ABCC2 p.Arg393Trp
| Predicted by SNAP2: | A: D (85%), C: D (75%), D: D (95%), E: D (91%), F: D (91%), G: D (91%), H: D (85%), I: D (85%), K: D (59%), L: D (91%), M: D (85%), N: D (85%), P: D (95%), Q: D (75%), S: D (85%), T: D (85%), V: D (85%), W: D (91%), Y: D (91%), |
| Predicted by PROVEAN: | A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, K: N, L: D, M: D, N: D, P: D, Q: D, S: D, T: D, V: D, W: D, Y: D, |
[switch to compact view]
Comments [show]
None has been submitted yet.
[hide] Additive effects of drug transporter genetic polym... Cancer Chemother Pharmacol. 2010 May;66(1):95-105. Epub 2009 Sep 22. Sai K, Saito Y, Maekawa K, Kim SR, Kaniwa N, Nishimaki-Mogami T, Sawada J, Shirao K, Hamaguchi T, Yamamoto N, Kunitoh H, Ohe Y, Yamada Y, Tamura T, Yoshida T, Matsumura Y, Ohtsu A, Saijo N, Minami H
Additive effects of drug transporter genetic polymorphisms on irinotecan pharmacokinetics/pharmacodynamics in Japanese cancer patients.
Cancer Chemother Pharmacol. 2010 May;66(1):95-105. Epub 2009 Sep 22., [PMID:19771428]
Abstract [show]
PURPOSE: Effects of genetic polymorphisms/variations of ABCB1, ABCC2, ABCG2 and SLCO1B1 in addition to "UGT1A1*28 or *6" on irinotecan pharmacokinetics/pharmacodynamics in Japanese cancer patients were investigated. METHODS: Associations between transporter haplotypes/variations along with UGT1A1*28 or *6 and SN-38 area under the time-concentration curve (AUC) or neutropenia were examined in irinotecan monotherapy (55 patients) and irinotecan-cisplatin-combination therapy (62 patients). RESULTS: Higher SN-38 AUC values were observed in ABCB1 2677G>T (A893S) (*2 group) for both regimens. Associations of grade 3/4 neutropenia were observed with ABCC2 -1774delG (*1A), ABCG2 421C>A (Q141K) and IVS12 + 49G>T ((#) IIB) and SLCO1B1 521T>C (V174A) (*15 x 17) in the irinotecan monotherapy, while they were evident only in homozygotes of ABCB1*2, ABCG2 (#) IIB, SLCO1B1*15 x 17 in the cisplatin-combination therapy. With combinations of haplotypes/variations of two or more genes, neutropenia incidence increased, but their prediction power for grade 3/4 neutropenia is still unsatisfactory. CONCLUSIONS: Certain transporter genotypes additively increased irinotecan-induced neutropenia, but their clinical importance should be further elucidated.
Comments [show]
None has been submitted yet.
No. Sentence Comment
124 patients who experienced grade 4 neutropenia ID Gene Genetic variation Nucleotide change (amino acid substitution) Haplotypea b1 ABCB1 304G[C (G102R) Block 1 *3 b2(B)b 1804G[A (D602N) Block 2 *12 b3(B)b 1342G[A (E448K) Block 2 *14 b4 3043A[G (T1015A) Block 2 *16 b5 3751G[A (V1251I) Block 3 *2 c1 ABCC2 1177C[T (R393W) *7 g1 ABCG2 376C[T (Q126X) Block 1 *4 g2 1465T[C (F489L) Block 2 *2 g3 1723C[T (R575X) Block 2 *5 s1(S)c SLCO1B1 1007C[G (P336R) s2 311T[A (M104K) u1 UGT1A1 -3279T[G, 1941C[G # 60-# IB (?/?)
X
ABCC2 p.Arg393Trp 19771428:124:312
status: NEW[hide] Mutational analysis of ABCC2 gene in two siblings ... Clin Genet. 2010 Dec;78(6):598-600. doi: 10.1111/j.1399-0004.2010.01497.x. Pacifico L, Carducci C, Poggiogalle E, Caravona F, Antonozzi I, Chiesa C, Maggiore G
Mutational analysis of ABCC2 gene in two siblings with neonatal-onset Dubin Johnson syndrome.
Clin Genet. 2010 Dec;78(6):598-600. doi: 10.1111/j.1399-0004.2010.01497.x., [PMID:21044052]
Abstract [show]
Comments [show]
None has been submitted yet.
No. Sentence Comment
28 The study of allelic segregation in Letter to the Editor R100X R393W IVS6_IVS7del L441M IVS13 +2 T>A IVS15 +2 T>C G676R IVS18 +2 T>C R768W * 2748_2883del * R1066X * 3399_3400del L1173F 3615_3843del* Y1275X * R1310X Q1382R R1392_M1393del S325X W709R T1273A IVS8 +4 A>G 1256_1272delins CT 4292_4293delR1150H E1352Q * Exon 1 32 Fig. 1.
X
ABCC2 p.Arg393Trp 21044052:28:65
status: NEW[hide] ABCC2/Abcc2: a multispecific transporter with domi... Drug Metab Rev. 2010 Aug;42(3):402-36. Jemnitz K, Heredi-Szabo K, Janossy J, Ioja E, Vereczkey L, Krajcsi P
ABCC2/Abcc2: a multispecific transporter with dominant excretory functions.
Drug Metab Rev. 2010 Aug;42(3):402-36., [PMID:20082599]
Abstract [show]
ABCC2/Abcc2 (MRP2/Mrp2) is expressed at major physiological barriers, such as the canalicular membrane of liver cells, kidney proximal tubule epithelial cells, enterocytes of the small and large intestine, and syncytiotrophoblast of the placenta. ABCC2/Abcc2 always localizes in the apical membranes. Although ABCC2/Abcc2 transports a variety of amphiphilic anions that belong to different classes of molecules, such as endogenous compounds (e.g., bilirubin-glucuronides), drugs, toxic chemicals, nutraceuticals, and their conjugates, it displays a preference for phase II conjugates. Phenotypically, the most obvious consequence of mutations in ABCC2 that lead to Dubin-Johnson syndrome is conjugate hyperbilirubinemia. ABCC2/Abcc2 harbors multiple binding sites and displays complex transport kinetics.
Comments [show]
None has been submitted yet.
No. Sentence Comment
113 Among these mutations recently compiled by Nies and Keppler (2007), of the five amino acids affected that are located outside the nucleotide-binding domains, four are basic (R100X, R393W, R1066X, and R1150H) and one is neutral (I1173F).
X
ABCC2 p.Arg393Trp 20082599:113:181
status: NEW116 For the R100X, R393W, and R1066X, in vitro expression and analysis needs to be carried out to explore if functional activity is affected by the mutation.
X
ABCC2 p.Arg393Trp 20082599:116:15
status: NEW[hide] Genetic variations and haplotypes of ABCC2 encodin... Drug Metab Pharmacokinet. 2008;23(2):139-47. Sai K, Saito Y, Itoda M, Fukushima-Uesaka H, Nishimaki-Mogami T, Ozawa S, Maekawa K, Kurose K, Kaniwa N, Kawamoto M, Kamatani N, Shirao K, Hamaguchi T, Yamamoto N, Kunitoh H, Ohe Y, Yamada Y, Tamura T, Yoshida T, Minami H, Matsumura Y, Ohtsu A, Saijo N, Sawada J
Genetic variations and haplotypes of ABCC2 encoding MRP2 in a Japanese population.
Drug Metab Pharmacokinet. 2008;23(2):139-47., [PMID:18445995]
Abstract [show]
The multidrug resistance-associated protein 2 (MRP2) encoded by the ABCC2 gene is expressed in the liver, intestine and kidneys and preferentially exports organic anions or conjugates with glucuronide or glutathione. In this study, all 32 exons and the 5'-flanking region of ABCC2 in 236 Japanese were resequenced, and 61 genetic variations including 5 novel nonsynonymous ones were detected. A total of 64 haplotypes were determined/inferred and classified into five *1 haplotype groups (*1A, *1B, *1C, *1G, and *1H) without nonsynonymous substitutions and *2 to *9 groups with nonsynonymous variations. Frequencies of the major 4 haplotype groups *1A (-1774delG), *1B (no common SNP), *1C (-24C>T and 3972C>T), and *2 [1249G>A (Val417Ile)] were 0.331, 0.292, 0.172, and 0.093, respectively. This study revealed that haplotype *1A, which has lowered activity, is quite common in Japanese, and that the frequency of *1C, another functional haplotype, was comparable to frequencies in Asians and Caucasians. In contrast, the haplotypes harboring 3972C>T but not -24C>T (*1G group), which are reportedly common in Caucasians, were minor in Japanese. Moreover, the allele 1446C>T (Thr482Thr), which has increased activity, was not detected in our Japanese population. These findings imply possible differences in MRP2-mediated drug responses between Asians and Caucasians.
Comments [show]
None has been submitted yet.
No. Sentence Comment
55 The novel non-synonymous variations were 1177CÀT (Arg393Trp), 1202AÀG (Tyr401Cys), 2358CÀA (Asp786Glu), 2801GÀA (Arg934Gln), and 3320TÀG (Leu1107Arg), and their frequencies were 0.002.
X
ABCC2 p.Arg393Trp 18445995:55:55
status: NEW68 Summary of ABCC2 variations detected in this study SNP ID Position This Study dbSNP (NCBI) JSNP Reference Location NT_030059.12 From the translational initiation site or from the end of the nearest exon Nucleotide change Amino acid change Frequency (total＝472) MPJ6_AC 2082 8 5?-Flanking 20289354 －1774 acttatcttgttG/_tttttttttttt 0.343 MPJ6_AC 2078 a 5?-Flanking 20289538 －1590 tttaatttgttaG/Atgtatgtttgct 0.002 MPJ6_AC 2079 8, 10, 17 5?-Flanking 20289579 －1549 tccttatagtatG/Attgtggatatta 0.203 MPJ6_AC 2080 9, 17 5?-Flanking 20290105 －1023 tgggaggccaagG/Acagaaggattgt 0.343 MPJ6_AC 2081 10, 17 5?-Flanking 20290109 －1019 aggccaaggcagA/Gaggattgttgaa 0.203 MPJ6_AC 2028 a 5?-Flanking 20290395 －733 acagtttctagcG/Tactgatgccacc 0.004 MPJ6_AC 2029 5?-Flanking 20290395 －733 acagtttctagcG/Aactgatgccacc 0.002 MPJ6_AC 2030 a 5?-Flanking 20290715 －413 ttgcagcagaagC/Tgaaactgcacat 0.002 MPJ6_AC 2003 ssj0000371 9, 12, 15-18, 20, 26 Exon 1 20291104 －24 tagaagagtcttC/Tgttccagacgca 0.174 MPJ6_AC 2004 18 Exon 1 20291105 －23 agaagagtcttcG/Attccagacgcag 0.006 MPJ6_AC 2031 ssj0000386 17, 26 Intron 3 20301785 IVS3 －49 ctcccctcagtcC/Ttcggttagtggc 0.203 MPJ6_AC 2032 a Intron 6 20302837 IVS6 ＋86 tattttattattT/Atttttttgagat 0.076 MPJ6_AC 2033 a Exon 7 20305479 732 caagtttgaaacG/Acacatgaagaga Thr244Thr 0.002 MPJ6_AC 2066 a Intron 7 20307421 IVS7 －69 tcacaggctgacC/Gaccctggagctg 0.002 MPJ6_AC 2067 a Intron 7 20307423 IVS7 －67 acaggctgaccaC/Acctggagctgct 0.002 MPJ6_AC 2035 a Exon 9 20308814 1177 ggtgtaaaagtaC/Tggacagctatca Arg393Trp 0.002 MPJ6_AC 2068 a Exon 9 20308839 1202 tggcttctgtatA/Gtaagaaggtaag Tyr401Cys 0.002 MPJ6_AC 2036 a Intron 9 20308859 IVS9 ＋13 gtaagcagaataC/Tggcaggtatcac 0.002 MPJ6_AC 2037 a Exon 10 20312319 1227 gaccctatccaaC/Tttggccaggaag Asn409Asn 0.002 MPJ6_AC 2009 ssj0000388 17, 18, 20, 23-26 Exon 10 20312341 1249 aaggagtacaccG/Attggagaaacag Val417Ile 0.097 MPJ6_AC 2010 18 Exon 10 20312549 1457 ccaagagtaagaC/Tcattcaggtaaa Thr486Ile 0.019 MPJ6_AC 2069 a Intron 11 20315600 IVS11 －67 taaaacatgggtG/Agatcagatacac 0.002 MPJ6_AC 2038 ssj0000390 26 Intron 12 20315952 IVS12 ＋148 ccgccccatgccA/Gcttttcctcctt 0.210 MPJ6_AC 2039 a Intron 13 20318344 IVS13 －73 tcatggactaacG/Aacaaagtcaaaa 0.002 MPJ6_AC 2070 a Intron 14 20318515 IVS14 ＋14 taaataaatttgG/Taagttgcttccc 0.002 MPJ6_AC 2040 a Intron 14 20318521 IVS14 ＋20 aatttggaagtt(del/ins) b cagcaaactga 0.002 MPJ6_AC 2071 a Intron 14 20318594 IVS14 ＋93 agcaaactgagaG/Tagagtgtggaga 0.002 MPJ6_AC 2041 a Intron 14 20319757 IVS14 －62 cggagagagacaC/Tgtgagggcagac 0.002 MPJ6_AC 2042 a Intron 14 20319758 IVS14 －61 ggagagagacacG/Atgagggcagaca 0.006 MPJ6_AC 2043 ssj0000393 26 Intron 15 20320054 IVS15 ＋169 aaagcaaaggttT/Ctcagccccttcc 0.210 MPJ6_AC 2044 a Intron 15 20321170 IVS15 －131 gtcttgtatatcC/Gaaggcaaatttt 0.004 MPJ6_AC 2045 a Intron 16 20325422 IVS16 －169 ttgagtcctgagA/Tgtggaataacta 0.004 MPJ6_AC 2046 ssj0000396 17 Intron 16 20325486 IVS16 －105 tgcacagttattC/Taaatttaagctc 0.214 MPJ6_AC 2072 a Exon 18 20327159 2358 tcttctagatgaC/Acccctgtctgca Asp786Glu 0.002 MPJ6_AC 2012 18, 20, 23 Exon 18 20327167 2366 atgaccccctgtC/Ttgcagtggatgc Ser789Phe 0.008 MPJ6_AC 2073 a Intron 19 20327555 IVS19 ＋3 gaagccacaggtA/Gtgtaagaaggat 0.002 MPJ6_AC 2047 a Intron 19 20327645 IVS19 ＋93 agtatccagtgaA/Tctagatttggaa 0.002 MPJ6_AC 2048 Intron 20 20338745 IVS20 ＋29 gctggcagccctC/Agtcagctctata 0.002 MPJ6_AC 2049 a Exon 21 20339052 2801 ccttgaaaactcG/Agaatgtgaatag Arg934Gln 0.002 MPJ6_AC 2015 ssj0000398 8, 18, 26 Exon 22 20339944 2934 aggattgttttcG/Aatattcttcatc Ser978Ser 0.040 MPJ6_AC 2050 a Exon 22 20340061 3051 cgactatccagcA/Gtctcagagggac Ala1017Ala 0.002 MPJ6_AC 2051 a Exon 23 20340337 3181 cacaagcaactgC/Ttgaacaatatcc Leu1061Leu 0.002 MPJ6_AC 2052 ssj0000399 17, 26 Intron 23 20340470 IVS23 ＋56 ggatctttctgaC/Tagggaggaatta 0.222 MPJ6_AC 2074 a Exon 24 20342724 3320 ttacatgcttccT/Gggggataatcag Leu1107Arg 0.002 MPJ6_AC 2053 Intron 24 20342843 IVS24 ＋25 atggctaagtcaT/Cccttccttcctc 0.030 MPJ6_AC 2075 a Intron 24 20342880 IVS24 ＋62 agcccagcctctT/Ctcctgagaatct 0.002 MPJ6_AC 2054 Intron 24 20342926 IVS24 ＋108 cactcactcctcC/Tcctcagcagctt 0.023 MPJ6_AC 2055 a Intron 24 20344318 IVS24 －56 agaaaggaggaaG/Aatggtggatgcc 0.002 MPJ6_AC 2056 a Intron 26 20352061 IVS26 －21 atgatgattttcA/Ggtcttctggttt 0.002 MPJ6_AC 2057 a Intron 27 20352227 IVS27 ＋44 ggcaaaaacaacA/Gtgcaactccttc 0.008 MPJ6_AC 2058 ssj0000404 17, 26 Intron 27 20352307 IVS27 ＋124 aaagtttcctttC/Gctctaactcaaa 0.222 MPJ6_AC 2076 26 Exon 28 20352688 3927 ccaagtgcggtaC/Tcgacctgagctg Tyr1309Tyr 0.002 MPJ6_AC 2022 ssj0000407 8, 12, 13, 17, 18, 20, 26 Exon 28 20352733 3972 cacttgtgacatC/Tggtagcatggag Ile1324Ile 0.216 MPJ6_AC 2059 a Intron 28 20352920 IVS28 ＋172 agggaaggatagC/Tagccagggatca 0.004 MPJ6_AC 2060 a Intron 29 20354201 IVS29 ＋136 cttgagctagttC/Tcctaggatggac 0.002 MPJ6_AC 2061 ssj0000408 26 Intron 29 20354219 IVS29 ＋154 gatggacacgtcA/Gtttccagaactt 0.367 MPJ6_AC 2062 IMS-JST090926 17 Intron 29 20355209 IVS29 －35 cttttctggcatG/Aagccccaacagc 0.015 MPJ6_AC 2063 a Intron 30 20358793 IVS30 －92 ggggggttttgaA/Gagtctgatctgg 0.008 MPJ6_AC 2064 IMS-JST185750 Intron 30 20358832 IVS30 －53 ccccctgccctgC/Tgtctttccttgg 0.051 MPJ6_AC 2077 a 3?-UTR 20359975 *61 c taattttattttT/Gtataaaatacag 0.002 MPJ6_AC 2065 a 3?-Flanking 20360190 *193＋83 c ttattcctttgcC/Gtttcatttctgt 0.002a8 a Novel genetic variation b delGCTTCCCAAACTTATTCGCAGTACTGGTGCCAGAATTTTGATAATACAAGAGCTTAGTAG/insTATTTACCT c Numbered from the termination codon.
X
ABCC2 p.Arg393Trp 18445995:68:1618
status: NEW88 Other rare haplotypes with novel nonsynonymous variation, *5 [2801GÀA (Arg934Gln)], *6 [3320TÀG (Leu1107Arg)], *7 [1177CÀT (Arg393Trp)], *8 [1202AÀG (Tyr401Cys)], and *9 [2358CÀA (Asp786Glu)] were found each in only one subject as heterozygote at a 0.002 frequency.
X
ABCC2 p.Arg393Trp 18445995:88:139
status: NEW93 This analysis predicted a possible functional change of Leu1107Arg (*6) due to substitution in (146) the transmembrane region (PHAT matrix element difference＝－6), and probable functional effects of Arg393Trp (*7) (PSIC score difference＝3.053), Tyr401Cys (*8) (3.382) and Asp786Glu (*9) (2.277), but no functional effects of *3 (1.446) and *5 (0.326).
X
ABCC2 p.Arg393Trp 18445995:93:214
status: NEW[hide] Genetic background of Japanese patients with adult... Hepatol Res. 2007 Oct;37(10):777-83. Epub 2007 May 22. Hayashi H, Wakusawa S, Yano M, Okada T
Genetic background of Japanese patients with adult-onset storage diseases in the liver.
Hepatol Res. 2007 Oct;37(10):777-83. Epub 2007 May 22., [PMID:17517077]
Abstract [show]
In contrast to primary lysosomal diseases in young subjects, adult-onset liver storage disorders may be explained by non-lysosomal genetic defects. The aim of the present review is to summarize the genetic backgrounds of Japanese patients with hemochromatosis of unknown etiology, Wilson disease of primary copper toxicosis, and the black liver of Dubin-Johnson syndrome. Three patients with middle-age onset hemochromatosis were homozygous for mutations of HJV and two patients were homozygous for mutations of TFR2. Minor genes other than HJV and TFR2 might be involved in Japanese patients. Five of the six patients with Wilson disease were compound heterozygous, while the remaining patient was heterozygous for the mutation in ATP7B responsible for copper toxicosis. Involvement of MURR1 was not proved in the heterozygote of ATP7B. Because of ferroxidase deficiency,most patients had secondary lysosomes shared by cuprothioneins and iron complex. Six patients with Dubin-Johnson syndrome were homozygous or compound heterozygous for mutant MRP2. Despite complex metabolic disorders, the syndrome had a single genetic background. Thus, most patients with adult-onset lysosomal proliferation in the liver had genetic defects in non-lysosomal organelles, named the secondary lysosomal diseases. The proliferating lysosomes in these conditions seemed to be heterogeneous in their matrices.
Comments [show]
None has been submitted yet.
No. Sentence Comment
64 They included the three mutations 1177C > T (R393W), 2026G > C (G676R) and 2125T > C (W709R) first found in our patients.23,49,52 Better understanding of the pathogenesis of hepatic storage disorders provided by gene analysis The genetic backgrounds of Japanese patients with hemochromatosis are now partially clear.
X
ABCC2 p.Arg393Trp 17517077:64:45
status: NEW76 Fifty years after the first identification of lysosomes,1,2 three Table 3 Results of mutation analysis for patients with Dubin-Johnson syndrome Patient Age (years)/Sex MRP2 Mutation 1 Mutation 2 1 21/male 298C > T (R100X) 298C > T (R100X) 2 26/male 1177C > T (R393W) 2302C > T (R768W) 3 23/female 1967 + 2T > C (1901del67: exon 15 skipping) 1967 + 2T > C (1901del67: exon 15 skipping) 4 25/male 1967 + 2T > C (1901del67: exon 15 skipping) 2026G > C (G676R) 5 28/female 2125T > C (W709R) 2125T > C (W709R) 6 28/male 2439 + 2T > C (2272del168: exon 18 skipping) 2439 + 2T > C (2272del168: exon 18 skipping) adult-onset storage disorders of the liver were found to be secondary lysosomal diseases with the genetic defects outside of lysosomes.
X
ABCC2 p.Arg393Trp 17517077:76:260
status: NEW[hide] The apical conjugate efflux pump ABCC2 (MRP2). Pflugers Arch. 2007 Feb;453(5):643-59. Epub 2006 Jul 18. Nies AT, Keppler D
The apical conjugate efflux pump ABCC2 (MRP2).
Pflugers Arch. 2007 Feb;453(5):643-59. Epub 2006 Jul 18., [PMID:16847695]
Abstract [show]
ABCC2 is a member of the multidrug resistance protein subfamily localized exclusively to the apical membrane domain of polarized cells, such as hepatocytes, renal proximal tubule epithelia, and intestinal epithelia. This localization supports the function of ABCC2 in the terminal excretion and detoxification of endogenous and xenobiotic organic anions, particularly in the unidirectional efflux of substances conjugated with glutathione, glucuronate, or sulfate, as exemplified by leukotriene C(4), bilirubin glucuronosides, and some steroid sulfates. The hepatic ABCC2 pump contributes to the driving forces of bile flow. Acquired or hereditary deficiency of ABCC2, the latter known as Dubin-Johnson syndrome in humans, causes an increased concentration of bilirubin glucuronosides in blood because of their efflux from hepatocytes via the basolateral ABCC3, which compensates for the deficiency in ABCC2-mediated apical efflux. In this article we provide an overview on the molecular characteristics of ABCC2 and its expression in various tissues and species. We discuss the transcriptional and posttranscriptional regulation of ABCC2 and review approaches to the functional analysis providing information on its substrate specificity. A comprehensive list of sequence variants in the human ABCC2 gene summarizes predicted and proven functional consequences, including variants leading to Dubin-Johnson syndrome.
Comments [show]
None has been submitted yet.
No. Sentence Comment
139 Although all sequence variants associated with Dubin-Johnson syndrome result in the absence of a Table 3 Nucleotide sequence variants in the human ABCC2 gene (NM_000392) leading to amino acid changes in the ABCC2/MRP2 protein (NP_000383) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references Exon 2 c.56 C>Te p.P19L Probably damaging T: 0.007 [63] Exon 2 c.116 T>A p.F39Y Benign A: 0.010 rs927344 A: 0.008 rs17222603 Exon 3 c.298 C>T p.R100Xf DJS [154] Exon 3 c.299 G>Ae p.R100Q Possibly damaging A: 0.007 [63] Exon 7 c.736 A>C p.M246L Benign C: 0.002 rs8187667 C: 0.002 rs17222744 Exon 7 c.842 G>A p.S281N Benign A: 0.0060.056 [117] Exon 8 c.998 A>G p.D333G Possibly damaging G: 0.002 rs8187668 G: 0.004 rs17222674 Exon 9 c.1058 G>A p.R353H Benign A: 0.009 rs7080681 A: 0.014 rs17216205 Exon 9 c.1177 C>T p.R393W DJS Probably damaging [104, 112] Exon 10 c.1234 A>G p.R412G Probably damaging Deficient methotrexate transport function [56] Exon 10 c.1249 G>A p.V417I Benign None apparent [50] A: 0.163 rs2273697, [146] A: 0.158 rs17216184 A: 0.125 [62] A: 0.1830.312 [117] Exon 10 c.1457 C>T p.T486I Benign T: 0.002 rs8187670 T: 0.002 rs17222589 Exon 11 c.1483 A>G p.K495E Possibly damaging G: 0.002 rs8187672 G: 0.002 rs17222561 Exon 13 c.1686 T>G p.F562L Benign G: 0.002 rs8187673 G: 0.002 rs17216233 Exon 16 c.2009 T>C p.I670T Benign rs8187676 C: 0.006 rs17222632 Exon 16 c.2026 G>C p.G676R DJS Probably damaging [181] Exon 17 c.2125 T>C p.W709R DJS Probably damaging [111] Exon 17 c.2153 A>G p.N718S Possibly damaging rs3740072 Exon 17 c.2215 C>T p.L739F Probably damaging T: 0.006 [51] Exon 18 c.2302 C>T p.R768W DJS Probably damaging Deficient maturation and impaired sorting [47] T: 0.010 [62] [168, 180] Exon 18 c.2366 C>T p.S789F Probably damaging Reduced protein levels [50] T: 0.010 [62] Exon 19 c.2546 T>G p.L849R Benign G: 0.002 rs8187689 G: 0.006 rs17222617 Exon 20 c.2647 G>Ae p.D883N Benign A: 0.007 [63] Exon 20 c.2677 G>C p.E893Q Benign rs3740071 Exon 21 c.2882 A>Ge p.K961R Benign G: 0.007 [63] Exon 22 c.2901 C>A p.Y967Xf A: 0.002 rs8187683 A: 0.002 rs17222547 Exon 22 c.2944 A>G p.I982V Benign G: 0.002 rs8187684 G: 0.002 rs17222554 Exon 22 c.3057 G>Te p.Q1019H Benign T: 0.007 [63] Exon 23 c.3107 T>C p.I1036T Possibly damaging C: 0.002 rs8187685 C: 0.004 rs17216149 Exon 23 c.3188 A>G p.N1063S Benign G: 0.002 rs8187686 G: 0.002 rs17222540 Exon 23 c.3196 C>T p.R1066Xf DJS No ABCC2 protein in liver [134] Exon 25 c.3449 G>A p.R1150H DJS Probably damaging Deficient transport function A: 00.009 [117] Exon 25 c.3517 A>T p.I1173F DJS Probably damaging Deficient maturation and impaired sorting, deficient transport function T: 00.029 [117] [80, 117] Exon 25 c.3521 G>Ae p.R1174H Probably damaging A: 0.007 [63] Exon 25 c.3542 G>T p.R1181L Possibly damaging T: 0.039 rs8187692 T: 0.034 rs17222702 Exon 25 c.3563 T>A p.V1188E Benign A: 0.059 rs8187694 A: 0.059 rs17222723 Exon 26 c.3732 T>Ge p.N1244K Possibly damaging G: 0.014 [63] Exon 27 c.3817 A>G p.T1273A Benign G: 0.002 rs8187699 G: 0.004 rs17222582 Exon 27 c.3825 C>G p.Y1275Xf DJS No ABCC2 protein in liver [104] Exon 28 c.3872 C>T p.P1291L Possibly damaging T: 0.012 rs8187700 T: 0.010 rs17216317 Exon 28 c.3895 A>C p.K1299Q Benign rs4148400, [146] Exon 28 c.3928 C>T p.R1310Xf DJS [166] Exon 29 c.4100 C>Ge p.S1367C Possibly damaging G: 0.007 [63] Exon 29 c.4145 A>G p.Q1382R DJS Probably Deficient [47, 168] Table 3 (continued) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references functionally active ABCC2 protein from the canalicular membrane, their effects on the synthesis and function of the ABCC2 protein differ.
X
ABCC2 p.Arg393Trp 16847695:139:1022
status: NEW140 Although all sequence variants associated with Dubin-Johnson syndrome result in the absence of a Table 3 Nucleotide sequence variants in the human ABCC2 gene (NM_000392) leading to amino acid changes in the ABCC2/MRP2 protein (NP_000383) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references Exon 2 c.56 C>Te p.P19L Probably damaging T: 0.007 [63] Exon 2 c.116 T>A p.F39Y Benign A: 0.010 rs927344 A: 0.008 rs17222603 Exon 3 c.298 C>T p.R100Xf DJS [154] Exon 3 c.299 G>Ae p.R100Q Possibly damaging A: 0.007 [63] Exon 7 c.736 A>C p.M246L Benign C: 0.002 rs8187667 C: 0.002 rs17222744 Exon 7 c.842 G>A p.S281N Benign A: 0.0060.056 [117] Exon 8 c.998 A>G p.D333G Possibly damaging G: 0.002 rs8187668 G: 0.004 rs17222674 Exon 9 c.1058 G>A p.R353H Benign A: 0.009 rs7080681 A: 0.014 rs17216205 Exon 9 c.1177 C>T p.R393W DJS Probably damaging [104, 112] Exon 10 c.1234 A>G p.R412G Probably damaging Deficient methotrexate transport function [56] Exon 10 c.1249 G>A p.V417I Benign None apparent [50] A: 0.163 rs2273697, [146] A: 0.158 rs17216184 A: 0.125 [62] A: 0.1830.312 [117] Exon 10 c.1457 C>T p.T486I Benign T: 0.002 rs8187670 T: 0.002 rs17222589 Exon 11 c.1483 A>G p.K495E Possibly damaging G: 0.002 rs8187672 G: 0.002 rs17222561 Exon 13 c.1686 T>G p.F562L Benign G: 0.002 rs8187673 G: 0.002 rs17216233 Exon 16 c.2009 T>C p.I670T Benign rs8187676 C: 0.006 rs17222632 Exon 16 c.2026 G>C p.G676R DJS Probably damaging [181] Exon 17 c.2125 T>C p.W709R DJS Probably damaging [111] Exon 17 c.2153 A>G p.N718S Possibly damaging rs3740072 Exon 17 c.2215 C>T p.L739F Probably damaging T: 0.006 [51] Exon 18 c.2302 C>T p.R768W DJS Probably damaging Deficient maturation and impaired sorting [47] T: 0.010 [62] [168, 180] Exon 18 c.2366 C>T p.S789F Probably damaging Reduced protein levels [50] T: 0.010 [62] Exon 19 c.2546 T>G p.L849R Benign G: 0.002 rs8187689 G: 0.006 rs17222617 Exon 20 c.2647 G>Ae p.D883N Benign A: 0.007 [63] Exon 20 c.2677 G>C p.E893Q Benign rs3740071 Exon 21 c.2882 A>Ge p.K961R Benign G: 0.007 [63] Exon 22 c.2901 C>A p.Y967Xf A: 0.002 rs8187683 A: 0.002 rs17222547 Exon 22 c.2944 A>G p.I982V Benign G: 0.002 rs8187684 G: 0.002 rs17222554 Exon 22 c.3057 G>Te p.Q1019H Benign T: 0.007 [63] Exon 23 c.3107 T>C p.I1036T Possibly damaging C: 0.002 rs8187685 C: 0.004 rs17216149 Exon 23 c.3188 A>G p.N1063S Benign G: 0.002 rs8187686 G: 0.002 rs17222540 Exon 23 c.3196 C>T p.R1066Xf DJS No ABCC2 protein in liver [134] Exon 25 c.3449 G>A p.R1150H DJS Probably damaging Deficient transport function A: 00.009 [117] Exon 25 c.3517 A>T p.I1173F DJS Probably damaging Deficient maturation and impaired sorting, deficient transport function T: 00.029 [117] [80, 117] Exon 25 c.3521 G>Ae p.R1174H Probably damaging A: 0.007 [63] Exon 25 c.3542 G>T p.R1181L Possibly damaging T: 0.039 rs8187692 T: 0.034 rs17222702 Exon 25 c.3563 T>A p.V1188E Benign A: 0.059 rs8187694 A: 0.059 rs17222723 Exon 26 c.3732 T>Ge p.N1244K Possibly damaging G: 0.014 [63] Exon 27 c.3817 A>G p.T1273A Benign G: 0.002 rs8187699 G: 0.004 rs17222582 Exon 27 c.3825 C>G p.Y1275Xf DJS No ABCC2 protein in liver [104] Exon 28 c.3872 C>T p.P1291L Possibly damaging T: 0.012 rs8187700 T: 0.010 rs17216317 Exon 28 c.3895 A>C p.K1299Q Benign rs4148400, [146] Exon 28 c.3928 C>T p.R1310Xf DJS [166] Exon 29 c.4100 C>Ge p.S1367C Possibly damaging G: 0.007 [63] Exon 29 c.4145 A>G p.Q1382R DJS Probably Deficient [47, 168] Table 3 (continued) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references functionally active ABCC2 protein from the canalicular membrane, their effects on the synthesis and function of the ABCC2 protein differ.
X
ABCC2 p.Arg393Trp 16847695:140:1022
status: NEW[hide] Identification of a novel 974C-->G nonsense mutati... Am J Gastroenterol. 2006 Oct;101(10):2427-32. Epub 2006 Sep 4. Corpechot C, Ping C, Wendum D, Matsuda F, Barbu V, Poupon R
Identification of a novel 974C-->G nonsense mutation of the MRP2/ABCC2 gene in a patient with Dubin-Johnson syndrome and analysis of the effects of rifampicin and ursodeoxycholic acid on serum bilirubin and bile acids.
Am J Gastroenterol. 2006 Oct;101(10):2427-32. Epub 2006 Sep 4., [PMID:16952291]
Abstract [show]
Rifampicin (RIF) and ursodeoxycholic acid (UDCA) therapies have beneficial effects in chronic cholestatic diseases. These may result in part from the induction of multidrug-resistance protein 2 (MRP2/ABCC2) expression in the liver and kidney. However, the precise mechanisms by which RIF and UDCA act in cholestasis remain unclear. In the present study, we report the effects of chronic administration of both drugs in a patient with Dubin-Johnson syndrome (DJS), an inherited autosomal recessive disorder characterized by the absence of functional MRP2 protein at the canalicular hepatocyte membrane. A novel 974C-->G nonsense mutation was identified in the MRP2 gene sequence from this patient. RIF induced further increase in conjugated bilirubinemia, whereas concomitant administration of RIF and UDCA led to a dramatic rise in serum bile acid concentrations. These biochemical effects, which are in marked contrast to those observed in cholestatic settings, were concomitant with an increased MRP3, but not MRP4, expression on basolateral hepatocyte membrane. Such findings highlight the key role of MRP2 in the pharmacological properties of RIF and UDCA and suggest that both drugs should be used with caution in pathologic settings in which MRP2 expression may be downregulated, as in advanced stage of cholestatic diseases.
Comments [show]
None has been submitted yet.
No. Sentence Comment
78 Mutations in the MRP2/ABCC2 Gene Associated with DJS Nucleotide Mutation Exon Predicted Effect Reference 298C→T 3 R100X 27 974C→G 8 S325X This article IVS8 + 4A→G Intron 8 Aberrant splicing 28 1177C→T 9 R393W 29 1256insCT/ delAAACAG TGAACCT- GATG 10 Frameshift 30 1271A→G 10 R412G 31 1815 + 2T→A 13 Skipped exon 32, 33 1967 + 2T→C 15 Skipped exon 34, 35 2026G→C 16 G676R 35 2125T→C 17 W709R 36 2302C→T 18 R768W 32, 37, 38 2439 + 2T→C 18 Skipped exon 32, 35, 37 3196C→T 23 R1066X 39, 40 3449G→A 25 R1150H 41 3517A→T 25 I1173F 41 3928C→T 28 R1310X 27, 33 4145A→G 29 Q1382R 37 4175delGGATGA 30 R1392 + M1393 deletion 40 4292delCA 30 Frameshift 30 DISCUSSION Identification of a Novel Nonsense Mutation of the MRP2/ABCC2 Gene Up to now, 18 mutations in the sequence of the MRP2/ABCC2 gene have been reported in DJS, including nonsense mutations, deletions, splicing junction mutations, and missense mutations (Table 1).
X
ABCC2 p.Arg393Trp 16952291:78:227
status: NEW[hide] Mutational analysis of the MRP2 gene and long-term... J Gastroenterol. 2005 Apr;40(4):366-70. Machida I, Wakusawa S, Sanae F, Hayashi H, Kusakabe A, Ninomiya H, Yano M, Yoshioka K
Mutational analysis of the MRP2 gene and long-term follow-up of Dubin-Johnson syndrome in Japan.
J Gastroenterol. 2005 Apr;40(4):366-70., [PMID:15870973]
Abstract [show]
BACKGROUND: Recent studies have indicated that dysfunction or loss of the multidrug resistance protein 2 (MRP2) is the molecular basis of Dubin-Johnson syndrome (DJS). To clarify the genetic basis of the disease and the long-term stability of serum bilirubin levels, we conducted a mutational analysis of the MRP2 gene and followed up serum bilirubin levels in Japanese DJS patients 30 years after they were originally diagnosed, based on traditional criteria. METHODS: Patients were interviewed by telephone, and blood tests, including a genetic analysis of MRP2, were performed on the patients and family members who gave informed consent. RESULTS: Over the 30 years, hyperbilirubinemia remained unchanged in four of the five patients studied, while it worsened in 1 patient whose DJS was complicated by chronic hepatitis C. From an MRP2 gene mutational analysis, six mutations, including the novel mutation 1177C>T, were found. Three patients of a consanguineous family were homozygotes for three mutations (298C>T, 1967+2T>C, and 2439+2T>C). Two patients were compound heterozygotes (1177C>T/2302C>T and 1967+2T>C/2026G>C). A familial study showed no difference in serum bilirubin levels between mutant/wild heterozygotes and wild/wild homozygotes. CONCLUSIONS: The hyperbilirubinemia of four Japanese patients with DJS, one of whom had a novel mutation, 1177C>T, of the MRP2 gene, had not worsened with aging.
Comments [show]
None has been submitted yet.
No. Sentence Comment
45 The mutation 1177CϾT in exon 9, found in patient 3 (entry ID, case 4), was a novel one, which introduced a missense mutation of Arg393Trp in the intracellular region of the MRP2 protein (Fig. 1).
X
ABCC2 p.Arg393Trp 15870973:45:134
status: NEW63 The mutation was predicated to cause the mutation Arg393Trp in the amino-acid sequence of the MRP2 protein.
X
ABCC2 p.Arg393Trp 15870973:63:50
status: NEW66 298CϾT Gly100Stop 14 1177CϾT Arg393Trp Novel 1967ϩ2TϾC 1901del67 (exon 15 skipping) 12 2026GϾC Gly676Arg 6 2302CϾT Arg768Trp 13 2439ϩ2TϾC 2272del168 (exon 18 skipping) 8 a b immunohistochemical analysis, the mechanism by which this mutation impairs the canalicular transport of conjugated bilirubin remains unclear.
X
ABCC2 p.Arg393Trp 15870973:66:41
status: NEW67 The effect of 1177CϾT (Arg393Trp) on the maturation or function of the MRP2 protein should be determined in the near future, by establishing stably transfected cells expressing the mutant protein.
X
ABCC2 p.Arg393Trp 15870973:67:29
status: NEW