9) Mitoxantorone 7.0 ± 1.1 108.0 ± 4.9 94.0 ± 18.6 46.7 ± 12.7 5.1 ± 1.0 13.4 ± 1.3 15.2 ± 1.4 5.7 ± 0.8 12.1 ± 6.2 (15.4)* (13.4)* (6.7)* (0.7) (1.9) (2.2)* (0.8) (1.7) Doxorubicin 38.8 ± 3.8 105.2 ± 24.9 123.6 ± 35.3 156.8 ± 27.5 19.9 ± 8.7 23.7 ± 6.7 43.5 ± 6.1 39.4 ± 4.1 47.6 ± 3.1 (2.7) (3.2) (4.0) (0.5) (0.6) (1.1) (1.0) (1.2) Daounorubicin 13.0 ± 0.6 32.3 ± 6.5 58.2 ± 5.0 57.7 ± 4.1 14.1 ± 2.3 22.1 ± 4.2 15.9 ± 1.2 13.3 ± 1.1 23.6 ± 1.6 (2.5) (4.5) (4.4) (1.1) (1.7) (1.2) (1.0) (1.8) Etoposide 117.1 ± 16.0 210.2 ± 18.4 297.3 ± 58.5 233.9 ± 54.2 122.9 ± 17.6 137.7 ± 14.8 139.1 ± 12.3 154.3 ± 8.5 186.9 ± 10.1 (1.8) (2.5) (2.0) (1.0) (1.2) (1.2) (1.3) (1.6) Vincristine 1.8 ± 0.2 4.3 ± 0.3 7.1 ± 1.4 5.6 ± 1.6 0.6 ± 0.0 4.3 ± 0.9 1.8 ± 0.3 0.9 ± 0.1 3.0 ± 0.7 (2.4) (3.0) (3.1) (0.3) (2.4) (1.0) (0.5) (1.7) The drug resistance profiles of ABCG2 WT and variants were obtained by incubating Flp-In-293/ABCG2 WT, V12M, Q141K, F208S, S248P, F431L, S441N, or F489L cells in the presence of SN-38, mitoxantrone, doxorubicin, daunorubicin, etoposide, or vincristine at different concentrations as described in Materials and Methods. Login to comment

PMID: 17297656 [PubMed] Tamura A et al: "Re-evaluation and functional classification of non-synonymous single nucleotide polymorphisms of the human ATP-binding cassette transporter ABCG2."

No. Sentence Comment

3 To re-evaluate the effect of single nucleotide polymorphisms (SNP) of ABCG2 in vitro, we created a total of seven variant cDNAs (V12M, Q141K, F208S, S248P, F431L, S441N and F489L) by site-directed mutagenesis and stably expressed each of them in Flp-In-293 cells using the Flp recombinase system. Login to comment
8 The contributions of the minor SNP variants (F208S, S248P, F431L, S441N and F489L) to drug resistance toward SN-38, mitoxantrone, doxorubicin, daunorubicin or etoposide were significantly lower than wild type. Login to comment
137 Characterization of the F208S, S248P, F431L, S441N and F489L variants expressed in Flp-In-293 cells. Login to comment
138 Figure 2C demonstrates the mRNA and protein levels of WT ABCG2 and the F208S, S248P, F431L, S441N and F489L variants expressed in Flp-In-293 cells. Login to comment
142 The other variants (S248P, F431L and F489L) were expressed in the plasma membrane, as was WT ABCG2. Login to comment
146 On the contrary, the S248P, F431L and F489L variants contributed drug resistance; however, their contribution was not so large as that of WT. Login to comment
155 For this purpose, we expressed WT ABCG2, V12M, Q141K, S248P, F431L, F489L, R482G and R482T in Sf9 insect cells and prepared plasma membranes as described previously,(16,35) as the plasma membrane of Sf9 cells has lower endogenous background ATPase activity than Flp-In-293 cells. Login to comment
176 Resistance profile (IC50) of ABCG2 Compound IC50 (nM) Mock Wild type V12M Q141K F208S S248P F431L S441N F489L SN-38 0.9 40.0 (44.4) 40.0 (44.4) 17.0 (18.9) 0.6 (0.7) 3.0 (3.3) 10.0 (11.1) 0.7 (0.8) 3.1 (3.4) Mitoxantorone 5.2 >100 (>19) 92.0 (17.7) 45.0 (8.7) 4.5 (0.9) 11.0 (2.1) 21.0 (4.0) 4.6 (0.9) 11.0 (2.1) Doxorubicin 32.0 78.0 (2.4) 100.0 (3.1) 110.0 (3.4) 20.0 (0.6) 20.0 (0.6) 40.0 (1.3) 21.0 (0.7) 45.0 (1.4) Daunorubicin 12.0 30.0 (2.5) 50.0 (4.2) 50.0 (4.2) 12.0 (1.0) 21.0 (1.8) 14.0 (1.2) 12.0 (1.0) 19.0 (1.6) Etoposide 110.0 200.0 (1.8) 220.0 (2.0) 200.0 (1.8) 110.0 (1.0) 120.0 (1.1) 120.0 (1.1) 130.0 (1.2) 170.0 (1.5) Vincristine 1.4 4.0 (2.9) 5.0 (3.6) 4.5 (3.2) 0.6 (0.4) 4.0 (2.9) 1.4 (1.0) 0.8 (0.6) 2.8 (2.0) Relative resistances to mock cells are described in parentheses. Login to comment
192 As clearly demonstrated in this study, the F208S, S248P, F431L, S441N and F489L variants exhibited greatly altered protein expression levels (Fig. 2C) or drug resistance profiles (Fig. 4 and Table 1). Login to comment
202 As one of the specific aims of the present study, we functionally classified the non-synonymous polymorphisms (V12M, Q141K, F208S, S248P, F431L, S441N and F489L) in terms of their protein expression level, drug resistance profile and prazosin-stimulated ATPase activity. Login to comment
207 Drug resistance profiles of Flp-In-293 cells expressing the wild-type (WT) BCRP/MXR1/ABCP (ABCG2), F208S, S248P, F431L, S441N or F489L variants toward (A) SN-38 and (B) mitoxantrone. Login to comment
216 Finally, S248P, F431L and F489L appear to form the fourth heterogeneous group, where those variant proteins are expressed at normal levels but exhibit different profiles of drug resistance and transport activity. Login to comment

PMID: 18154452 [PubMed] Sharom FJ et al: "ABC multidrug transporters: structure, function and role in chemoresistance."

No. Sentence Comment

368 A recent study characterized the activity of 18 ABCG2 variants, and concluded that Q126stop, F208S, S248P, E334stop, S441N and F489L are defective in hematoporphyrin transport [170], which may increase the risk of disease in individuals carrying these polymorphisms. Login to comment

PMID: 18159130 [PubMed] Tamura A et al: "In vitro evaluation of photosensitivity risk related to genetic polymorphisms of human ABC transporter ABCG2 and inhibition by drugs."

No. Sentence Comment

8 In the present study, we expressed ABCG2 genetic variants, i.e., V12M, Q141K, S441N, and F489L, as well as the wild type (WT) in Flp-In-293 cells to examine the hypothesis. Login to comment
9 Cells expressing S441N and F489L variants exhibited high levels of both cellularly accumulated pheophorbide a and photosensitivity, when those cells were incubated with pheophorbide a and irradiated with visible light. Login to comment
22 By using plasma membrane vesicles and a high-speed screening system, we precisely evaluated functional changes associated with genetic polymorphisms in vitro.24) Since porphyrins are considered to be endogenous substrates for ABCG2, we have investigated the transport of porphyrins with a total of 18 variant forms of human ABCG2 in the plasma membrane vesicle system.4) As a result, we found that the variants Q126stop, F208S, S248P, E334stop, S441N, and F489L are defective or impaired in the transport of porphyrins. Login to comment
98 Genetic polymorphisms of human ABCG2 and pheophorbide a-photosensitivity In vitro experiments SNP data IC50 (mM) Photosensitivity ratio (fold) Ethnic group N Allele frequency (z) Reference WT 3.0 1.0 - - - - V12M 4.1 0.7 Caucasian 546 5.6 22, 13, 21, 20, 14 Japanese 259 17.6 18, 22, 20 African 181 6.3 22, 20 Q141K 2.9 1.0 Caucasian 717 11.0 22, 13, 21, 15, 20, 14 Japanese 354 30.6 18, 22, 20 African 1213 1.4 22, 15, 14 S441N 0.5 6.0 Japanese 100 0.5 20 F489L 1.7 1.8 Japanese 160 0.6 19, 20 Pheophorbide a-photosensitivity ratios and IC50 values were determined from the data shown in Fig. 2B. 432 Ai TAMURA, et al. a Fluoroskan Ascent FL (Thermo Labsystems, Helsinki, Finland) (excitation at 405 nm; emission at 612 nm). Login to comment
99 Results Expression of ABCG2 WT and SNP variants in Flp-In-293 cells: In the present study, we aimed to examine the impact of hitherto reported major SNPs (V12M, Q141K, S441N, or F489L) on the photo-sensitivity. Login to comment
110 Figure 1B depicts the immuno‰uorescence images of Flp-In-293 cells expressing ABCG2 WT and those SNP variants (i.e., V12M, Q141K, S441N, and F489L) as well as mock vector-transfected cells (Flp-In-293/ Mock). Login to comment
114 In contrast, strong green ‰uorescence was observed at the plasma membrane and within intracellular compartments in Flp-In-293 cells expressing ABCG2 WT as well as the SNP variants of V12M, Q141K, and F489L. Login to comment
120 In addition, the cellular pherophorbide a accumulation in Flp-In-293/ABCG2 (F489L) cells was about the same level as those in Flp-In-293/ABCG2 (S441N) and Flp-In-293/Mock cells at the concentration of 2.5 mM. Login to comment
123 Expression of human ABCG2 WT, V12M, Q141K, S441N, and F489L in Flp-In-293 cells. Login to comment
129 433Genetic Polymorphisms of ABCG2 and Photosensitivity Risk whereas the S441N variant and F489L appeared unable to export pheophorbide a. Login to comment
130 Photosensitivity of Flp-In-293 cells expressing ABCG2 WT and SNP variants: Figure 2B demonstrates the cellular photosensitivity proˆles of Flp-In-293 cells expressing ABCG2 WT, V12M, Q141K, S441N, and F489L, as well as that of Flp-In-293/Mock cells. Login to comment
137 Flp-In-293/ABCG2 (F489L) cells exhibited a moderate photosensitivity in the range between those of Flp-In-293/Mock and Flp-In-293/ABCG2 (WT) cells. Login to comment
141 A, Flp-In-293 cells expressing human ABCG2 WT and SNP variants (V12M, Q141K, S441N, and F489L) were incubated with pheophorbide a at diŠerent concentrations (0, 0.63, 1.25, and 2.5 mM) at 379C for 4 hours. Login to comment
199 Indeed, we reported that the variants Q126stop, F208S, S248P, E334stop, and S441N are defective in the transport of hematoporphyrin.4) The F489L variant showed impaired transport activity. Login to comment
200 As demonstrated in the present study, as well as in our previous one,4) Flp-In-293 cells expressing the F208S, S248P, S441N, and F489L variants were sensitive to light when cells were treated with pheophorbide a. Thus, it is likely that humans with these alleles may be more susceptible to porphyrin-induced phototoxicity. Login to comment

PMID: 18237272 [PubMed] Nakagawa H et al: "Ubiquitin-mediated proteasomal degradation of non-synonymous SNP variants of human ABC transporter ABCG2."

No. Sentence Comment

26 The ABCG2 non-synonymous SNP variants Q126stop, F208S, S248P, E334stop, S441N and F489L were defective in the active transport of methotrexate and haematoporphyrin [18]. Login to comment
27 Furthermore, the F208S, S248P, F431L, S441N, and F489L ABCG2 variants exhibited greatly altered protein expression levels and drug Abbreviations used: ABC, ATP-binding cassette; ABCG2, ABC subfamily G, member 2; BMA, bafilomycin A1; CPT, camptothecin; DMEM, Dulbecco`s modified Eagle`s medium; endo H, endoglycosidase H; ER, endoplasmic reticulum; ERAD, ER-associated degradation; FCS, fetal calf serum; Flp, flippase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HRP, horseradish peroxidase; ME, 2-mercaptoethanol; PNGase F, peptide N-glycosidase F; RT-PCR, reverse transcription-PCR; SN-38, 7-ethyl-10-hydroxycamptothecin; SNP, single nucleotide polymorphism; TBS, Tris-buffered saline; WT, wild-type. Login to comment
208 In a previous study using the Flp recombinase system [33], we functionally characterized the non-synonymous polymorphisms (V12M, Q141K, F208S, S248P, F431L, S441N and F489L) in terms of their protein expression level, drug resistance profile and prazosin-stimulated ATPase activity. Login to comment

PMID: 18249138 [PubMed] Hazai E et al: "Homology modeling of breast cancer resistance protein (ABCG2)."

No. Sentence Comment

245 However, in our model, R482 cannot form interaction with rhodamine, but L484 is in interacting distance Table 3 Mutations on BCRP and their effect on its function Mutation Effect/results Reference V12M Did not effect Hemato and MTX transport Tamura et al. (2006) G51C Did not effect Hemato and MTX transport Tamura et al. (2006) K86M Inactivates transporter (dominant negative effect on ATPase activity); alters subcellular distribution Henriksen et al. (2005a) K86M Transporter inactive, but still able to bind ATP Ozvegy et al. (2002) Q126stop Defective porphyrin transport Tamura et al. (2006) Q141K Did not effect Hemato and MTX transport Tamura et al. (2006) T153M Did not effect Hemato and MTX transport Tamura et al. (2006) Q166E Did not effect Hemato and MTX transport Tamura et al. (2006) I206L Did not effect Hemato and MTX transport Tamura et al. (2006) F208S Defective porphyrin transport Tamura et al. (2006) S248P Defective porphyrin transport Tamura et al. (2006) E334stop Defective porphyrin transport Tamura et al. (2006) F431L Effects MTX transport Tamura et al. (2006) S441N Defective porphyrin transport Tamura et al. (2006) E446-mutants No drug resistance Miwa et al. (2003) R482G, R482T Effects MTX transport Tamura et al. (2006) R482T Substrate drug transport and inhibitor efficiency is not mediated by changes in drug-binding Pozza et al. (2006) R482G, R482T Substitution influence the substrate specificity of the transporter Ozvegy et al. (2002) R482G, R482T Altered substrate specificity Honjo et al. (2001) R482G Methotrexate not transported Chen et al. (2003b) Mitomo et al. (2003) R482G Resistance to hydrophilic antifolates in vitro, G482-ABCG2 mutation confers high-level resistance to various hydrophilic antifolates Shafran et al., (2005) R482G Three distinct drug, binding sites Clark et al. (2006) R482G Altered substrate specificity, granulocyte maturation uneffected Ujhelly et al. (2003) R482 mutants Higher resistance to mitoxantrone and doxorubicin than wt Miwa et al. (2003) R482X Affects substrate transport and ATP hydrolysis but not substrate binding Ejendal et al. (2006) F489L Impaired porphyrin transport Tamura et al. (2006) G553L; G553E Impaired trafficing, expression, and N-linked glycosylation Polgar et al. (2006) L554P Dominant negative effect on drug sensitivity Kage et al. (2002) N557D Resistance to MTX, but decreased transport of SN-38; N557E no change in transport compared to wt Miwa et al. (2003) F571I Did not effect Hemato and MTX transport Tamura et al. (2006) N590Y Did not effect Hemato and MTX transport Tamura et al. (2006) C592A Impaired function and expression Henriksen et al. (2005b) C592A/C608A Restored plasma mb expression; MTX transport normal, BODIPY-prazosin impaired Henriksen et al. (2005b) C603A Disulfide bridge; no functional or membrane targeting change Henriksen et al. (2005b) C608A Impaired function and expression Henriksen et al. (2005b) D620N Did not effect Hemato and MTX transport Tamura et al. (2006) H630X No change in transport Miwa et al. (2003) Cand N-terminal truncated Impaired trafficing Takada et al. (2005) with the ligand. Login to comment

PMID: 18363541 [PubMed] Tamura A et al: "Drug-induced phototoxicity evoked by inhibition of human ABC transporter ABCG2: development of in vitro high-speed screening systems."

No. Sentence Comment

230 Plasma membrane Outside Inside ATP-binding cassette H2 N COOH V12M G51C Q126stop Q141K T153M R160Q Q166E I206L F208S S248P E334stop F431L F489L S441N R482G R482T F571I R575stop N590Y D620N T542A A528T D296H P269S A. Login to comment
231 0.0 0.1 0.2 0.3 0.4 0.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T ATP-dependenthematoporphyrintransport (nmol/min/mgprotein) B. interactions should also take into consideration the presence of multiple flavonoids. Login to comment
245 Based on the presently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells. Login to comment
247 The F489L variant showed impaired transport activity. Login to comment
248 Flp-In-293 cells expressing the F208S, S248P, S441N, and F489L variants were sensitive to light when cells were treated with pheophorbide a [87,88]. Login to comment
249 To further elucidate the significance of ABCG2 in cellular porphyrin homeostasis, we observed the cellular accumulation and compartmentation of porphyrin and pheophorbide a by means of a new fluorescence microscopy technology, and found that the accumulation of porphyrin and pheophorbide a in the cytoplasmic compartment was significantly higher in Flp-In-293 cells expressing S441N and F489L variants, as compared with those expressing WT, V12M, or Q141K [88]. Login to comment
252 Amino acid Porphyrin transport* Allele frequency (%)‡ cDNA position Location Wild-type allele Variant alllele V12M ++ 2.0 - 90.0 34 Exon 2 G A Q126stop - 0.0 - 1.7 376 Exon 4 C T Q141K ++ 0.0 - 35.5 421 Exon 5 C A T153M ++ 3.3 458 Exon 5 C T Q166E ++ N.D. 496 Exon 5 C G I206L ++ 10.0 616 Exon 6 A C F208S - N.D. 623 Exon 6 T C S248P - N.D. 742 Exon 7 T C E334stop - N.D. 1000 Exon 9 G T F431L ++ 0.8 1291 Exon 11 T C S441N - 0.5 1322 Exon 11 G A F489L + 0.5 - 0.8 1465 Exon 12 T C F571L ++ 0.5 1711 Exon 14 T A N590Y ++ 0.0 - 1.0 1768 Exon 15 A T D620N ++ 0.5 1858 Exon 16 G A *Transport of hematoporphyrin is indicated by either '+` (positive) or '-' (negative). Login to comment

PMID: 18464048 [PubMed] Gradhand U et al: "Pharmacogenomics of MRP transporters (ABCC1-5) and BCRP (ABCG2)."

No. Sentence Comment

250 It should be noted that many xeno- and endobiotic BCRP Figure 5 Predicted membrance topology of BCRP (ABCG2) based on hydrophobicity analysis. Locations of the non-synonymous polymorphisms are indicated with arrows. See Table 5 for allele frequencies and description of funtional consequences. NH2 COOH NBD Val12Met Gly51Cys Gln126* Ala149Pro Gln141Lys Thr153Met Arg160Gln Arg163Lys Gln166Glu Phe506Ser Phe507Leu Val508Leu Met509* Phe489Leu Ser441Asn Phe431Leu Glu334* Ile206Leu Ala315del Thr316del Phe208Ser Asp296His Ser248Pro Pro269Ser Phe571Ile Arg575* Asn590Tyr Asp620Asn in out Membrane BCRP (ABCG2) NBD Val12Met NBDNBD Val12Met substrates are also transported by other efflux transporters, especially P-glycoprotein, thus extrapolating BCRP related in vitro data to the in vivo situation may be difficult. Login to comment

PMID: 18668433 [PubMed] Koshiba S et al: "Human ABC transporters ABCG2 (BCRP) and ABCG4."

No. Sentence Comment

225 Based on the currently available data on SNPs and acquired mutations, a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) were created by site-directed mutagenesis and expressed in Sf9 insect cells (Tamura et al. 2006, 2007). Login to comment
233 On the other hand, the F489L variant, that did not transport methotrexate, exhibited impaired haematoporphyrin transport. Login to comment
235 Flp-In-293 cells expressing the F208S, S248P, S441N, and F489L variants were sensitive to light when those cells were treated with pheophorbide a (Tamura et al. 2007). Login to comment

PMID: 18958403 [PubMed] Furukawa T et al: "Major SNP (Q141K) variant of human ABC transporter ABCG2 undergoes lysosomal and proteasomal degradations."

No. Sentence Comment

129 Protein expression levels of the WT and the Q141K variant were determined by immunoblotting after PNGase F treatment in the same way as described above. Login to comment
130 As shown in Fig. 3A, the protein level of the Q141K variant was approximately two-fold enhanced by treatment with the proteasome inhibitor MG132. Login to comment
174 The nonsynonymous SNP variants of Q126stop, F208S, S248P, E334stop, S441N, and F489L were defective in the active transport of methotrexate and hematoporphyrin (42). Login to comment
175 Furthermore, the F208S, S248P, F431L, S441N, and F489L variants exhibited greatly altered protein expression levels and drug resistance profiles (18). Login to comment

PMID: 19111841 [PubMed] Noguchi K et al: "Functions of the breast cancer resistance protein (BCRP/ABCG2) in chemotherapy."

No. Sentence Comment

874 Among these SNPs, with the exception of C376T and C421A, only a few have been studied Table 1 Identified SNPs within the BCRP gene Variation Effect Domain A-1379G - Δ-654/-651 - G-286C - T-476C - Δ-235A - A-113G - A-29G - G34A V12M N-terminal T114C No change N-terminal G151T G51C N-terminal C369T No change NBD C376T Q126stop NBD C421A Q141K NBD C458T T153M NBD C474T No change NBD C496G Q166E NBD A564G No change NBD A616C I206L NBD T623C F208S NBD T742C S248P Linker G1000T E334stop Linker G1098A No change Linker T1291C F431L TMD A1425G No change TMD T1465C F489L TMD A1768T N590Y TMD G1858A D620N TMD G2237T - G2393T - NBD, nucleotide-binding domain; TMD, transmembrane domain. Login to comment

PMID: 19111842 [PubMed] Wakabayashi-Nakao K et al: "Quality control of human ABCG2 protein in the endoplasmic reticulum: ubiquitination and proteasomal degradation."

No. Sentence Comment

950 The non-synonymous SNP variants Q126stop, F208S, S248P, E334stop, S441N, and F489L were defective in the active transport of methotrexate and hematoporphyrin [54]. Login to comment
951 Furthermore, the F208S, S248P, F431L, S441N, and F489L variants exhibited greatly altered protein expression levels and drug resistance profiles [34]. Login to comment

PMID: 19200005 [PubMed] Porcelli L et al: "Intracellular trafficking of MDR transporters and relevance of SNPs."

No. Sentence Comment

206 The polymorphisms T623C (F208S), T742C (S248P), T1291C (F431L) and T1465C (F489L) were studied by Tamura et al. Login to comment

PMID: 19771428 [PubMed] Sai K et al: "Additive effects of drug transporter genetic polymorphisms on irinotecan pharmacokinetics/pharmacodynamics in Japanese cancer patients."

No. Sentence Comment

107 These variations include an amino acid substitution leading to reduced in vitro activity, ABCG2 1465T[C (F489L) [36], and the stop codons, ABCG2 376C[T (Q126X) and 1723C[T (R575X) [28]. Login to comment
124 patients who experienced grade 4 neutropenia ID Gene Genetic variation Nucleotide change (amino acid substitution) Haplotypea b1 ABCB1 304G[C (G102R) Block 1 *3 b2(B)b 1804G[A (D602N) Block 2 *12 b3(B)b 1342G[A (E448K) Block 2 *14 b4 3043A[G (T1015A) Block 2 *16 b5 3751G[A (V1251I) Block 3 *2 c1 ABCC2 1177C[T (R393W) *7 g1 ABCG2 376C[T (Q126X) Block 1 *4 g2 1465T[C (F489L) Block 2 *2 g3 1723C[T (R575X) Block 2 *5 s1(S)c SLCO1B1 1007C[G (P336R) s2 311T[A (M104K) u1 UGT1A1 -3279T[G, 1941C[G # 60-# IB (?/?) Login to comment

PMID: 19827267 [PubMed] Ishikawa T et al: "Human ABC transporter ABCG2 in cancer chemotherapy and pharmacogenomics."

No. Sentence Comment

222 COOH H2N N590Y V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L F489L D620N R482G R482T S441N F571I OUT IN R160Q R575stop ATP-binding site Figure 7. Continued A 005-024 pp JETO-0900616-TI (Review).indd 8/7/2009 3:59:50 19 Q141K has been associated with lower levels of protein expression and impaired transport in vitro (Imai et al., 2002; Kobayashi et al., 2005; Misuarai et al., 2004; Zamber et al., 2003; Morisaki et al., 2008; Kondo et al., 2004). Login to comment
227 The non-synonymous SNP variants Q126stop, F208S, S248P, E334stop, S441N, and F489L were defective in the active transport of methotrexate and hematoporphyrin (Tamura et al., 2006) (Fig. 7C). Login to comment
228 Furthermore, the F208S, S248P, F431L, S441N, and F489L variants exhibited greatly altered protein expression levels and drug resistance profiles Figure 7. Continued WT V12M Q141K F208S S248P F431L S441N F489L R482G R482T Protein expression + + + - + + - + + + MTX transport + + + - - - - +/ - - Porphyrin transport + + + - - + - +/ + + SN-38 resistance + + + - +/ + - - + + MX resistance + + + - - - - - -- - - - - - - - +/ - - - - - - - - + + Doxorubicin resistance + + Daunorubicin resistance + + ATPase activity (Prazosin) + + WTV12M Q141K F431L F489L S248P F208S S441L R482G R482T ∆1.5 ∆3 ∆3.5 ∆5 ∆4 - - - - - - -- - - B 005-024 pp JETO-0900616-TI (Review).indd 8/7/2009 3:59:51 20 Journal of Experimental Therapeutics and Oncology Vol. 8 2009 (Tamura et al., 2007b). Login to comment
232 It is known that, in the ER, the N-linked glycans play pivotal roles in protein fold- 0.0 0.5 1.0 1.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T Methotrexatetransport (nmol/min/mgprotein) Methotrexate 0.0 0.5 1.0 1.5 0.0 0.5 1.0 1.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T Methotrexatetransport (nmol/min/mgprotein) MethotrexateMethotrexate Porphyrintransport (nmol/min/mgprotein) 0.0 0.1 0.2 0.3 0.4 0.5 0.0 0.1 0.2 0.3 0.4 0.5 Porphyrin Figure 7. Login to comment

PMID: 19949922 [PubMed] Cascorbi I et al: "Pharmacogenetics of ATP-binding cassette transporters and clinical implications."

No. Sentence Comment

245 0.165 c. 1465 A>G F489L 0.005 c.1492 G>C ? Login to comment

PMID: 19949928 [PubMed] Ross DD et al: "Impact of breast cancer resistance protein on cancer treatment outcomes."

No. Sentence Comment

93 Tamura et al. used multicolor fluorescence in situ hybridization to assure uniform mRNA expression of cDNAs of seven BCRP SNPs (V12M, Q141K, F208S, S248P, F431L, S441N and F489L) transduced into Flp-In-293 cells (87, 88). Login to comment

PMID: 20812902 [PubMed] Ni Z et al: "Structure and function of the human breast cancer resistance protein (BCRP/ABCG2)."

No. Sentence Comment

249 A systematic study of 18 natural variants of BCRP expressed in insect cells showed that the variants Q126stop, F208S, S248P, E334stop, and S441N were defective in porphyrin transport, whereas F489L displayed approximately 10% of the transport activity of wild-type BCRP [120]. Login to comment

PMID: 21188243 [PubMed] Ishikawa T et al: "Key Role of Human ABC Transporter ABCG2 in Photodynamic Therapy and Photodynamic Diagnosis."

No. Sentence Comment

167 Based on the currently available data on SNPs and acquired mutations, we have created a total of 18 variant forms of ABCG2 (V12M, G51C, Q126stop, Q141K, T153M, Q166E, I206L, F208S, S248P, E334stop, F431L, S441N, R482G, R482T, F489L, F571I, N590Y, and D620N) by site-directed mutagenesis and expressed them in insect cells [41, 90]. Login to comment
169 The F489L variant showed impaired transport activity (Figure 4(b)). Login to comment
170 Flp-In-293 cells expressing the F208S, S248P, S441N, and F489L variants were sensitive to light when cells were treated with pheophorbide a. Login to comment
177 Gefitinib and imatinib are new anticancer drugs Outside Plasma membrane Inside H2N COOH V12M G51C Q126stop Q141K T153M R160Q Q166E I206L F208S S248P E334stop F431L F489L S441N R482G R482T F571I R575stop N590Y D620N T542A A528T D296H P269S ATP-binding cassette (a) 0 0.1 0.3 0.4 0.2 0.5 Mock WT V12M G51C Q126stop Q141K T153M Q166E I206L F208S S248P E334stop F431L S441N F489L F571I N590Y D620N R482G R482T ATP-dependenthematoporphyrin transport(nmol/min/mgprotein) (b) Figure 4: (a) Schematic illustration of human ABCG2 and its nonsynonymous polymorphisms. Login to comment

PMID: 21567408 [PubMed] Nakagawa H et al: "Ubiquitin-mediated proteasomal degradation of ABC transporters: a new aspect of genetic polymorphisms and clinical impacts."

No. Sentence Comment

118 Impact of SNPs on Protein Stability and ERAD of ABCG2 By functional validation in vitro, the above-mentioned 17 nonsynonymous polymorphisms of ABCG2 were classified into four groups.99 The nonsynonymous SNP variants Q126stop, F208S, S248P, E334stop, S441N, and F489L were defective in the active transport of methotrexate and hematoporphyrin.100 The F208S, S248P, F431L, S441N, and F489L variants, on the contrary, exhibited greatly reduced protein expression levels and drug resistance profiles.99 In particular, expression levels of the F208S and S441N variant proteins were markedly low.99 These variant proteins do not undergo Golgi apparatus-mediated glycoprocessing but are passed through the ERAD pathway.78 The immature and nonglycosylated forms of F208S and S441N (Fig. 6a) were detected. Login to comment

PMID: 20103563 [PubMed] Klaassen CD et al: "Xenobiotic, bile acid, and cholesterol transporters: function and regulation."

No. Sentence Comment

6589 Absent C421A Q141K 2 Normal/reduced G445C A149P ↔ Normal G448A R163K ↔ Normal C496G Q166E ↔ Normal/reduced A616C I206L 2↔ Normal T623C F208S N.D. Reduced T742C S248P N.D. Normal C805T P269S 2↔ Normal T1291C F431L 2 Normal/reduced G1322A S441N 2 Reduced T1465C F489L 2↔ Normal/reduced A1768T N590Y 2↔ Increased G1858A D620N 2↔ Normal 2, reduced function; ↔, no change in function; N.D. not determined. Login to comment

PMID: 24388985 [PubMed] Deppe S et al: "Impact of genetic variability in the ABCG2 gene on ABCG2 expression, function, and interaction with AT1 receptor antagonist telmisartan."

No. Sentence Comment

6 Importantly, protein levels of the Q141K and F489L variant were significantly reduced, a phenomenon that was partly reversed by pharmacological proteasome inhibition. Login to comment
7 Moreover, basal pheophorbide A efflux capacity of S248P, F431L, and F489L variants was significantly impaired. Login to comment
8 Interestingly, inhibition of ABCG2-mediated pheophorbide A transport by telmisartan was almost abolished in cells expressing the R482G variant, whereas it was largely increased in cells expressing the F489L variant. Login to comment
10 Furthermore, individuals carrying the F489L polymorphism may be at increased risk of developing adverse drug reactions in multidrug regimens involving ABCG2 substrates and telmisartan. Login to comment
37 Site-directed mutagenesis Non-synonymous ABCG2 single nucleotide polymorphisms (SNPs) G34A (V12M), C421A (Q141K), T742C (S248P), T1291C (F431L), T1465C (F489L) as well as somatic mutation A1444G (R482G) were inserted into the ABCG2 cDNA sequence in the pTRE-Tight-BI-AcGFP1-ABCG2 plasmid using the QuickChange&#d2; Lightning Site-Directed Mutagenesis Kit (Agilent Technologies, Waldbronn, Germany) with specific primers according to the manufacturer`s instructions (Supplemental Fig. 1). Login to comment
83 In contrast, ABCG2 protein levels of cells transfected with the Q141K and the F489L mutants, respectively, were lower than those transfected with ABCG2 wild-type (Fig. 2B and C). Login to comment
84 Concomitant treatment of transfected HEK293-Tet-On cells with increasing concentrations of the proteasome inhibitor PS-341 (bortezomib) for 24 h slightly increased protein levels of variants Q141K and F489L but not that of ABCG2 wild-type (Fig. 2D). Login to comment
95 (D) Impact of increasing concentrations of the proteasome inhibitor PS-341 (bortezomib) on ABCG2 protein levels in doxycycline-treated (1 lg/mL; 24 h) HEK293-Tet-On cells transiently transfected with ABCG2 wild-type or the ABCG2 variants Q141K and F489L, respectively. Login to comment
96 (92.7 &#b1; 10.4%), and F489L (94.1 &#b1; 9.1%)). Login to comment
100 However, basal PhA efflux was significantly lower in HEK293- Tet-On cells transfected with the ABCG2 variants S248P (44.2 &#b1; 2.8%; P < 0.01 vs. doxycycline-induced ABCG2 wild-type), F431L (28.4 &#b1; 3.1%; P < 0.01 vs. doxycycline-induced ABCG2 wild-type), and F489L (20.9 &#b1; 2.0%; P < 0.05 vs. doxycycline-induced ABCG2 wild-type), demonstrating that these mutations significantly reduce ABCG2-mediated PhA transport in HEK293-Tet-On cells. Login to comment
106 In contrast, the inhibitory efficacy of telmisartan was significantly increased by the F489L mutation (Fig. 4B and C), indicating that the F489L mutation may facilitate the inhibitory interaction of telmisartan with ABCG2. Login to comment
117 Although the mRNA expression levels of these ABCG2 variants were similar to ABCG2 wild-type, protein levels of the Q141K and the F489L variants were significantly reduced in our experimental system. These findings are in accordance with experimental data from other groups [19], although the reduction of the F489L variant was more pronounced in our cellular expression model. Login to comment
119 Hence, further investigations of a potential role of the F489L mutation in the pathogenesis of gout could not only be of scientific interest but also of clinical importance. Login to comment
120 Moreover, reduced ABCG2 protein levels in individuals carrying the F489L mutation could also affect the pharmacokinetic profile of ABCG2 substrates, e.g. small-molecule receptor tyrosine kinase inhibitors, and increase the likelihood of adverse drug reactions. Login to comment
121 The reason for the reduced protein levels of the Q141K and F489L variant are currently unclear, but enhanced proteasomal degradation has been proposed to participate in reduction of cellular Q141K protein content [22]. Login to comment
122 Indeed, inhibition of proteasomal activity using the proteasome inhibitor bortezomib slightly increased the protein levels of both the Q141K and the F489L variant in HEK293-Tet-On cells, thereby suggesting a role of the proteasome in decreasing the protein content of both ABCG2 variants. Login to comment
124 In addition, PhA efflux of the F489L variant was only marginally impaired in our experimental system. These data suggest that (1) the observed reduction in ABCG2 protein content caused by the Q141K or F489L polymorphisms may be compensated by a more efficient PhA transport Fig. 3. Login to comment
127 Nevertheless, data from clinical investigations indicate that the Q141K variant may be associated with a reduced ABCG2-mediated substrate clearance in affected individuals [8,9,21] and that thus, clinical investigations are needed to further explore this issue with respect to the F489L variant. Login to comment
140 Moreover, our data demonstrate that the germ-line mutation F489L is associated with a more efficient telmisartan-induced inhibition of ABCG2-mediated PhA transport. Login to comment
141 The reason for this phenomenon remains unclear, but it is tempting to speculate that the F489L mutation may induce structural changes within the third transmembrane domain of the ABCG2 molecule to facilitate ABCG2-associated recognition and/or binding of telmisartan. Login to comment
142 This finding may also be of clinical importance, as individuals carrying the F489L mutation could be prone to telmisartan-induced ABCG2-dependent drug-drug interactions, e.g. in concomitant use with ABCG2 substrates. Login to comment
145 Moreover, our data suggest that clinical investigations are needed to clarify whether individuals carrying the F489L mutation may be prone to ABCG2-dependent drug-drug interactions in drug regimens involving telmisartan. Login to comment

PMID: 24777822 [PubMed] Jani M et al: "Structure and function of BCRP, a broad specificity transporter of xenobiotics and endobiotics."

No. Sentence Comment

95 Histone deacetylase inhibitors rescue newly synthesized transporter proteins and prevent aggresome targeting by disturbing TableÊf;1ߒߙMajor non-synonymous single-nucleotide polymorphisms found in the ABCG2 coding region Allele frequencies presented in this table do not reflect interethnic differences Mutation Position in BCRP Cellular effects of SNP Allele frequency % References 34G>A, V12M (rs2231137) N-terminus Lower expression, no impact on function 0-29.8 Tamura et al. (2006), Bosch et al. (2005), Mizuarai et al. (2004), Imai et al. (2002), Kobayashi et al. (2005), Backstrom et al. (2003), Honjo et al. (2002), Kondo et al. (2004) 151G>T, G51C N-terminus Slightly overexpressed, decreased transport activity 0.1 Tamura et al. (2006), Yoshioka et al. (2007) 376C>T, Q126X (rs7255271) NBD No expression, no activity 0-1.7 Tamura et al. (2006), Mizuarai et al. (2004), Itoda et al. (2003), Imai et al. (2002), Kobayashi et al. (2005), Kondo et al. (2004) 421C>A, Q141K (rs2231142) NBD Lower expression, decreased transport activity, substrate specificity altered 0-35.7 Tamura et al. (2006), Bosch et al. (2005), Mizuarai et al. (2004), Imai et al. (2002), Kobayashi et al. (2005), Backstrom et al. (2003), Honjo et al. (2002), Kondo et al. (2004) 458C>T, T153 M NBD Slightly lower expression, no impact on function 3.3 Tamura et al. (2006), Mizuarai et al. (2004) 479G>A, R160Q NBD Not determined 0.5 Bosch et al. (2005), Tamura et al. (2006) 496C>G, Q166E (rs1061017) NBD Slightly lower expression, no impact on function 0-1.1 Tamura et al. (2006), Kondo et al. (2004), Yoshioka et al. (2007) 616A>C, I206L (rs12721643) NBD Well expressed, decreased transport activity 0-10.0 Tamura et al. (2006), Zamber et al. (2003), Vethanayagam et al. (2005), Ieiri (2012a) 623T>C, F208 (rs1061018) NBD No expression, no transport activity 0.9-3.9 Tamura et al. (2006) 742T>C, S248P (rs3116448) NBD Well expressed, no transport activity 0.5 Tamura et al. (2006), Yoshioka et al. (2007) 1000G>T, E334X (rs3201997) NBD No expression, no transport activity Not determined Tamura et al. (2006), Ishikawa et al. (2005) 1291T>C F431L ECL1 Lower expression, substrate specificity altered 0.6-0.8 Tamura et al. (2006), Itoda et al. (2003), Yoshioka et al. (2007) 1322G>A, S441 N ECL1 Slightly lower expression, no transport activity 0.5 Tamura et al. (2006), Kobayashi et al. (2005), Kondo et al. (2004) 1465T>C, F489L TM3 Slightly lower expression, no transport activity 0.5-0.8 Tamura et al. (2006), Itoda et al. (2003), Kobayashi et al. (2005) 1515delC, F506S TM4 Not determined 0.5 Itoda et al. (2003), Kobayashi et al. (2005) 1515delC, F507L 1515delC, V508L 1515delC, M509X 1711T>A, F571I (rs9282571) TM5 Well expressed, substrate specificity altered 0.5 Tamura et al. (2006) 1723C>T, R575X TM5 Not determined 0.5 Tamura et al. (2006) 1768A>T, N590Y (rs34264773) ECL3 Slightly overexpressed, substrate specificity altered 0-9.7 Tamura et al. (2006), Mizuarai et al. (2004), Zamber et al. (2003), Vethanayagam et al. (2005) 1858G>A, D620 N (rs34783571) ECL3 Slightly overexpressed, substrate specificity altered 0-11.1 Tamura et al. (2006), Bosch et al. (2005), Honjo et al. (2002), Vethanayagam et al. (2005) the trafficking along microtubules (Basseville et al. 2012). Login to comment

PMID: 25036722 [PubMed] Szafraniec MJ et al: "Determinants of the activity and substrate recognition of breast cancer resistance protein (ABCG2)."

No. Sentence Comment

201 To elucidate the significance of this polymorphism for porphyrin transport, a set of 18 variants of BCRP (Val12 Met, Gly51 Cys, Gln126 stop, Gln141 Lys, Thr153 Met, Gln166 Glu, Ile206 Leu, Phe208 Ser, Ser248 Pro, Glu334 stop, Phe431 Leu, Ser441 Asn, Arg482 Gly, Arg482 Thr, Phe489 Leu, Phe571 Ile, Asn590 Tyr and Asp620 Asn) have been expressed in insect cells. Login to comment
204 In the Phe489 Leu mutant transport was also impaired, while the Ser441 Asn variant lost the ability to transport methotrexate and the Phe431 Leu variant seemed to transport hematoporphyrin normally but showed no transport of methotrexate. Login to comment
205 The Phe489 Leu variant did not transport methotrexate but maintained hematoporphyrin transport at a low level (10% of the WT protein). Login to comment
206 Moreover, Flp-In-293 cells expressing the variants Phe208 Ser, Ser248 Phe, Ser441 Asn and Phe489 Leu were light sensitive when treated with Pheide. Login to comment
209 Position Type of mutation Effect on the transporter References NBD Lys 86 Met (i) No stimulation of the ATPase activity by prazosin; (ii) no influence on the transport of mitoxantrone Henriksen et al. (2005b) Glu 126 stop, Phe 208 Ser, Ser 248 Phe, Glu 334 stop Inability to transport hematoporphyrin Tamura et al. (2006) Glu 211 Gln Complete abolishment of the ATPase activity and methotrexate transport Hou et al. (2009) Pro 392 Ala Significant reduction in the efflux activity of mitoxantrone, BODIPY-prazosin and Hoechst 33342 Ni et al. (2011) TM1 Gly 406 Ala Gly 410 Ala No influence on the activity of the transporter Polgar et al. (2004) Gly 406 Leu Gly 410 Leu (i) Loss of the ability to transport rhodamine123; (ii) impaired transport of mitoxantrone, Pheide and BODIPY-prazosin Polgar et al. (2004) Extracellular loop 1 Phe 431 Leu (i) Loss of the ability to transport methotrexate; (ii) 10% level of hematoporphyrin transport compared to the WT protein Tamura et al. (2006) Ser 441 Asn Inability to transport hematoporphyrin Tamura et al. (2006) Ser 441 Asn Loss of the ability to transport methotrexate Tamura et al. (2006) TM2 Lys 452 Ala His 457 Ala Increase in transport of mitoxantrone, BODIPY-prazosin and Hoechst 33342 Cai et al. (2010) Lys 453 Ala Arg 465 Ala Decrease in transport of mitoxantrone, BODIPY-prazosin, Hoechst 33342, doxorubicin, SN-38 and rhodamine 123 Cai et al. (2010) TM3 Arg 482 Gly Arg 482 Thr (i) No change in the inhibitory activity of lapatinib; (ii) about two times greater inhibition by ritonavir, saquinavir and nalfinavir than in the WT variant; (iii) gaining the ability to transport rhodamine123 and doxorubicin; (iv) no influence on the transport of mitoxantrone; (v) loss of the ability to transport methotrexate Dai et al. (2008), Gupta et al. (2004), Honjo et al. (2001), Mitomo et al. (2003) Arg 482 Thr (i) Lower IC 50 of cyclosporine A for mutant than for WT variant; (ii) lower elacridar inhibition potency Xia et al. (2007) Arg 482 Lys Complete loss of transport activity Ejendal et al. (2006) Phe 489 Leu Impaired transport of porphyrins, no transport of methotrexate Tamura et al. (2006) Extracellular loop 3 Asn 590 Tyr Over twice reduced transport of mitoxantrone, topotecan, daunorubicin and rhodamine 123 Vethanayagam et al. (2005) Cys 592 Ala/Cys 608 Ala (i) Transport of mitoxantrone almost unchanged; (ii) transport of BODIPY-prazosin significantly impaired Henriksen et al. (2005a) Extracellular loop 3 Cys 603 Ser Cys 592 Ser/Cys 608 Ser Cys 592 Ser/Cys 603 Ser/Cys 608 Ser Diminished susceptibility to the inhibitory activity of fumitremorgin C Shigeta et al. (2010) Cys-less Arg 482 Gly-BCRP Complete loss of the ability to efflux mitoxantrone Liu et al. (2008b) The positions of the amino acid residues refer to the topological model of BCRP proposed by Wang et al. (2009). Login to comment