ABCMdb

PMID: 17290305

Linde L, Boelz S, Nissim-Rafinia M, Oren YS, Wilschanski M, Yaacov Y, Virgilis D, Neu-Yilik G, Kulozik AE, Kerem E, Kerem B
Nonsense-mediated mRNA decay affects nonsense transcript levels and governs response of cystic fibrosis patients to gentamicin.
J Clin Invest. 2007 Mar;117(3):683-92. Epub 2007 Feb 8., [PubMed]

Sentences

No. Mutations Sentence Comment

10 ABCC7 p.Trp1282* Our results demonstrate differences in NMD efficiency of CFTR transcripts carrying the W1282X mutation among different epithelial cell lines derived from the same tissue. Login to comment 13 ABCC7 p.Trp1282* Downregulation of NMD in cells carrying the W1282X mutation increased the level of CFTR nonsense transcripts and enhanced the CFTR chloride channel activity in response to gentamicin. Login to comment 21 ABCC7 p.Trp1282* We have recently administered gentamicin to the nasal epithelium of CF patients, all of whom carried the same W1282X nonsense mutation (29). Login to comment 36 ABCC7 p.Trp1282* Variability in the NMD efficiency was found for CFTR transcripts carrying the W1282X mutation as well as for several physiologic NMD substrates, ribosomal protein L3 (RPL3), splicing component 35 kDa (SC35) 1.6 kb, SC35 1.7 kb, asparagine synthetase (ASNS), and cysteinyl-tRNA synthetase (CARS). Login to comment 46 ABCC7 p.Trp1282* ABCC7 p.Trp1282* (C) A summary of the W1282X transcript levels in the W1282X/ΔF508 patients. Login to comment 48 ABCC7 p.Trp1282* (D) An example of real-time PCR of the CFTR and the RPS9 genes, of RNA from 2 patients (nos. 8 and 9) homozygous for W1282X and a control individual with normal CFTR alleles. Login to comment 51 ABCC7 p.Trp1282* (F) An example of GeneScan analysis of RT-PCR products of the CFTR and the KRT18, in a patient homozygous for the W1282X mutation (patient 6). Login to comment 55 ABCC7 p.Trp1282* The levels in C, E, and G, are 685 scripts carrying the W1282X mutation, we obtained RNA samples from nasal epithelial cells from patients who had participated in our double-blind, placebo-controlled, crossover trial (29). Login to comment 56 ABCC7 p.Trp1282* The level of nonsense CFTR mRNA was analyzed in pretreatment samples from these patients. Five of the patients were heterozygous for the W1282X and the ΔF508 mutations (Figure 1A). Login to comment 58 ABCC7 p.Trp1282* Thus, the level of mRNA transcribed from W1282X alleles could be distinguished and compared to those transcribed from the ΔF508 allele. Login to comment 59 ABCC7 p.Trp1282* The results showed that the level of the W1282X mRNA among these patients was reduced to between 62% ± 0.05% and 68% ± 0.02% of that transcribed from the ΔF508 allele (Figure 1, B and C). Login to comment 60 ABCC7 p.Trp1282* The other 5 patients carried 2 alleles with CFTR nonsense mutations, of which at least 1 was the W1282X (Figure 1A). Login to comment 62 ABCC7 p.Trp1282* The level of the normalized CFTR nonsense mRNA in each patient was compared to the normalized level obtained from a control individual with normal CFTR alleles. The results revealed that in 3 patients (nos. 6, 7, and 8), the level of CFTR nonsense mRNA was between 60% ± 0.10% and 84% ± 0.12% of that found in a control individual with normal CFTR alleles, similar to the level found in the W1282X/ΔF508 patients (Figure 1, D and E). Login to comment 64 ABCC7 p.Trp1282* We further analyzed 1 patient heterozygous for the W1282X and the ΔF508 mutations (patient 3) by both GeneScan and real-time PCR analyses for comparisons of the results obtained by the different mRNA quantification methods. Login to comment 66 ABCC7 p.Trp1282* Furthermore, 2 of the patients homozygous for W1282X (nos. 8 and 9) are sisters whose parents are first-degree cousins. Login to comment 67 ABCC7 p.Trp1282* Although they carry identical CFTR alleles, there was a large difference in their levels of W1282X transcripts. Login to comment 83 ABCC7 p.Trp1282* ABCC7 p.Trp1282* ABCC7 p.Trp1282* ABCC7 p.Trp1282* ABCC7 p.Trp1282* ABCC7 p.Trp1282* ABCC7 p.Trp1282* ABCC7 p.Trp1282* ABCC7 p.Trp1282* ABCC7 p.Trp1282* ABCC7 p.Trp1282* ABCC7 p.Trp1282* ABCC7 p.Trp1282* ABCC7 p.Gly542* It is important to note that in all previous clinical trials in CF patients, aminoglycosides (22, 23, 29) or other molecules (41-44) affected only the chloride transport Table 1 Study patients and response to gentamicin treatment Patient Genotype Basal NPD Chloride transport Response number Before treatment After gentamicin Before treatment After gentamicin 1 W1282X/ΔF508 -38 -18 -1 -6 + 2 W1282X/ΔF508 -41 -41 -3 -5 + 3 W1282X/ΔF508 -43 -30 -1 -4 + 4 W1282X/ΔF508 -40 -30 4 -4 + 5 W1282X/ΔF508 -40 -30 -2 -2 +/-A 6 W1282X/W1282X -47 -32 0 -9 + 7 W1282X/G542X -43 -45 -2 -11 + 8 W1282X/W1282X -40 -35 11 -9 + 9 W1282X/W1282X -32 -33 2 4 - 10 W1282X/3849+10 kb C→T -65 -56 3 -3 - All values are expressed as mV. Login to comment 91 ABCC7 p.Trp1282* Variable NMD efficiency of endogenous CFTR transcripts carrying the W1282X mutation. Login to comment 92 ABCC7 p.Trp1282* ABCC7 p.Trp1282* Previous studies showed that the level of W1282X transcripts is markedly reduced in epithelial samples derived from CF patients and in a bronchial epithelial cell line, IB3-1, heterozygous for the W1282X and the ΔF508 mutations (5, 45). Login to comment 93 ABCC7 p.Trp1282* These results raised the possibility that transcripts carrying the W1282X mutation are subject to NMD. Login to comment 95 ABCC7 p.Trp1282* ABCC7 p.Trp1282* Since the last CFTR exon-exon junction is located more than 55 nucleotides downstream to the W1282X mutation, transcripts carrying the W1282X mutation have the potential to be subject to NMD. Login to comment 96 ABCC7 p.Trp1282* In order to investigate this possibility, we analyzed nasal epithelial cell lines (CFP15a and CFP15b) derived from polyps of 2 unrelated CF patients, both heterozygous for the W1282X and the 3849+10 kb C→T mutations. Login to comment 101 ABCC7 p.Trp1282* These results suggest that endogenous CFTR W1282X transcripts might be subject to NMD with variable efficiencies. Login to comment 117 ABCC7 p.Trp1282* Together, the results suggest that NMD efficiency for transcripts carrying the W1282X mutation is different among different cell lines even derived from the same tissue. Login to comment 157 ABCC7 p.Trp1282* Previous studies have shown that the level of the W1282X transcripts in these cells is markedly reduced in comparison to the level of transcripts derived from the ΔF508 allele (5). Login to comment 213 ABCC7 p.Trp1282* It is worth noting that the role of posttranscriptional mechanisms in regulating the response to gentamicin cannot be excluded, except for alternative splicing of CFTR exon 20, which we found not be upregulated by the W1282X mutation (Supplemental Results and Supplemental Figure 4). Login to comment 216 ABCC7 p.Trp1282* It is interesting to note that we and others are currently investigating the effect of a newly developed small molecule, PTC124, on CF patients carrying the W1282X mutation (64). Login to comment 218 ABCC7 p.Trp1282* ABCC7 p.Trp1282* ABCC7 p.Trp1282* ABCC7 p.Trp1282* ABCC7 p.Gly542* Methods Patients. Five of the patients were heterozygous for the W1282X and the ΔF508 mutations (patients 1-5); 3 were homozygous for the W1282X mutation (patients 6, 8, and 9); 1 was heterozygous for the W1282X and G542X mutations (patient 7); and 1 was heterozygous for W1282X and 3849+10 kb C→T mutations (patient 10), which can lead to inclusion of an 84-bp cryptic exon harboring a PTC. Login to comment 232 ABCC7 p.Trp1282* The level of the nonsense CFTR mRNA in samples of W1282X/ΔF508 patients was analyzed by RT-PCR with primers in exons 10 and 11, flanking the ΔF508 mutation. Login to comment 234 ABCC7 p.Trp1282* Thus, the level of mRNA transcribed from W1282X alleles could be distinguished and compared to those transcribed from the ΔF508 allele. Login to comment 237 ABCC7 p.Trp1282* The PCR products of the ΔF508 transcripts and the W1282X transcripts were 254 and 257 bp, respectively. Login to comment 241 ABCC7 p.Trp1282* ABCC7 p.Trp1282* The level of the W1282X transcripts was determined as the peak area of the signal of the W1282X PCR product divided by the peak area of the signal of the ΔF508 PCR product. Login to comment 253 ABCC7 p.Trp1282* CFTR primer pair used here was the same as that used for the reactions with samples from the W1282X/ΔF508 patients. Login to comment 265 ABCC7 p.Trp1282* In order to analyze the splicing pattern 691 of the W1282X region, we performed RT-PCR reactions with primers in exons 18 and 21: forward GTAAACTCCAGCATAGATGTGG, reverse CCACTGTTCATAGGGATCCAA. Login to comment 328 ABCC7 p.Gly542* Du, M., et al. 2002. Aminoglycoside suppression of a premature stop mutation in a Cftr-/- mouse carrying a human CFTR-G542X transgene. Login to comment 382 ABCC7 p.Trp1282* Association of a nonsense mutation (W1282X), the most common mutation in the Ashkenazi Jewish cystic fibrosis patients in Israel, with presentation of severe disease. Login to comment 432 ABCC7 p.Trp1282* ABCC7 p.Gly542* CFTR nonsense mutations G542X and W1282X associated with severe reduction of CFTR mRNA in nasal epithelial cells. Login to comment