PMID: 11600715

Solinas A, Brown LJ, McKeen C, Mellor JM, Nicol J, Thelwell N, Brown T
Duplex Scorpion primers in SNP analysis and FRET applications.
Nucleic Acids Res. 2001 Oct 15;29(20):E96., 2001-10-15 [PubMed]
Sentences
No. Mutations Sentence Comment
8 ABCC7 p.Trp1282*
X
ABCC7 p.Trp1282* 11600715:8:64
status: NEW
view ABCC7 p.Trp1282* details
We have demonstrated their use in allelic discrimination at the W1282X locus of the ABCC7 gene and shown that they can be used in assays where fluorescence resonance energy transfer is required. Login to comment
28 ABCC7 p.Trp1282*
X
ABCC7 p.Trp1282* 11600715:28:71
status: NEW
view ABCC7 p.Trp1282* details
We report the use of duplex Scorpions in allelic discrimination at the W1282X locus of the ABCC7 gene (8,9), we compare them to stem-loop Scorpions and demonstrate the use of FRET duplex Scorpions. Login to comment
35 ABCC7 p.Trp1282*
X
ABCC7 p.Trp1282* 11600715:35:75
status: NEW
view ABCC7 p.Trp1282* details
Real-time PCR Human genomic DNA samples, NA 11472 (wild-type) and NA 1723 (W1282X heterozygote), were purchased from Coriell. Login to comment
37 ABCC7 p.Trp1282*
X
ABCC7 p.Trp1282* 11600715:37:34
status: NEW
view ABCC7 p.Trp1282* details
Sequence data for the ABCC7 locus W1282X were obtained from GenBank (11) (see Table 1 for accession numbers and mismatches). Login to comment
41 ABCC7 p.Trp1282*
X
ABCC7 p.Trp1282* 11600715:41:98
status: NEW
view ABCC7 p.Trp1282* details
The design of duplex Scorpions was adapted from the stem-loop version previously evaluated on the W1282X locus (2). Login to comment
56 ABCC7 p.Trp1282*
X
ABCC7 p.Trp1282* 11600715:56:36
status: NEW
view ABCC7 p.Trp1282* details
GenBank accession numbers for locus W1282X Locus GenBank accession no. Login to comment
57 ABCC7 p.Trp1282*
X
ABCC7 p.Trp1282* 11600715:57:48
status: NEW
view ABCC7 p.Trp1282* details
Mutation site Base change Probe-target mismatch W1282X M55127 395 G→A C-A Figure 1. Login to comment
71 ABCC7 p.Trp1282*
X
ABCC7 p.Trp1282* 11600715:71:51
status: NEW
view ABCC7 p.Trp1282* details
ABCC7 p.Trp1282*
X
ABCC7 p.Trp1282* 11600715:71:357
status: NEW
view ABCC7 p.Trp1282* details
ABCC7 p.Trp1282*
X
ABCC7 p.Trp1282* 11600715:71:451
status: NEW
view ABCC7 p.Trp1282* details
ABCC7 p.Trp1282*
X
ABCC7 p.Trp1282* 11600715:71:667
status: NEW
view ABCC7 p.Trp1282* details
ABCC7 p.Trp1282*
X
ABCC7 p.Trp1282* 11600715:71:826
status: NEW
view ABCC7 p.Trp1282* details
Oligonucleotide name Code Oligonucleotide sequence W1282X reverse primer GGCTAAGTCCTTTTGCTCAC Stem-loop FAM Scorpion W-001 2CCCGCGCCTTTCCTCCACTGTTGCGCGCGGG43ATGGTGTGTCTTGGGATTCA Duplex FAM Scorpion 1 W-002 2CTTTCCTCCACTGTTGC3ATGGTGTGTCTTGGGATTCA Quencher oligonucleotide standard W-003 GCAACAGTGGAGGAAAG4 Quencher oligonucleotide short W-004 CAGTGGAGGAAAG4 W1282X FRET stem-loop Scorpion W-005 5CCCGCG8CCTTTCCTCCACTGTTGCGACGCGGG76ATGGTGTGTCTTGGGATTCA W1282X FRET duplex Scorpion 6 base separation W-006 5CTTTCC6CCACTGTTGC3ATGGTGTGTCTTGGGATTCA Double quencher oligo 6 base separation W-007 GCAACAGTGG7GGAAAG4 Internal quencher oligonucleotide W-008 GCAACAGTGG7GGAAAG8 W1282X FRET duplex Scorpion 11 base separation W-009 5CTTTCCTCCAC6GTTGC3ATGGTGTGTCTTGGGATTCA Double quencher oligo 11 base separation W-010 GCAAC7GTGGAGGAAAG4 W1282X FRET duplex Scorpion 3 base separation W-011 5CTT6CCTCCACTGTTGC3ATGGTGTGTCTTGGGATTCA Double quencher oligo 3 base separation W-012 GCAACAGTGGAGG7AAG4 transition rate and cooling at 40°C for 30 s. Login to comment
124 ABCC7 p.Trp1282*
X
ABCC7 p.Trp1282* 11600715:124:42
status: NEW
view ABCC7 p.Trp1282* details
ABCC7 p.Trp1282*
X
ABCC7 p.Trp1282* 11600715:124:110
status: NEW
view ABCC7 p.Trp1282* details
The Scorpions were again evaluated on the W1282X locus and FRET duplex Scorpions were derived from the normal W1282X duplex Scorpion W-002 (Table 2). Login to comment