ABCMdb

PMID: 17901983

Gallego Romero I, Ober C
CFTR mutations and reproductive outcomes in a population isolate.
Hum Genet. 2008 Jan;122(6):583-8. Epub 2007 Sep 28., [PubMed]

Sentences

No. Mutations Sentence Comment

3 ABCC7 p.Met1101Lys Following a population-wide screen for the only two mutations present in the Hutterites (M1101K, F508), we tested for associations between carrier status and measures of fertility. Login to comment 15 ABCC7 p.Gly542* F508 accounts for up to 83% of CF mutations in northern European populations, and 66% of mutations worldwide, well above the 2.4% worldwide frequency of the second most common mutation, G542X, in CF patients (Zielenski and Tsui 1995). Login to comment 17 ABCC7 p.Met1101Lys As an example, the M1101K mutation is the most common CF mutation in the North American Hutterites, with F508 being the only other, and less common, mutation present in the population (Zielenski et al. 1993). Login to comment 18 ABCC7 p.Met1101Lys Outside of the Hutterites, M1101K has only been reported in a single patient from the South Tyrol (Stuhrmann et al. 1997), where some of the ancestors of the Hutterite population lived in the sixteenth century (Hostetler 1974). Login to comment 28 ABCC7 p.Met1101Lys Our study was conducted in the South Dakota Hutterites, in whom only two CF mutations are segregating ( F508, M1101K). Login to comment 42 ABCC7 p.Met1101Lys M1101K genotyping Genotyping was performed using single base extension with Xuorescent polarization (SBE-FP) (Chen et al. 1999) (primer: CFTR_1101U: ACCTGTCAACACTGCGCTGG TTCCAAA). Login to comment 49 ABCC7 p.Met1101Lys The eVects of M1101K and F508 were considered both independently and together in all analyses. Login to comment 55 ABCC7 p.Met1101Lys Results CF mutation and carrier frequencies We determined M1101K genotypes for 948 individuals (534 females, 414 males), and F508 genotypes for 942 (531 females, 411 males). Login to comment 58 ABCC7 p.Met1101Lys 68 were M1101K carriers (39 females and 29 males in 29 families) and 13 were F508 carriers (11 females and 2 males in 10 families). Login to comment 59 ABCC7 p.Met1101Lys In addition, carrier status for four individuals was inferred by pedigree analysis (one female and one male for M1101K; two males for F508). Login to comment 64 ABCC7 p.Met1101Lys The fourth, an M1101K carrier, was the father of two CF children who were not genotyped in our study because they were under 6 years of age. Login to comment 65 ABCC7 p.Met1101Lys This carrier father was excluded from all analyses, as was his wife (a carrier of M1101K and also part of the genotyped sample), because their children`s illness could have aVected their subsequent reproductive behaviour and none of their children were in our study. Login to comment 66 ABCC7 p.Met1101Lys A second family with CF children, in which the father was an M1101K carrier and the mother a F508 carrier, was excluded from the fertility analyses for the same reasons; the children of this couple were also under 6 years of age and were not genotyped as part of this study. Login to comment 67 ABCC7 p.Met1101Lys There was, in addition, one adult female in our sample who had CF and was homozygous for M1101K. Login to comment 70 ABCC7 p.Met1101Lys The frequency of CFTR mutations in this sample is 0.044, with M1101K accounting for slightly over 82% of mutations and F508 for the remaining 18%. Login to comment 71 ABCC7 p.Met1101Lys The estimated carrier frequency is 0.072 (1 in 14) for M1101K and 0.014 (1 in 72) for F508, yielding an overall carrier frequency of approximately 0.086 (1 in 12) in the Schmiedeleut Hutterites of South Dakota (Table 1). Login to comment 75 ABCC7 p.Met1101Lys ABCC7 p.Met1101Lys ABCC7 p.Met1101Lys homozygotes CF mutation frequency Carrier frequency M1101K 948 68 1 0.037 1 in 14 F508 942 13 0 0.007 1 in 72 Totala 936 81 1 0.044 1 in 12 transmission ratios conform to Mendelian expectations (P = 0.490 for M1101K alone, 0.617 for F508 alone and 0.409 for both mutations combined) this result is basically unchanged when three families with a carrier parent with an inferred genotype are excluded (P = 0.544 for M1101K, 1.000 for F508, and 0.564 for both mutations combined). Login to comment 76 ABCC7 p.Met1101Lys ABCC7 p.Met1101Lys Moreover, there is no evidence for skewed sex ratios relative to genotype (P = 0.348 for M1101K alone, 0.763 for F508 alone and 0.327 for both mutations combined, df = 1), nor is there evidence for an excess of either boys or girls among children of carrier parents (P = 0.887 for M1101K, 0.466 for F508, and 0.847 for both combined) when their ungenotyped siblings-for whom we had no DNA-are included in the overall totals (data not shown). Login to comment 78 ABCC7 p.Met1101Lys ABCC7 p.Met1101Lys Our data do not support the hypothesis that carrier fathers preferentially transmit mutant alleles to their sons and normal alleles to their daughters (Kitzis et al. 1988) (P = 0.917 for M1101K alone, 0.897 when F508 is included), nor that carrier mothers preferentially transmit mutant alleles to their sons or daughters (P = 0.388 for M1101K alone, 0.513 when F508 is included). Login to comment 79 ABCC7 p.Met1101Lys ABCC7 p.Met1101Lys These results remain when the three inferred carrier parents are removed from the analysis (paternal transmissions: P = 0.917 for M1101K alone, 0.917 when F508 is included; maternal transmissions: P = 0.184 for M1101K alone, 0.285 when F508 is included). Login to comment 82 ABCC7 p.Met1101Lys ABCC7 p.Met1101Lys Male carriers of both mutations come from larger sibships than female carriers; this diVerence is signiWcant for M1101K carriers (unpaired, 2-tailed t test, P = 0.022 for M1101K, 0.59 for F508). Login to comment 85 ABCC7 p.Met1101Lys However, the birth order of male and female carriers was not signiWcantly diVerent (unpaired, 1-tailed t test, P = 0.302 for carriers of M1101K, 0.152 for carriers of both mutations combined) and therefore cannot account for the diVerence in sibship sizes between male and female carriers. Login to comment 87 ABCC7 p.Met1101Lys Heterozygosity for M1101K was not associated with increased (or decreased) fertility in Hutterite men (GTAM, P = 0.441) or women (GTAM, P = 0.333). Login to comment 89 ABCC7 p.Met1101Lys Discussion The frequencies of M1101K (0.072) and of F508 (0.014) carriers in the Hutterites result in an overall CF carrier frequency of 0.086 This is slightly lower than the »0.11 reported in Canadian Hutterites (Zielenski et al. 1993) but nonetheless more than two times higher than CF carrier frequencies in most Caucasian populations, which averages »0.04 (Welsh et al. 2001). Login to comment 90 ABCC7 p.Met1101Lys Whereas M1101K accounted for 64% of CF mutations in a previous study of 16 Canadian and US Hutterite families from all three leut (Zielenski et al. 1993), this mutation accounts for 82% of CF mutations in the South Dakota Schmeideleut Hutterites. Login to comment 92 ABCC7 p.Met1101Lys Number of transmissions of CFTR mutations to 103 children in 23 Hutterite families segregating M1101K and 15 children in 5 Hutterite families segregating F508 (includes 3 parents with inferred genotypes). Login to comment 94 ABCC7 p.Met1101Lys ABCC7 p.Met1101Lys Number of transmissions of CFTR mutations to 98 children in 22 Hutterite families segregating M1101K and to 10 children in 3 Hutterite families segregating F508 (excludes 3 parents with inferred genotypes) TR Transmitted, NT nontransmitted a Exact test M1101K F508 Combined TR NT P value TR NT P value TR NT P value A. Login to comment 96 ABCC7 p.Met1101Lys 46 52 0.544 5 5 1.0a 51 57 0.564 Table 3 Number of transmissions (TR) and nontransmissions (NT) of M1101K and F508 to sons (#) and daughters ($) from carrier parents A. Login to comment 97 ABCC7 p.Met1101Lys From carrier mothers and fathers combined (28 families; 23 M1101K, 5 F508). Login to comment 99 ABCC7 p.Met1101Lys From carrier fathers (12 families; 10 M1101K, 2 F508). Login to comment 101 ABCC7 p.Met1101Lys From carrier mothers (16 families; 13 M1101K, 3 F508). Login to comment 103 ABCC7 p.Met1101Lys Includes three parents with inferred genotypes (see text for details) a Exact test M1101K (TR:NT) F508 (TR:NT) Combined (TR:NT) # $ P value # $ P value # $ P value A. Login to comment 115 ABCC7 p.Met1101Lys Despite a previous study showing larger sibship sizes for female compared to male carriers (Gedschold et al. 1988), in our study male carriers for either M1101K or F508 had larger sibships (Table 4). Login to comment 121 ABCC7 p.Met1101Lys The biophysical consequences of the M1101K mutation are not known, although homozygosity for M110K is associated with pancreatic insuYciency and a fairly classical presentation of disease that is generally indistinguishable from CF in F508 homozygotes (Zielenski et al. 1993 and unpublished data). Login to comment 122 ABCC7 p.Met1101Lys Nonetheless, it is possible that the biochemical properties of F508 and M1101K diVer in a manner that is relevant to fertility eVects. Login to comment 123 ABCC7 p.Met1101Lys Therefore, while the data presented in this study do not support the hypothesis of a fertility advantage in CF carriers, it could be argued that our study only rules out any fertility advantage to carrying the M1101K mutation whereas a fertility advantage to F508 carrier status cannot be ruled out. Login to comment