ABCMdb

PMID: 11274414

Zhong XB, Lizardi PM, Huang XH, Bray-Ward PL, Ward DC
Visualization of oligonucleotide probes and point mutations in interphase nuclei and DNA fibers using rolling circle DNA amplification.
Proc Natl Acad Sci U S A. 2001 Mar 27;98(7):3940-5., 2001-03-27 [PubMed]

Sentences

No. Mutations Sentence Comment

32 ABCC7 p.Gly542* Cell lines with mutations at the G542X locus of the cystic fibrosis transmembrane conductance regulator (CFTR) gene (GM11497, heterozygous mutation; GM11496; homozygous mutations), a cell line (CTL2337) with a single C insertion between nucleotides 5382 and 5383 of the BRCA1 gene, and standard HeLa cell lines, were obtained from the American Tissue Type Collection (Corriel Cell Repositories, Camden, NJ). Login to comment 54 ABCC7 p.Gly542* ABCC7 p.Met1101Lys A mixture of 500 nM decorator probes (Det3-Cy3 for ⌬F508, Det1c-FITC, Det1d-FITC for G542X, Det4-Cy5 for M1101K) in 2 ϫ SSC, 1% BSA, and 0.1% Tween 20 was applied to the slides. Login to comment 68 ABCC7 p.Gly542* ABCC7 p.Met1101Lys Physical mapping of three loci in the CFTR gene region by RCA Locus ODN sequences ⌬508 Probe-primer PRP3 (89): 3Ј-CCCTCTTGACCTCGGAAGTCTCCCATTTTAATTCGTGTCACCTTCTTAAAtttt(CH2)18tttttACGTCATCATGAACATTACACGTTCCAC-3Ј Circle3 (78): GTGGAACGTGTAATGTTCATGATGACGTGCATCCTTGACAGCCGATGAGGCTGGCATCCTTGACAGCCGATGAGGCTG Decorator probe: Det3-Cy3 (24): 5Ј-Cy3-GCATCCTTGACAGCCGATGAGGCT-3Ј G542X Probe-primer PRP1 (89): 3Ј-GAACCTCTTCCACCTTAGTGTGACTCACCTCCAGTTGCTCGTTCTTAAAGtttt(CH2)18tttttATGATCACAGCTGAGGATAGGACATGCGA-3Ј Circle1 (78): CGCATGTCCTATCCTCAGCTGTGATCATCAGAACTCACCTGTTAGACGCCACCAGCTCCAACTGTGAAGATCGCTTAT Decorator probe: Det1c-FITC (18): 5Ј-FITC-TCAGAACTCACCTGTTAG-3Ј; Det1d-FITC (18): 5Ј-FITC-ACTGTGAAGATCGCTTAT-3Ј M1101K Probe-primer PRP4 (89): 3Ј-GACGGTTGACCAAGAACATGGACAGTTGTGACGCGACCAAGGTTTACTCTtttt(CH2)18tttttCTTGTACATGTCTCAGTAGCTCGTCAGT-3Ј Circle4 (78): ACTGACGAGCTACTGAGACATGTACAAGGAGCAGTCCTGT˙CAGCTAGGTCACGGAGCAGTCCTGTCAGCTAGGTCACG Decorator probe: Det4-Cy5 (24): 5Ј-Cy5-GAGCAGTCCTGTCAGCTAGGTCACG-3Ј Bold type: probe sequence; lowercase tttt(CH2)18ttttt: linker; standard type: RCA primer, circle, and decorator ODN sequences. Note that probe-primer and AD-P2-ODNs have polarity reversal and two 3Ј ends. Login to comment 75 ABCC7 p.Gly542* Human genomic DNA fibers were stretched from freshly cultured normal peripheral blood lymphocytes and GM11496 cells (homozygous G542X mutation). Login to comment 93 ABCC7 p.Gly542* ABCC7 p.Met1101Lys A mixture of 500 nM decorator probes (Det3-Cy3 for ⌬F508, Det1c-FITC, Det1d-FITC for G542X, Det4-Cy5 for M1101K) in 2 ϫ SSC, 1% BSA, and 0.1% Tween 20 was applied to the slides. Login to comment 100 ABCC7 p.Gly542* Experiments designed for allele discrimination at the G542X locus did not use the PAC prehybridization step outlined above. Login to comment 101 ABCC7 p.Gly542* ABCC7 p.Met1101Lys Instead, the P1 anchor ODN and the pair of P2 AD-ODNs for the G542X locus were cohybridized with the 50-mer non-AD-ODN probes for the ⌬508 and M1101K loci, which acted as reference markers. Login to comment 102 ABCC7 p.Gly542* The hybridization, ligation, RCA reactions, washes, and signal detection conditions were carried out as described for the detection of G542X mutations in interphase cells. Login to comment 122 ABCC7 p.Gly542* To test the ability of RCA to detect small genomic DNA sequences within interphase nuclei and stretched DNA fibers we chose three 50-bp targets at the ⌬508, G542X, and M101K mutation loci within the CFTR gene. Login to comment 131 ABCC7 p.Gly542* In Fig. 2A, the RCA products from the ⌬508, G542X, and M11101K probes were detected by Cy3-, FITC-, and Cy5-labeled decorator ODNs, respectively. Login to comment 136 ABCC7 p.Gly542* ABCC7 p.Met1101Lys The overall RCA detection efficiency at the ⌬508, G542X, and M1101K loci averaged 37%, 45%, and 35%, respectively. Login to comment 140 ABCC7 p.Gly542* ABCC7 p.Met1101Lys (A) RCA detection of probes targeted to the G542X locus (FITC), the ⌬508 locus (Cy-3), and the M1101K locus (Cy5) in normal human lymphocytes. Login to comment 143 ABCC7 p.Gly542* ABCC7 p.Met1101Lys (C) Cohybridization of two PAC clones (extended green and red signals) with ⌬508 (yellow), G542X (green), and M1101K (white) oligomer probes. Login to comment 153 ABCC7 p.Gly542* ABCC7 p.Met1101Lys The overall efficiency in detecting RCA signals at the ⌬508, G542X, and M1101K loci were 48%, 44%, and 36% respectively. Login to comment 157 ABCC7 p.Gly542* The sequences of the P1 and the two AD-P2 ODNs designed to detect mutations at the G542X locus of the CFTR gene are given in Table 2. Login to comment 172 ABCC7 p.Gly542* ABCC7 p.Gly542* Detection of the G542X mutation also was done on stretched DNA fibers prepared from normal lymphocytes and the GM11496 cell line homozygous for the G542X mutation (Fig. 3B). Login to comment 173 ABCC7 p.Met1101Lys Here, P1 and AD P2 ODNs were cohybridized with the nonallele discriminating ⌬508 and M1101K 50mer probes previously used for small target detection (Fig. 2 A and B). Login to comment 176 ABCC7 p.Gly542* RCA detection of wt and mu alleles at the G542X locus of the CFTR gene. Login to comment 178 ABCC7 p.Gly542* (B) Discrimination of wt and mu alleles of the G542X locus on stretched DNA fibers. Login to comment 182 ABCC7 p.Met1101Lys The wt ⌬508 and M1101K loci were detected by using Cy3- and Cy5-labeled probes, respectively. Login to comment 183 ABCC7 p.Gly542* The wt G542X allele is labeled with Cy5 while the mu allele is labeled with Cy3. Login to comment 184 ABCC7 p.Gly542* ABCC7 p.Gly542* The merged image (Com) shows a yellow-blue-white hybridization pattern when the G542X allele is wt and a yellow-green-white pattern when G542X is a mu allele. Login to comment 186 ABCC7 p.Gly542* It was apparent, however, that wt and mu alleles at the G542X could be readily detected as many fibers showing the hybridization profiles illustrated in Fig. 3B were observed. Login to comment