ABCMdb

PMID: 7530726

Avner R, Laufer N, Safran A, Kerem BS, Friedmann A, Mitrani-Rosenbaum S
Preimplantation diagnosis of cystic fibrosis by simultaneous detection of the W1282X and delta F508 mutations.
Hum Reprod. 1994 Sep;9(9):1676-80., [PubMed]

Sentences

No. Mutations Sentence Comment

12 ABCC7 p.Trp1282* The two major mutations in the CF Israeli population are AF5O8 (A) (30% of CF mutations in all ethnic groups) and the point mutation W1282X (W) (60% of CF Ashkenazi Jews) (Shoshani et al., 1992). Login to comment 24 ABCC7 p.Trp1282* W1282X external set (amplified product 473 bp) (Zielenski etal., 1991): 20i-5: 5'GGTCAGGATTGAAAGTGTGCA3' 20i-3: 5'CTATGAGAAAACTGCACTGGA3' 4. Login to comment 25 ABCC7 p.Trp1282* ABCC7 p.Trp1282* W1282X internal set (amplified product 270 bp) (Zielenski etal., 1991): Wl: 5TACCTATATGTCACAGAAGT3' (44 bp upstream exon 20) W2: 5'GTACAAGTATCAAATAGCAG3' (70 bp downstream exon 20) Locus-specific amplification The independent amplifications of the W1282X locus and the AF508 locus were performed under the same conditions in both cases using a two-step PCR procedure. Login to comment 40 ABCC7 p.Trp1282* Schematic representation of multiplex polymerase chain reaction (PCR) for simultaneous amplification of the AF508 and W1282X mutations from a single cell. Login to comment 53 ABCC7 p.Trp1282* Efficiency of amplification at the CFTR locusa in single cells Type of cells analysed Number of cells amplified at: Single locus W Single locus A Both loci W and A simultaneously Double signal Single W signal Single A signal Oocytes Blastomeres Total 60/98 43/64 103/162 75/110 60/78 135/188 33/65 14/35 57/100 6/65 2/35 8/100 14/65 2/35 8/100 W = W1282X; A = AF508. Login to comment 55 ABCC7 p.Trp1282* Identification of the W1282X (W) and AF508 (A) mutations simultaneously amplified from genomic DNA. Login to comment 61 ABCC7 p.Trp1282* Simultaneous amplification and analysis ofAF508 and W1282X Genomic DNA analysis The simultaneous amplification of both sites of mutations, A and W, was performed as described above. Login to comment 82 ABCC7 p.Trp1282* The simultaneous amplification products of single blastomeres at the W1282X locus (W) and at the AF508 locus (A) were visualized in a 2% agarose ethidium bromide-stained gel. Numbers indicate the expected sizes of the amplified products. Login to comment 85 ABCC7 p.Trp1282* Analysis of mutations W1282X (W) and AF508 (A) simultaneously amplified in single blastomeres. Login to comment 94 ABCC7 p.Trp1282* W1282X and AF508 are the two most common mutations in the CF Israeli population. Login to comment