ABCMdb

PMID: 22079487

Kivlehan F, Paolucci M, Brennan D, Ragoussis I, Galvin P
Three-dimensional hydrogel structures as optical sensor arrays, for the detection of specific DNA sequences.
Anal Biochem. 2012 Feb 1;421(1):1-8. Epub 2011 Oct 21., [PubMed]

Sentences

No. Mutations Sentence Comment

45 ABCC7 p.Trp1282* Detection of complementary target sequences down to nanomolar concentrations was observed, allowing for low detection limits of target sequences that contain mutations p.W1282X and p.F508del relative to the cystic fibrosis transmembrane conductance regulator gene (CFTR; OMIM ID: 602421). Login to comment 50 ABCC7 p.Trp1282* Probe sequences used in the detection of p.W1282X and p.F508del mutations were provided by The Wellcome Trust Centre, University of Oxford, and are also described in Table 1. Login to comment 61 ABCC7 p.Trp1282* ABCC7 p.Trp1282* Name Oligonucleotide sequence (50 to 30 ) Length Probe 1-Cy5 + NH2 Cy5-TACAGGCTTACCGTCATAGGT-C7-Aminolinka 21 Probe 1-NH2 C6-Aminolinkb -TACAGGCTTACCGTCATAGGT 21 Target 1-Cy5 Cy5 Ester-ACCTATGACGGTAAGCCTGTA 21 Probe 2-Cy5 + NH2 Cy5-GCCTAAGCCCTCTTTCTCAGT-C7-Aminolinka 21 Probe 2-NH2 C6-Aminolinkb -GCCTAAGCCCTCTTTCTCAGT 21 Target 2-Cy5 Cy5 Ester-ACTGAGAAAGAGGGCTTAGGC 21 W1282X-wt AAAGGCTTTCCTCCACTGTTGCGATCATGTCGAAGGA 22 W1282X-mut AAGGCTTTCCTTCACTGTTGCGATCATGTCGAAGGA 23 DF508-wt AAATATCATCTTTGGTGTTTCCTATGGATCATGTCGAAGGA 26 DF508-mut AAAGAAAATATCATTGGTGTTTCCTATGGATCATGTCGAAGGA 28 a Primary amino group at the end of seven carbon spacer. Login to comment 75 ABCC7 p.Trp1282* Cy5-labeled p.W1282X and p.F508del PCR primers (Metabion International AG) were used in standard PCR. Login to comment 76 ABCC7 p.Trp1282* Concentrations of 280-300 and 200-250 nM were recorded using the 2100 Bioanalyzer system for the 87-bp p.W1282X and 105- bp p.F508del PCR products, respectively, using an Agilent DNA 1000 kit. Login to comment 118 ABCC7 p.Trp1282* Two mutations in the CFTR gene associated with cystic fibrosis were selected: the p.W1282X mutation where a tryptophan group at position 1282 of the CFTR gene is replaced by a stop codon as a result of a nucleotide change from G to A at position 3978 [33], and the more commonly known p.F508del mutation, which consists of a 3 base deletion of CTT at position 508 of the gene. Login to comment 125 ABCC7 p.Trp1282* Fluorescence intensities obtained resulted in a ratio of 3.6 for wild-type over mutant for the p.W1282X probes, and a ratio of 2.9 for wild-type over mutant for the p.F508del probes (as was expected). Login to comment 126 ABCC7 p.Trp1282* Results obtained from hybridization reactions with the heterozygous (wt/mut) PCR products correctly showed an equal level of Cy5 fluorescence between the probes in each pair, resulting in ratios of 0.93 for the p.W1282X probes, and 1.05 for the p.F508del probes. Login to comment 128 ABCC7 p.Trp1282* The detection of these mutations and successful discrimination between wild-type and mutant allele sequences was achieved down to lower target concentrations of $1 nM, an example of which is shown in Fig. 7 for the detection of p.W1282X homozygous target. Login to comment 132 ABCC7 p.Trp1282* Fig. 8 shows that we were able to replicate the same fluorescence intensity ratios for hybridization of p.W1282X heterozygous target, with a time period ranging from 2 h down to 15 min. Login to comment 140 ABCC7 p.Trp1282* ABCC7 p.Trp1282* Hybridization between p.W1282X-wt and -mut probes immobilized within 25% (v/v) hydrogel spots (4 lM) and denatured p.W1282X PCR wt/wt homozygous products of (i) 78.6 nM, (ii) 7.2 nM, (iii) 1.08 nM, and (iv) 0.72 nM. Login to comment 170 ABCC7 p.Trp1282* ABCC7 p.Trp1282* ABCC7 p.Trp1282* ABCC7 p.Trp1282* ABCC7 p.Trp1282* ABCC7 p.Trp1282* Hybridization between p.W1282X-wt and -mut probes immobilized within 25% (v/v) hydrogel spots (4 lM) and denatured W1282X ($49 nM) PCR wt/mut heterozygous products, (i) prehybridization reaction for W1282X-wt, (ii) posthybridization reaction and washes for W1282X-wt, (iii) prehybridization reaction for W1282X-mut; (iv) posthybridization reaction and washes for W1282X-mut. Login to comment 187 ABCC7 p.Trp1282* Acknowledgments We acknowledge the financial support of Enterprise Ireland for funding of this project (Grant PC-2008-030), support from Wellcome Trust grant # 075491/Z/04 to J.R. for providing the p.W1282X and p.F508del probes in this work, and Suzanne Crotty from the Electron Microscopy Facility Biosciences Institute in UCC for her help with the confocal microscopy work. Login to comment