ABCC2 p.Leu1107Arg
| Predicted by SNAP2: | A: N (53%), C: N (72%), D: D (80%), E: D (71%), F: N (82%), G: D (71%), H: D (59%), I: N (72%), K: D (80%), M: N (82%), N: D (71%), P: D (75%), Q: D (66%), R: D (80%), S: D (59%), T: D (59%), V: N (78%), W: D (71%), Y: N (61%), |
| Predicted by PROVEAN: | A: N, C: D, D: D, E: D, F: N, G: D, H: N, I: N, K: D, M: N, N: D, P: D, Q: D, R: D, S: D, T: N, V: N, W: N, Y: N, |
[switch to compact view]
Comments [show]
None has been submitted yet.
[hide] Genetic variations and haplotypes of ABCC2 encodin... Drug Metab Pharmacokinet. 2008;23(2):139-47. Sai K, Saito Y, Itoda M, Fukushima-Uesaka H, Nishimaki-Mogami T, Ozawa S, Maekawa K, Kurose K, Kaniwa N, Kawamoto M, Kamatani N, Shirao K, Hamaguchi T, Yamamoto N, Kunitoh H, Ohe Y, Yamada Y, Tamura T, Yoshida T, Minami H, Matsumura Y, Ohtsu A, Saijo N, Sawada J
Genetic variations and haplotypes of ABCC2 encoding MRP2 in a Japanese population.
Drug Metab Pharmacokinet. 2008;23(2):139-47., [PMID:18445995]
Abstract [show]
The multidrug resistance-associated protein 2 (MRP2) encoded by the ABCC2 gene is expressed in the liver, intestine and kidneys and preferentially exports organic anions or conjugates with glucuronide or glutathione. In this study, all 32 exons and the 5'-flanking region of ABCC2 in 236 Japanese were resequenced, and 61 genetic variations including 5 novel nonsynonymous ones were detected. A total of 64 haplotypes were determined/inferred and classified into five *1 haplotype groups (*1A, *1B, *1C, *1G, and *1H) without nonsynonymous substitutions and *2 to *9 groups with nonsynonymous variations. Frequencies of the major 4 haplotype groups *1A (-1774delG), *1B (no common SNP), *1C (-24C>T and 3972C>T), and *2 [1249G>A (Val417Ile)] were 0.331, 0.292, 0.172, and 0.093, respectively. This study revealed that haplotype *1A, which has lowered activity, is quite common in Japanese, and that the frequency of *1C, another functional haplotype, was comparable to frequencies in Asians and Caucasians. In contrast, the haplotypes harboring 3972C>T but not -24C>T (*1G group), which are reportedly common in Caucasians, were minor in Japanese. Moreover, the allele 1446C>T (Thr482Thr), which has increased activity, was not detected in our Japanese population. These findings imply possible differences in MRP2-mediated drug responses between Asians and Caucasians.
Comments [show]
None has been submitted yet.
No. Sentence Comment
55 The novel non-synonymous variations were 1177CÀT (Arg393Trp), 1202AÀG (Tyr401Cys), 2358CÀA (Asp786Glu), 2801GÀA (Arg934Gln), and 3320TÀG (Leu1107Arg), and their frequencies were 0.002.
X
ABCC2 p.Leu1107Arg 18445995:55:163
status: NEW68 Summary of ABCC2 variations detected in this study SNP ID Position This Study dbSNP (NCBI) JSNP Reference Location NT_030059.12 From the translational initiation site or from the end of the nearest exon Nucleotide change Amino acid change Frequency (total＝472) MPJ6_AC 2082 8 5?-Flanking 20289354 －1774 acttatcttgttG/_tttttttttttt 0.343 MPJ6_AC 2078 a 5?-Flanking 20289538 －1590 tttaatttgttaG/Atgtatgtttgct 0.002 MPJ6_AC 2079 8, 10, 17 5?-Flanking 20289579 －1549 tccttatagtatG/Attgtggatatta 0.203 MPJ6_AC 2080 9, 17 5?-Flanking 20290105 －1023 tgggaggccaagG/Acagaaggattgt 0.343 MPJ6_AC 2081 10, 17 5?-Flanking 20290109 －1019 aggccaaggcagA/Gaggattgttgaa 0.203 MPJ6_AC 2028 a 5?-Flanking 20290395 －733 acagtttctagcG/Tactgatgccacc 0.004 MPJ6_AC 2029 5?-Flanking 20290395 －733 acagtttctagcG/Aactgatgccacc 0.002 MPJ6_AC 2030 a 5?-Flanking 20290715 －413 ttgcagcagaagC/Tgaaactgcacat 0.002 MPJ6_AC 2003 ssj0000371 9, 12, 15-18, 20, 26 Exon 1 20291104 －24 tagaagagtcttC/Tgttccagacgca 0.174 MPJ6_AC 2004 18 Exon 1 20291105 －23 agaagagtcttcG/Attccagacgcag 0.006 MPJ6_AC 2031 ssj0000386 17, 26 Intron 3 20301785 IVS3 －49 ctcccctcagtcC/Ttcggttagtggc 0.203 MPJ6_AC 2032 a Intron 6 20302837 IVS6 ＋86 tattttattattT/Atttttttgagat 0.076 MPJ6_AC 2033 a Exon 7 20305479 732 caagtttgaaacG/Acacatgaagaga Thr244Thr 0.002 MPJ6_AC 2066 a Intron 7 20307421 IVS7 －69 tcacaggctgacC/Gaccctggagctg 0.002 MPJ6_AC 2067 a Intron 7 20307423 IVS7 －67 acaggctgaccaC/Acctggagctgct 0.002 MPJ6_AC 2035 a Exon 9 20308814 1177 ggtgtaaaagtaC/Tggacagctatca Arg393Trp 0.002 MPJ6_AC 2068 a Exon 9 20308839 1202 tggcttctgtatA/Gtaagaaggtaag Tyr401Cys 0.002 MPJ6_AC 2036 a Intron 9 20308859 IVS9 ＋13 gtaagcagaataC/Tggcaggtatcac 0.002 MPJ6_AC 2037 a Exon 10 20312319 1227 gaccctatccaaC/Tttggccaggaag Asn409Asn 0.002 MPJ6_AC 2009 ssj0000388 17, 18, 20, 23-26 Exon 10 20312341 1249 aaggagtacaccG/Attggagaaacag Val417Ile 0.097 MPJ6_AC 2010 18 Exon 10 20312549 1457 ccaagagtaagaC/Tcattcaggtaaa Thr486Ile 0.019 MPJ6_AC 2069 a Intron 11 20315600 IVS11 －67 taaaacatgggtG/Agatcagatacac 0.002 MPJ6_AC 2038 ssj0000390 26 Intron 12 20315952 IVS12 ＋148 ccgccccatgccA/Gcttttcctcctt 0.210 MPJ6_AC 2039 a Intron 13 20318344 IVS13 －73 tcatggactaacG/Aacaaagtcaaaa 0.002 MPJ6_AC 2070 a Intron 14 20318515 IVS14 ＋14 taaataaatttgG/Taagttgcttccc 0.002 MPJ6_AC 2040 a Intron 14 20318521 IVS14 ＋20 aatttggaagtt(del/ins) b cagcaaactga 0.002 MPJ6_AC 2071 a Intron 14 20318594 IVS14 ＋93 agcaaactgagaG/Tagagtgtggaga 0.002 MPJ6_AC 2041 a Intron 14 20319757 IVS14 －62 cggagagagacaC/Tgtgagggcagac 0.002 MPJ6_AC 2042 a Intron 14 20319758 IVS14 －61 ggagagagacacG/Atgagggcagaca 0.006 MPJ6_AC 2043 ssj0000393 26 Intron 15 20320054 IVS15 ＋169 aaagcaaaggttT/Ctcagccccttcc 0.210 MPJ6_AC 2044 a Intron 15 20321170 IVS15 －131 gtcttgtatatcC/Gaaggcaaatttt 0.004 MPJ6_AC 2045 a Intron 16 20325422 IVS16 －169 ttgagtcctgagA/Tgtggaataacta 0.004 MPJ6_AC 2046 ssj0000396 17 Intron 16 20325486 IVS16 －105 tgcacagttattC/Taaatttaagctc 0.214 MPJ6_AC 2072 a Exon 18 20327159 2358 tcttctagatgaC/Acccctgtctgca Asp786Glu 0.002 MPJ6_AC 2012 18, 20, 23 Exon 18 20327167 2366 atgaccccctgtC/Ttgcagtggatgc Ser789Phe 0.008 MPJ6_AC 2073 a Intron 19 20327555 IVS19 ＋3 gaagccacaggtA/Gtgtaagaaggat 0.002 MPJ6_AC 2047 a Intron 19 20327645 IVS19 ＋93 agtatccagtgaA/Tctagatttggaa 0.002 MPJ6_AC 2048 Intron 20 20338745 IVS20 ＋29 gctggcagccctC/Agtcagctctata 0.002 MPJ6_AC 2049 a Exon 21 20339052 2801 ccttgaaaactcG/Agaatgtgaatag Arg934Gln 0.002 MPJ6_AC 2015 ssj0000398 8, 18, 26 Exon 22 20339944 2934 aggattgttttcG/Aatattcttcatc Ser978Ser 0.040 MPJ6_AC 2050 a Exon 22 20340061 3051 cgactatccagcA/Gtctcagagggac Ala1017Ala 0.002 MPJ6_AC 2051 a Exon 23 20340337 3181 cacaagcaactgC/Ttgaacaatatcc Leu1061Leu 0.002 MPJ6_AC 2052 ssj0000399 17, 26 Intron 23 20340470 IVS23 ＋56 ggatctttctgaC/Tagggaggaatta 0.222 MPJ6_AC 2074 a Exon 24 20342724 3320 ttacatgcttccT/Gggggataatcag Leu1107Arg 0.002 MPJ6_AC 2053 Intron 24 20342843 IVS24 ＋25 atggctaagtcaT/Cccttccttcctc 0.030 MPJ6_AC 2075 a Intron 24 20342880 IVS24 ＋62 agcccagcctctT/Ctcctgagaatct 0.002 MPJ6_AC 2054 Intron 24 20342926 IVS24 ＋108 cactcactcctcC/Tcctcagcagctt 0.023 MPJ6_AC 2055 a Intron 24 20344318 IVS24 －56 agaaaggaggaaG/Aatggtggatgcc 0.002 MPJ6_AC 2056 a Intron 26 20352061 IVS26 －21 atgatgattttcA/Ggtcttctggttt 0.002 MPJ6_AC 2057 a Intron 27 20352227 IVS27 ＋44 ggcaaaaacaacA/Gtgcaactccttc 0.008 MPJ6_AC 2058 ssj0000404 17, 26 Intron 27 20352307 IVS27 ＋124 aaagtttcctttC/Gctctaactcaaa 0.222 MPJ6_AC 2076 26 Exon 28 20352688 3927 ccaagtgcggtaC/Tcgacctgagctg Tyr1309Tyr 0.002 MPJ6_AC 2022 ssj0000407 8, 12, 13, 17, 18, 20, 26 Exon 28 20352733 3972 cacttgtgacatC/Tggtagcatggag Ile1324Ile 0.216 MPJ6_AC 2059 a Intron 28 20352920 IVS28 ＋172 agggaaggatagC/Tagccagggatca 0.004 MPJ6_AC 2060 a Intron 29 20354201 IVS29 ＋136 cttgagctagttC/Tcctaggatggac 0.002 MPJ6_AC 2061 ssj0000408 26 Intron 29 20354219 IVS29 ＋154 gatggacacgtcA/Gtttccagaactt 0.367 MPJ6_AC 2062 IMS-JST090926 17 Intron 29 20355209 IVS29 －35 cttttctggcatG/Aagccccaacagc 0.015 MPJ6_AC 2063 a Intron 30 20358793 IVS30 －92 ggggggttttgaA/Gagtctgatctgg 0.008 MPJ6_AC 2064 IMS-JST185750 Intron 30 20358832 IVS30 －53 ccccctgccctgC/Tgtctttccttgg 0.051 MPJ6_AC 2077 a 3?-UTR 20359975 *61 c taattttattttT/Gtataaaatacag 0.002 MPJ6_AC 2065 a 3?-Flanking 20360190 *193＋83 c ttattcctttgcC/Gtttcatttctgt 0.002a8 a Novel genetic variation b delGCTTCCCAAACTTATTCGCAGTACTGGTGCCAGAATTTTGATAATACAAGAGCTTAGTAG/insTATTTACCT c Numbered from the termination codon.
X
ABCC2 p.Leu1107Arg 18445995:68:4071
status: NEW88 Other rare haplotypes with novel nonsynonymous variation, *5 [2801GÀA (Arg934Gln)], *6 [3320TÀG (Leu1107Arg)], *7 [1177CÀT (Arg393Trp)], *8 [1202AÀG (Tyr401Cys)], and *9 [2358CÀA (Asp786Glu)] were found each in only one subject as heterozygote at a 0.002 frequency.
X
ABCC2 p.Leu1107Arg 18445995:88:107
status: NEW93 This analysis predicted a possible functional change of Leu1107Arg (*6) due to substitution in (146) the transmembrane region (PHAT matrix element difference＝－6), and probable functional effects of Arg393Trp (*7) (PSIC score difference＝3.053), Tyr401Cys (*8) (3.382) and Asp786Glu (*9) (2.277), but no functional effects of *3 (1.446) and *5 (0.326).
X
ABCC2 p.Leu1107Arg 18445995:93:56
status: NEW