ABCMdb

PMID: 2344617

Dean M, White MB, Amos J, Gerrard B, Stewart C, Khaw KT, Leppert M
Multiple mutations in highly conserved residues are found in mildly affected cystic fibrosis patients.
Cell. 1990 Jun 1;61(5):863-70., [PubMed]

Sentences

No. Mutations Sentence Comment

58 ABCC7 p.Arg117His This mutation changes an arginine codon to histidine; it will be referred to as R117H. Login to comment 60 ABCC7 p.Arg347Pro Family UT 1446 contains a C to G transversion at position 1172 that changes an aspartic acid residue to proline (R347P). Login to comment 97 ABCC7 p.Arg117His Both of the families that carry the CF R117H mutation contain individuals that are very mildly afA. Login to comment 98 ABCC7 p.Arg117His 406 GAAGTCACCAAAGCAGTACAGCCTCTC~ACTGGGAAGAATCATAGCTTCCTAT~CCCG EVTKAVQPLLLGR IIASYDP CF DIIOH CAC H 466 GATAACAAGGAGGAAC~TCTATCGCGAmATCTACGCATCTAGGCATAGGC~ATGCC~CTC~T DNKEERSIAIYLGIGLCLLF CF R117H CAC H 526 ATTGTGAGGACACTGCTCCTACACCCAGCCA~GGCC~CATCACA~GGAATGCAG IVRTLLLHPAI FGLHHIGMQ 566 ATGAGAATAGCTATGTTTAGTTTGATTTATAAGAAG MRIAMFSLIYKK 6. Login to comment 99 ABCC7 p.Arg347Pro 1003 xenopur 1063 1123 CF R347P 1163 ACAGAACTGAAACTGACTCGGAAGGCAGCCTATGTGAGATAC~CAATAGCTCAGCC~C TELKLTRKAAYVRYFNSV .G.. AYVRYFNSSAF .G.. AYVRYFNSSAF TTCTTCTCAGGG~C~GTGGTG~ATCTGTGCCCCTATGCACTAATCAAAGGA FFSGFFVVFLSVLPYALI[KE T. Login to comment 117 ABCC7 p.Arg117His ABCC7 p.Arg347Pro of Chromosomes Mutation CF DllOH Wild Type Mutated x2 Normal CF CF R117H 94 0 14 1 6.0a Normal CF CF R347P 94 0 13 2 12b Normal CF 96 0 14 1 6.0a Allele Diagnosis D7S399 Number Pancreatic insufficient (PI) 1 2 2 34 Pancreatic sufficient (PS) 1 4 2 4 Number refers to number of chromosomes with the corresponding genotype for the marker MPW (D7S399). Login to comment 128 ABCC7 p.Arg117His Thus the two families with the same pair of mutations (AF508 and CF R117H) both contain at least one individual with exceptionally mild disease. Login to comment 130 ABCC7 p.Arg117His Three observations support the proposition that these mutations are responsible for disease: the mutations have not been found on over 94 normal chromosomes of the same haplotype; the mutations cause the replacement of highly charged amino acids that are highly conserved in vertebrates; and two families that carry the same combination of mutations (AFSo8 and CF R117H) show mild clinical features. Login to comment 135 ABCC7 p.Arg347Pro The third change (CF R347P) replaces an arginine with a proline residue. Login to comment 158 ABCC7 p.Arg347Pro The R347P mutation can be directly assayed by restriction digestion and the others by allele-specific oligonucleotides. Login to comment 167 ABCC7 p.Arg117His The two families with the R117H mutation provide a clear example that clinical characterization of each combination of compound heterozygote may be important in predicting the severity of individual patients. Login to comment 195 ABCC7 p.Arg117His ABCC7 p.Arg347Pro The R347P mutation was confirmed by Hhal and Ncol digestion of amplified DNA The DllOH and R117H mutations were confirmed by hybridization at 42% with CF-49 (5`TCCTATCACCCGGAT) and CF-48 (5`.GAGGAACACTCTATC). Login to comment