ABCMdb

PMID: 9238680

Scobie G, Woodroffe B, Fishel S, Kalsheker N
Identification of the five most common cystic fibrosis mutations in single cells using a rapid and specific differential amplification system.
Mol Hum Reprod. 1996 Mar;2(3):203-7., [PubMed]

Sentences

No. Mutations Sentence Comment

2 ABCC7 p.Gly551Asp ABCC7 p.Arg553* ABCC7 p.Gly542* In the first round of the polymerase chain reaction (PCR), regions of exons 4, 10 and 11 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene containing the mutations AF508, G551D, R553X, G542X and 621 + 1 O T were co-amplified in a single multiplex PCR. Login to comment 11 ABCC7 p.Gly551Asp ABCC7 p.Arg553* ABCC7 p.Gly542* Although this mutation accounts for ~50-80% of cases (CF Genetic Analysis Consortium, 1990), depending on the population being studied, in the UK around 10% of the remainder present with one or two of the four other most common mutations, these being the G551D Gly-Asp, R553X Arg-Stop (Cutting et al, 1990), the G542X Gly-Stop (Kerem et al, 1990) and the G-T splice mutation 621 + 1 O T (the first intronic base in the splice donor site flanking the 3' end of exon 4) (Zielenski et al, 1991). Login to comment 22 ABCC7 p.Arg553* ABCC7 p.Gly542* Using this procedure, we have shown it is possible to genotype a single cell for any of the five most common mutations responsible for CF, which when used in parallel 621 + IOT AFSOS A B G551D0U53X) G542X Cystic fibrosis diagnosis in single cells 200 bp 4S 4AS S21 + 10 >T 10S 11S 10AS AFSOS 11 AS R553X QS51D L G54ZX Figure 2. Login to comment 23 ABCC7 p.Gly542* ABCC7 p.Gly551* ABCC7 p.Arg553Asp Schematic diagram of external CFTR primers for exons 4, 10 and 11 and the relative positions of the cystic fibrosis mutations 621 + 1 O T , AF508, G542X, R553D and G551X. Login to comment 24 ABCC7 p.Arg553* Amu tabc A B AmpUOcatiM prtetn 621+1G>T AFSOS G551D(R553X) C342X 621+1G>T AFSOS G591D(R5S3X) GS41X normal Dormal mount mutant mutant mutant normaj Figure 1. Login to comment 36 ABCC7 p.Gly551Asp ABCC7 p.Arg553* ABCC7 p.Gly542* ABCC7 p.Gly542* CF cell lines Four lymphoblastoid cell lines with genotypes AF5O8/AF5O8, G542X/ G542X, G551D/R553X and 621+ l>G/AF508 were purchased from Coriell Cell Repositories (Camden, NJ, USA) and one cell line with genotype 621 + lG>T/normal was purchased from European Collection of Animal Cell Cultures (Porton Down, UK). Login to comment 54 ABCC7 p.Gly551Asp ABCC7 p.Arg553* ABCC7 p.Gly542* Table I. Sequences of pnmary and secondary polymerase chain reaction (PCR) primers including ARMS kit primers and their relevant uM concentrations (compared to a standard concentration of 0.86 nM per reaction) CFTR Exon Sequence Size (bp) Primary PCR primers Exon 4 Exon 10 Exon II HUMTH01 5'- CAAGTCTTATTTCAAAGTACCAAG 5'- CAGCTCACTACCTAATTTATGACA 5'- AAGTGAATCCTGAGCGTGATTTGATAATGA 5'- CACAGTAGCTTACCCATAGAGGAAACATAA 5'- TATTTAATGATCATTCATGACATTT 5'- TAAAGCAATAGAGAAATGTCTGTA 5'- ATTCAAAGGGTATCTGGGCTCTGG 5'- GTGGGCTGAAAAGCTCCCGATTAT 479 380 425 179-203 Mutation and sequence Size (bp) Tube Concentration Secondary PCR primers AF508 C: 5'- GACTTCACTTCTAATGATGATTATGGGAGA N: 5'- GTATCTATATTCATCATAGGAAACACCAC M: 5'- GTATCTATATTCATCATAGGAAACACCATT Exon II C: 5'- TAAAATTTCAGCAATGTTGTTTTTGACC G551D/R553X N: 5'- GCTAAAGAAATTCTTGCTCGTTGCC M: 5'- AGCTAAAGAAATTCTTGCTCGTTGCT G542X N: 5'- ACTCAGTGTGATTCCACCTTCTAC M: 5'- CACTCAGTGTGATTCCACCTTCTCA 621 + 1 O T C: 5'- TCACATATGGTATGACCCTCTATATAAACT N: 5'- TGCCATGGGGCCTGTGCAAGGAAGTATTCC M: 5'- TGCCATGGGGCCTGTGCAAGGAAGTATTCA HUMTHOI 5'- TGATTCCCATTGGCCTGTTCCTCC 5'- TGGCCCACACAGTCCCCTGTACAC 160 157 285 286 256 257 380 380 123-147 A/B A B A/B I A B A A/B A B 1.0 1.0 2.0 2.0 2.0 1.0 1.0 1.0 0.5 0.5 0.5 C = common primer, N = normal primer, M = mutant primer. Login to comment 56 ABCC7 p.Gly551Asp ABCC7 p.Arg553* ABCC7 p.Gly542* Figure 3 shows the detection of individual AF508, G551D, R553X and G542X, 621 + 1 O T mutations using the CF ARMS kit after primary amplification of individual CFTR exons containing these mutations, and the corresponding fingerprint from the same cells (Figure 4). Login to comment 63 ABCC7 p.Gly551Asp ABCC7 p.Arg553* ABCC7 p.Gly542* One drawback of using single exon 1 2 3 4 5 6 7 8 9 10 0 X 621+1G>T G551D/R553X G542X AF508 Figure 3. Login to comment 65 ABCC7 p.Gly551Asp ABCC7 p.Arg553* ABCC7 p.Gly542* ABCC7 p.Gly542* Tubes A and B for a normal genotype (lanes I and 2), then tubes A and B for the mutations: AF5O8/AF5O8 (lanes 3 and 4), 621 + lOT/normal (lanes 5 and 6), G551D/R553X (lanes 7 and 8), and G542X/G542X (lanes 9 and 10). Login to comment 69 ABCC7 p.Gly551Asp ABCC7 p.Arg553* ABCC7 p.Gly542* ABCC7 p.Gly542* Lanes 1-5 are cells containing the mutations AF508/AF508, 621 + lG>T/normal, G551D/R553X, G542X/G542X and 621 + 1OT/AF508 respectively. Login to comment 71 ABCC7 p.Gly551Asp ABCC7 p.Arg553* ABCC7 p.Gly542* 1 2 3 4 5 6 7 8 9 10 11 12 621+1G>T G551D/R553X G542X AF508 Figure 5. Login to comment 72 ABCC7 p.Gly551Asp ABCC7 p.Arg553* ABCC7 p.Gly542* ABCC7 p.Gly542* Detection of the same five mutations using a multiplex containing external primers for exons 4, 10 and 11, and subsequent genotyping using the ARMS kit Tubes A and B for a normal genotype (lanes 1 and 2), then tubes A and B for the mutations AF5O8/AF5O8 (lanes 3 and 4), 621+ lG>17normal (lanes 5 and 6), G551D/R553X (lanes 7 and 8), G542X/G542X (lanes 9 and 10) and 621 + 1OT/AF508 (lanes 11 and 12). Login to comment 81 ABCC7 p.Gly551Asp ABCC7 p.Gly551Asp ABCC7 p.Gly551Asp ABCC7 p.Arg553* ABCC7 p.Arg553* Under the conditions used here the mutant and normal ARMS primers for the G551D mutation also detects the R553X mutation such that the G551D/R553X compound heterozygote is indistinguishable from a G551D homozygote (confirmed by sequencing). Login to comment 82 ABCC7 p.Gly551Asp ABCC7 p.Gly551Asp ABCC7 p.Arg553* This is most likely due to the normal G551D ARMS primer, which is also destabilized at position-2 (Table I), incurring a mismatch at position-6 caused by the R553X C-T mutation, such that a PCR product is not observed with the B tube (wild type) and a diagnosis of homozygous G551D would be inferred. Login to comment 83 ABCC7 p.Gly551Asp ABCC7 p.Gly551Asp ABCC7 p.Arg553* Since both parents would be typed for the CF mutations prior to preimplantation diagnosis, it would be possible to distinguish between homozygous G551D and compound G551D/R553X heterozygotes. Login to comment 86 ABCC7 p.Gly551Asp ABCC7 p.Arg553* ABCC7 p.Gly542* The ARMS procedure used here has this advantage in that it is capable of detecting the 621 + 1 O T , AF508, G551D, R553X and the G542X mutations within 6-8 h from a single cell. Login to comment 87 ABCC7 p.Trp1282* Multiplex PCR has also been used to identify the AF508 and W1282X mutations in the Jewish population from oocytes and single blastomeres (Avner et al., 1994). Login to comment 88 ABCC7 p.Trp1282* However this procedure requires further analysis including heteroduplex formation and restriction enzyme digest to obtain a result, whereas the ARMS (which can also detect the W1282X in the standard plus kit) does not. Login to comment